Abstract
In this study, we characterize a new function for activator of stress response genes (Asg1) in fatty acid utilization. Asg1 is required for full activation of genes in several pathways, including β-oxidation (POX1, FOX2, and POT1), gluconeogenesis (PCK1), glyoxylate cycle (ICL1), triacylglycerol breakdown (TGL3), and peroxisomal transport (PXA1). In addition, the transcriptional activator Asg1 is found to be enriched on promoters of genes in β-oxidation and gluconeogenesis pathways, suggesting that Asg1 is directly involved in the control of fatty acid utilizing genes. In agreement, impaired growth on non-fermentable carbons such as fatty acids and oils and increased sensitivity to some oxidative agents are found for the Δasg1 strain. The lipid class profile of the Δasg1 cells grown in oleate displays approximately 3-fold increase in free fatty acid (FFA) content in comparison to glucose-grown cells, which correlates with decreased expression of β-oxidation genes. The ∆asg1 strain grown in glucose also exhibits higher accumulation of triacylglycerols (TAGs) during log phase, reaching levels typically observed in stationary phase cells. Altered TAG accumulation is partly due to the inability of the Δasg1 cells to efficiently break down TAGs, which is consistent with lowered expression of TGL3 gene, encoding triglycerol lipase. Overall, these results highlight a new role of the transcriptional regulator Asg1 in coordinating expression of genes involved in fatty acid utilization and its role in regulating cellular lipid accumulation, thereby providing an attractive approach to increase FFAs and TAGs content for the production of lipid-derived biofuels and chemicals in Saccharomyces cerevisiae.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Production of biofuels as a clean, renewable, environment-friendly, and sustainable source of alternative energy has recently attracted substantial research interests. Biofuels derived from microorganisms, including yeasts, are gaining more attention due to several advantages in comparison to plant-derived oils. These include short life cycle of the microorganisms, reducing production time, and the fact that microbial growth can be independent of climate and season. Previous studies of lipid production in the oleaginous yeast Yarrowia lipolytica showed that its fatty acids’ profile is similar to vegetable oils, suggesting potential use as a replacement for plant oils in biofuel production (Beopoulos et al. 2011). The baker’s yeast Saccharomyces cerevisiae is a well-suited unicellular organism used in various industrial and biotechnological processes, including production of bioethanol and pharmaceutical components. In addition to its robustness and feasibility for upscaling and commercial processes, the S. cerevisiae genome and metabolic pathways are also well-documented. These properties make the model S. cerevisiae yeast suitable for the strain development and pathway engineering (Dyer et al. 2002; Nielsen and Jewett 2008; Veen and Lang 2004). Currently, S. cerevisiae is applied as a host for the production of fatty acid-derived biofuels and fuel chemicals to replace vegetable oils or animal fats which are food sources with high costs for biofuel production (Papanikolaou et al. 2002; Zhou et al. 2014).
S. cerevisiae can utilize a wide variety of substrates including fatty acids as a source of carbon (Schüller 2003). Extensive studies have demonstrated that manipulation of genes, either overexpression or deletion of genes in the fatty acid synthetic pathway (FAA1, FAA4, or ACC1), alters accumulation and composition of free fatty acids (FFAs) which are important precursors for the biosynthesis of triacyglycerol (TAG), a starting material in the transesterification reaction for the production of fatty acid methyl/ethyl esters (FAMEs/FAEE (biodiesel)), and fatty acy-CoA for production of fatty alcohols and alka(e)nes in S. cerevisiae (Runguphan and Keasling 2014; Scharnewski et al. 2008), oleaginous yeasts (Haddouche et al. 2011; Sitepu et al. 2014), or Escherichia coli (Janssen and Steinbüchel 2014; Lennen and Pfleger 2013). In addition to FFAs, S. cerevisiae accumulates storage lipids in the form of TAGs at approximately 10 % of dry cell weight or less. Overexpression of genes encoding fatty acyl synthetases (FAS1 and FAS2), acetyl-CoA carboxylase (ACC1), and diacyl-glycerol acyltransferase (DGA1), as well as the deletion of isocitrate dehydrogenases IDH1 and IDH2, in S. cerevisiae strains expressing ATP-citrate lyase (ACL1), are shown to enhance TAG levels (Chen et al. 2014; Li et al. 2014; Runguphan and Keasling 2014; Tang et al. 2013). Furthermore, disruption of the SNF2 gene, encoding the catalytic subunit of the SWI/SNF chromatin remodeling complex, strongly boosts TAG accumulation, suggesting an extensive involvement of transcriptional control over TAG and fatty acid biosynthesis (Kamisaka et al. 2006). Alternatively, to enhance fatty acid biosynthesis, blocking the pathway of fatty acid degradation has also been shown to increase FFA accumulation (Chen et al. 2014). In S. cerevisae, fatty acid breakdown is mediated by the β-oxidation pathway, responsible for breaking down fatty acids to generate acetyl-CoA (Kohlwein et al. 2013).
Zinc cluster proteins form a major class of transcription regulators in the yeast S. cerevisiae. They contain a Zn2Cys6 binuclear cluster DNA-binding motif with the consensus sequence of Cys-X2-Cys-X6-Cys-X5–12-Cys-X2-Cys-X6–8-Cys. Zinc cluster transcriptional regulators are associated with many cellular processes, such as sugar, amino acid, carbon, and nitrogen metabolism (MacPherson et al. 2006). Other zinc cluster regulators control expression of genes involved in the metabolism of non-fermentable carbon sources or in lipid metabolism (Turcotte et al. 2010). For example, Upc2 plays a primary role in regulating the expression of ergosterol biosynthetic genes and has a secondary role in anaerobic sterol uptake and in controlling expression of DAN/TIR cell wall gene, encoded mannoprotein (Abramova et al. 2001; Hartman et al. 2001). Zinc cluster transcriptional regulators Oaf1 and Pip2 regulate genes involved in β-oxidation in response to the presence of oleate (Rottensteiner et al. 1996). The Sut1 regulator activates genes, involved in sterol uptake under anaerobic conditions, and is involved in hypoxic gene expression (Bourot and Karst 1995; Ness et al. 2001). Adr1 is a Cys2His2 regulator that is also important for yeast growth on fatty acids and is involved in the regulation of gene-encoding peroxisomal proteins, including FOX2 and POT1 (Gurvitz et al. 2000). Cells lacking Adr1 show no growth on media containing fatty acids as a sole carbon source. Recently, Tog1 regulator of zinc cluster proteins was found to induce expression of β-oxidation genes in response to a shift from glucose to oleate (Thepnok et al. 2014).
The objective of this study was to characterize the involvement of a lesser-known zinc cluster protein Asg1 (also called Yil130w) in fatty acid metabolism. Phenotypes of the Δasg1 strain on fatty acids and oils as sole carbon sources and in the presence of oxidative agents were examined. Expression levels of selected genes related to fatty acid utilization and binding enrichment of Asg1 at the promoters of these genes were investigated during growth on oleate. High-performance liquid chromatography (HPLC) analysis was also employed to identify lipid classes in the Δasg1 cells grown in glucose or following the glucose-oleate shift. These analyses should allow for a better understanding of the contribution of the Asg1 regulator to the control of lipid utilizing genes as well as its effect on fatty acid accumulation.
Materials and methods
Yeast strains
The S. cerevisiae zinc cluster deletion Δasg1 strain was derived from the wild-type strain FY73 (MATa; his3-Δ200; ura3–52) which is isogenic to S288C (Winston et al. 1995). The FY73 and the Δasg1 strains, kindly provided by B. Turcotte (McGill University, Canada), were used for phenotypic, gene expression, and lipid analyses. The obtained Δasg1 strain was previously constructed by disrupting a part of the open reading frame (ORF) of ASG1 gene, encoding zinc cluster protein by using the PCR method with HIS3 as a marker for selection and confirmed via Southern blot analysis, as performed and described (Akache et al. 2001; Baudin et al. 1993). Again, the resulting Δasg1 strain was verified by PCR using primers specific for HIS3 marker with a pair of primers located downstream of the ASG1 ORF with the oligo primer 5′-TTGCAGTTTATCACCATTAT and the primer 5′TTACTCTTGGCCTCCTCTAG (located in the 5′-end of the HIS3 marker) (data not shown). The S. cerevisiae strains BY4742 (MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0) and the isogenic strain Δasg1 (MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; yil130w::kanMX4) were obtained and used (Winzeler et al. 1999) while the W303 strain (MATα, leu2–3112, trp1–1, can1–100, ura3–1, ade2–1, his3-Jl,15) and the corresponding Asg1-Myc tagged strain used in ChIP analysis, were also kindly provided by B. Turcotte. The W303 strain expressing N-terminally Myc tagged-Asg1 was constructed and verified by J. Drolet as previously described (Drolet 2007; Schneider et al. 1995).
Phenotypic analysis of the yeast strains on lipid-containing media and in the presence of oxidative agents
To screen for the involvement of the zinc cluster Asg1 in the utilization of fatty acid as a sole carbon source, a phenotypic analysis of zinc cluster deletion strains Δasg1 (in FY73, BY4742, and W303 backgrounds), and the revertant ASG1 strain (FY73) was performed. For construction of the ASG1-revertant strain, the pRS316-ASG1 plasmid was constructed using oligos:
ASG1F:5′-CGCGGATCCCCGTAGGAGGAGAGTCTGGACC and ASG1R:5′-AAA GCGGCCGCTCATTCAGAGGGGTAATTTAAAG for PCR amplification of the promoter region (1000 bp upstream of the ATG codon) and the ORF of ASG1 gene with high fidelity polymerase (Thermo Fisher Scientific, NY, USA). The amplified fragment was inserted into the vector pRS316 (Sikorski and Hieter 1989) to obtain the pRS316-ASG1 which was checked for correct insertion at BamHI and NotI site using restriction digest with the enzymes BamHI and NotI (New England Biolabs, Ipswich, MA, USA). After, the wild-type FY73 and the Δasg1 strains were transformed with either the empty vector pRS316 or pRS316-ASG1 and checked for growth on SD-Ura plates, containing 0.67 % yeast nitrogen base without amino acids (Himedia Laboratories, Mumbai, India), 2 % dextrose (Himedia Laboratories, Mumbai, India), and supplement of yeast synthetic dropout medium without uracil (Sigma-Aldrich, Rehovot, Israel). After, cells were grown in yeast extract/peptone/dextrose (YPD) medium containing 1 % yeast extract, 2 % peptone, and 2 % dextrose (Himedia Laboratories, Mumbai, India) and incubated at 30 °C overnight. They were then serially diluted with distilled water to an optical density (OD600) of 0.1, 0.04, 0.0062, and 0.0015, respectively. Ten microliters of each dilution was spotted onto YP plates containing different fatty acids or oils as sole carbon sources at a final concentration of 0.125 % oleic acid, 0.125 % linoleic acid, 0.125 % palmitic acid, 0.125 % stearic acid, 10 mg/ml palm oil, or 10 mg/ml sunflower oil. Fatty acids and oils were emulsified in 0.5 % Tween 80 (LabChem, Zelienople, PA, USA).
To examine the sensitivity of yeast zinc cluster deletion strains to oxidative stress, cells were challenged with H2O2 and menadione. Mid-log phase cells (OD600 of 0.8) were exposed to menadione solubilized in DMSO, for 1 h at 30 °C and 100 rpm. Cells were serially diluted and spotted on YPD plates, followed by incubation at 30 °C for 2–3 days to monitor the growth. To compare the growth of the Δasg1 strain in FY73 and in BY4742 and W303 backgrounds, cells were again prepared as previously described prior to being spotted on plates containing either glucose or oleate as a sole source of carbon or in the presence of 4.0 or 5.0 mM H2O2. For cell viability assay, viability of the wild-type cells and the Δasg1 strains were determined, using the colony counting method on YPD agar plates following exposure to H2O2 and menadione. Yeast cell cultures were grown overnight in YPD medium at 30 °C with shaking and then diluted into fresh media to a final OD600 of 0.1. Cells were grown until the mid-log phase and then exposed to 0.4 mM menadione in DMSO, for 1 h at 30 °C with shaking. Following the exposure to menadione, cells were serially diluted and spread onto YPD agar plates and incubated at 30 °C for 2–3 days. The viability of cells was calculated by comparing the number of colonies formed from non-exposed and exposed cultures. These results were normalized using values from the wild-type strain and presented as a percentage of viable cells.
Culture conditions for lipid analysis
Yeast cell cultures were grown in YPD medium at 30 °C with shaking overnight and then diluted to an OD600 of 0.1 in 100 ml of YPD and regrown until reaching the exponential growth phase (OD600 of 0.6), then divided into half, harvested by centrifugation, and washed twice with distilled water. Cells were resuspended in YP medium containing 0.125 % oleic acid emulsified with Tween 80 and allowed to grow for an additional 3 h. To examine lipid composition in cells during the stationary phase of growth, cells were inoculated at OD600 of 0.1 in YPD medium and incubated for 96 h, harvested, and washed at least twice with deionized water prior to being used for analysis of lipid composition.
Lipid extraction
Harvested cells from 50 ml of culture were mixed with 10 ml of methanol and disrupted with glass beads by vortexing. Chloroform was then added to the cell suspension (chloroform/methanol 2:1 (v/v)) and stirred for 1 h. The extract was filtered, mixed with 10 ml of 0.345 % MgCl2 and centrifuged. Afterwards, the upper layer was removed by aspiration. Ten milliliters of 2 M KCl/methanol (4:1 (v/v)) was then added to the organic phase. Samples were again centrifuged, and the upper aqueous layer was again aspirated. The organic phase was washed twice with 10 ml of chloroform/methanol/water (3:48:47 (v/v)). The solvent was evaporated in a rotary evaporator at 55 °C and 200 mbar. The lipid film was weighed and dissolved in toluene.
HPLC analysis
HPLC was performed to analyze the lipid composition from yeast cells. Extracted lipids that were dissolved in toluene were injected into a HPLC system which was equipped with a Sedex 75 Evaporative Light Scattering Detector (ELSD; Sedere, Alfortville, France). Detector temperature was set at 30 °C, and N2 gas pressure was set at 2 bar. Data was collected and processed by CSW32 HPLC software (DataApex Ltd., Prague, Czech Republic). Samples were analyzed in a 100 Å Phenogel column (300 mM × 7.8 mM ID, 5 μm) (Phenomenex, Torrance, CA, USA). The column and injector were put in an oven set at 65 °C. The mobile phase comprised of 100 % toluene and 0.25 % acetic acid. Flow rate for the mobile phase was 1.0 ml/min.
Gene induction and RT-qPCR
Yeast cells were cultured in 5 ml of YPD medium at 30 °C with shaking overnight. Cell cultures were diluted to an OD600 of 0.1 in YPD medium and grown until reaching the OD600 of 0.6. Cultures were then divided in half, and cells were grown either in 2 % glucose or 0.125 % oleic acid induction conditions for an additional 3 h. Cells were washed with diethylpyrocarbonate (DEPC) water, and pellets were used for RNA extraction, purification, and reverse transcription quantitative PCR (RT-qPCR) analysis. The wild-type and ∆asg1 strains were grown as described above. Total RNA was isolated by the hot acid phenol method and purified using a Rneasy Mini Kit (Qiagen, Hilden, Germany), and cDNA synthesis employed a Super Script™ III first-strand synthesis kit (Life Technologies, Carlsbad CA, USA). RT-qPCR was performed using an Mx3005P QPCR system with MxPro QPCR software for analysis (Agilent Technologies, Santa Clara CA, USA). The reaction mixture contained Brilliant II SYBR Green QPCR Mix (Kapa Biosystems, Wilmington, MA, USA). DNA sequences of the oligonucleotides used for RT-qPCR analysis are given in Table 1. The relative quantification of each transcript was calculated by the 2-ΔΔCt method (Livak and Schmittgen 2001) and normalized using the ACT1 (actin) gene.
Chromatin immunoprecipitation assays
Yeast cells from wild-type W303 and Myc-Asg1 tagged strains were grown as previously described for gene induction. The chromatin immunoprecipitation (ChIP) assays were performed as described (Larochelle et al. 2006; Soontorngun et al. 2007) with minor modifications. Equal amounts of whole-cell extracts from each sample were incubated with anti-Myc antibody (12CA5) (Roche, Mannheim, Germany) coupled with magnetic beads (Dynabeads, Oslo, Norway). Following immunoprecipitation and cross-link reversal, DNA was purified and used for QPCR analysis with an ABI 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA) with the gene-specific oligos listed in Table 1. The binding enrichments were calculated using the 2-ΔΔCt method (Livak and Schmittgen 2001), and the values were normalized with the non-tagged strain.
Results
Impaired growth on fatty acids and increased sensitivity to oxidative stress of the Δasg1 strain
Akache and co-workers previously demonstrated that some zinc cluster deletion strains, including a strain with deletion in the YIL130W (ASG1) gene, display impaired growth on glycerol and lactate (Akache et al. 2001). Here, we further tested the ability of the zinc cluster ∆asg1 strain (the FY73 genetic background) to utilize fatty acids and oils including oleic, linoleic, palmitic, and steric acids as well as palm and sunflower oils as a sole source of carbon. Our phenotypic analysis revealed that the ∆asg1 strain grows poorly when these compounds are used as a sole carbon source (Fig. 1a), suggesting a role of Asg1 in non-fermentable carbon utilization of fatty acids. To test whether the observed defective phenotypes were specific to the S. cerevisiae FY73 background, we also examined growth of the Δasg1 strain in BY4742 and W303 backgrounds by growing cells on oleate and linoleate as a sole source of carbon and in the presence of H2O2, the oxidant commonly produced during the β-oxidation of fatty acids (Kunau and Hartig 1992) The results showed that the growth of the Δasg1 (BY4742 and W303 genetic backgrounds) strains on oleate and linoleate is normal unlike what is observed for the Δasg1 (FY73 background) strain (Fig. 1b). Since oxidation of fatty acids is known to produce H2O2 , it could result in cellular oxidative stress and reduced growth rate and cell viability (Hatem et al. 2014; Kurita 2003; Minard and McAlister-Henn 1999). The effect of ASG1 deletion on sensitivity to oxidative stress was also tested with oxidative agents such as H2O2 and menadione. Menadione is commonly used as a source of reactive oxygen species (ROS). This quinone compound when reduced to a semiquinone produces various ROS such as superoxide ion, hydrogen peroxide and hydroxyl radical (Stohs and Bagchi 1995). Here, the results demonstrated that the ∆asg1 strain shows impaired growth in the presence of 3.0, 4.0, or 5.0 mM H2O2 and upon exposure to menadione at a final concentration of 0.6, 0.8, and 1 mM (Fig. 1a). Interestingly, the sensitivity to H2O2 was found to be similarly impaired in all three genetic backgrounds tested. Overall, the results suggest specific growth impair on fatty acids and common hypersensitive phenotype of the Δasg1 strains among these S. cerevisiae genetic backgrounds tested (Fig. 1b).
To confirm that Asg1 in the FY73 background contributes to the defective phenotypes on fatty acids and during H2O2 exposure, a centromeric vector pPRS316-ASG1 which contains the original ASG1 promoter and the open reading frame of ASG1 gene was constructed and transformed into the Δasg1 (FY73) strain for the phenotype analysis via spot tests. The results showed that growth of the Δasg1 (FY73) is rescued on oleate or linoleate as a sole carbon source and in the presence of oxidizing agent H2O2 (Fig. 1c), supporting the contribution of Asg1 in the utilization of these two fatty acids and increased tolerance to H2O2 stress. To confirm results of the spot test, cell viability assay was also performed. It was observed that the ∆asg1 strain displays increased sensitivity to 2.0 or 3.0 H2O2 and 0.4 mM menadione stress with 32.9, 12.6, and 18.4 % viability as compared to the wild-type FY73 strain, respectively (data not shown). Both spot and viability assays revealed an increased sensitivity of the ∆asg1 strain to the oxidative agents (Figs. 1a and data not shown), suggesting an important role of Asg1 during oxidative metabolism and in cellular defense against harmful oxidative agents.
Asg1 regulates expression of lipid utilization genes
The β-oxidation, the glyoxylate shunt, and the gluconeogenesis are important processes involved in lipid degradation and generation of important metabolites during non-fermentative metabolism (Schüller 2003; Turcotte et al. 2010). Since Asg1 encodes a putative transcriptional regulator in the zinc cluster protein family, we hypothesized that Asg1 may play a role in controlling expression of genes involved in fatty acid breakdown, β-oxidation, or other downstream pathways that are required for the utilization of fatty acids. To test this potential role of Asg1, RT-qPCR analysis was performed to determine the expression of key oleate utilizing genes that encode peroxisomal transporter (PXA1), triacylglycerol lipase (TGL3), β-oxidation (POX1, FOX2 and POT1), glyoxylate cycle (ICL1), or gluconeogenic (PCK1) enzymes. The expression of these genes was examined in the Δasg1 strain in comparison to the wild-type FY73 strain, following the glucose-oleate shift. Expression levels of these genes were enhanced in response to the oleate shift, in agreement with previous reports (Karpichev and Small 1998; Karpichev et al. 1997). Interestingly, deletion of ASG1 reduced the expression level of POX1 and POT1 by approximately 2.6-fold, 3.7-fold for MDH2, and 5.2-, 4.7-, and 6.7-fold for TGL3, PXA1, and FOX2, respectively (Fig. 2). Likewise, the expression of ICL1 and PCK1 was almost absent in the Δasg1 strain compared to the wild-type FY73 strain (Fig. 2). The transcript levels were also measured to include the known regulatory genes CAT8, ADR1, OAF1, and PIP2 in the Δasg1 strain. However, the results showed that following oleate induction, deletion of ASG1 gene does not alter the expression levels of these regulatory genes with the relative expression levels (Δasg1/WT) of 0.7-, 1.1-, 0.9-, and 1.3-fold for CAT8, ADR1, OAF1, and PIP2, respectively, as compared to the wild-type strain (data not shown). This suggests that the Asg1 regulator may directly activate genes, involved in fatty acid utilization and breakdown as well as those in the glyoxylate cycle and gluconeogenesis.
Since the Asg1 was required to activate some key genes involved in the β-oxidation and the gluconeogenesis, we further investigated whether the Asg1 regulator is directly bound to the promoters of these genes. Standard ChIP assays were performed using a Myc-tagged Asg1 under conditions in which cells are shifted from glucose- to oleate-containing medium. A substantial binding enrichment of Asg1 was found at promoters of the genes necessary for the utilization of non-fermentable carbon sources. Binding enrichment of the zinc cluster transcriptional regulator Asg1 was observed at the promoters of POX1, FOX2, and POT1 genes, encoding enzymes in β-oxidation, PCK1 and MDH2 genes, encoding key enzymes phosphoenolpyruvate carboxykinase and malate dehydrogenase, respectively, of the gluconeogenesis (Fig. 3). Binding of Asg1 was observed at positions upstream of the ATG start codons on promoters of POX1 (between −112 and −469 bp), FOX2 (between −102 and −430 bp), POT1 (between (−23 and −346 bp), PCK1 (between −450 and −150 bp), and MDH2 (between −500 and −300 bp) relative to the ATG codon. In contrast, there was no binding enrichment on ACT1 gene (Fig. 3). Thus, the Asg1 activator was enriched at promoters of genes in central pathways for the utilization of non-fermentable compounds, and not exclusively genes for oleate utilization.
Increased lipid content and percentage abundance of free fatty acids in the ∆asg1 strain
Yeast cells are known to accumulate neutral lipids mainly as TAG in the stationary phase of growth. TAG is an essential lipid for maintaining energy homeostasis and is a precursor or a buliding block for the synthesis of structural lipids and other important components of membranes. It is also used to support rapid growth and division of cells (Czabany et al. 2007). During the exponential phase of growth, when cells divide rapidly, TAGs are continuously consumed. However, in the stationary phase, cell division decreases, and TAG is stored (Sandager et al. 2002). Since our RT-qPCR analysis indicated that Asg1 is involved in the regulation of TGL3, a gene for triacylglycerol lipase (Fig. 2), we questioned whether the Δasg1 strain’s ability to break down TAG was impaired. Since defective breakdown of TAG would alter the lipid content and composition, the neutral lipid content in wild-type and ∆asg1 cells grown in glucose-containing medium during the stationary phase of growth (96 h) were determined. Lipid content in the wild-type FY73 strain was found to be approximately 0.011 g/g of lipid per cell dry weight whereas the Δasg1 strain contained 0.043 g/g of lipid per cell dry weight after 96 h of cultivation in glucose (Table 2). This was approximately a 4-fold increase in lipid content (Table 2), confirming that the Δasg1 strain accumulated more lipid than in the wild-type strain. Our results suggested that the inability to breakdown TAGs is one contributing factor for the elevated total lipid content observed for the Δasg1 strain.
The lipid profile of the ∆asg1 strain was also analyzed using HPLC analysis. The TAG and SE were found as major neutral lipids. As expected, results indicated that the percentage abundance of TAG and SE of the wild-type FY73 glucose-grown cells (the exponential growth phase) is lower than when cells are grown to the stationary phase (Table 2). In contrast, a similar trend was found for the percentage abundance of TAG and SE of the glucose-grown Δasg1 cells in both phases of growth (Table 2). A similar trend was found for the percentage abundance of free fatty acids (FFA) (Table 2), indicating that the Δasg1 strain is unable to break down triacylglyceride. For the wild-type FY73 strain, during the exponential phase of growth, the FFA percentage abundance was found to be similar for glucose-grown and glucose-oleate shifted cells (Table 2). Interestingly, FFA percentage abundance of the ∆asg1 strain following the glucose-oleate shift was found to be approximately 2-fold higher than that of wild-type cells, cultured in glucose-containing medium (Table 2), supporting that yeast cells that are unable to utilize fatty acids as a sole carbon source because they display compromised β-oxidation activity and therefore accumulate FFA.
Discussion
Here, the transcriptional role of the zinc cluster transcription factor Asg1 in fatty acid utilization was shown by RT-qPCR and ChIP analyses which demonstrates that Asg1 regulator induces the expression of several oleate utilizing genes namely the PXA1, POX1, FOX2, POT1, ICL,1 and PCK1 genes and binds to POX1, FOX2, POT1, MDH2, and PCK1 promoters in response to oleate induction, respectively (Figs. 2 and 3). A model for Asg1 function in controlling oleate utilization is provided in Fig. 4. Many Asg1 target genes encode proteins that are required for effective degradation of fatty acids, and some of which are localized in the peroxisomes. First, Asg1 regulates expression of the PXA1 gene (Fig. 2) encoding a peroxisomal transporter that facilitates the passage of fatty acids and metabolites across the peroxisomal membrane, allowing for cross-talk between this organelle and other subcellular compartments. Deletion of PXA1 and PXA2 genes results in impaired fatty acid oxidation and poor growth on the medium, containing long-chain fatty acids as a sole carbon source, even though the genes for the β-oxidation pathway remain intact (Beopoulos et al. 2011). In addition, activation of medium-chain fatty acids also occurs in the peroxisome through the action of acyl-CoA synthetase. Acyl-CoA substrates are subsequently oxidized to trans-2-enoyl-CoA by the peroxisomal acyl-CoA oxidase Pox1 (also called Fox1) whose expression is also controlled by the Asg1 regulator (Figs. 2 and 3). A by-product of this reaction is excess H2O2 which can damage cellular macromolecules through toxic ROS. Whenever the concentration of ROS exceeds the antioxidant buffering capacity, cells experience oxidative stress, leading to cell death (Costa and Moradas-Ferreira 2001). Antioxidant systems thereby play important roles in neutralizing H2O2 and ROS and in repairing damaged macromolecules. Importantly, it is conserved in all genetic backgrounds that Asg1 is involved in stress response to oxidizing agent such as H2O2, an interesting role for future detail examination. Asg1 may act to coordinate cellular responses to tolerate oxidative stress, a common phenomenon during non-fermentative metabolism and oxidation of fatty acids.
Continuing to the β-oxidation process, trans-2-enoyl-CoA is subsequently processed to 3-ketocyl-CoA by Pot1 peroxisomal oxoacyl thiolase (Erdmann 1994), another target of Asg1 (Figs. 2 and 3), to yield acetyl-CoA and C2-shortened acyl-CoA which can then enter either the glyoxylate or the tricarboxylic acid (TCA) cycles to generate ATPs and metabolic intermediates. Asg1 is also involved in activation of the glyoxylate ICL1 gene (Figs. 2 and 3) for conversion of glyoxylate and acetyl-CoA to malate (Fernandez et al. 1992) and at least two key gluconeogenic genes MDH2 and PCK1 (Figs. 2 and 3) for generation of glucose-6-phospate, important precursors for several cellular pathways (Minard and McAlister-Henn 1991; Valdes-Hevia et al. 1989). Regarding triacylglerol degradation, the enzyme triacylglycerol lipases (Tgl3–5) act to hydrolyze TAGs to provide diacyl-glycerol and free fatty acids (Athenstaedt and Daum 2003) and are essential for membrane lipid biosynthesis, as well as for energy production (Beopoulos et al. 2011). Cells lacking these TGL genes are unable to utilize TAGs, and lipids are accumulated inside the cells as lipid bodies, composed predominantly of neutral lipid TAGs (Dulermo et al. 2013). Expression of TGL3 as well as other fatty acid-utilizing genes partially depends on the Asg1 regulator (Fig. 2) which also explains the altered level of TAG and fatty acid contents observed in the Δasg1 strain (Table 2). Interestingly, Asg1 is enriched in promoter regions that contain cis-acting oleate-responsive elements (OREs), important for the induction of β-oxidation as well as carbon source responsive elements (CSREs) of the key gluconeogenic gene PCK1, suggesting a direct role in the up-regulation of their expression (Figs. 2 and 3, (Gurvitz and Rottensteiner 2006; Hiltunen et al. 2003)). The increased FFA percentage abundance of the ∆asg1 strain also corelates well with the decreased expression of fatty acid β-oxidation pathway which prevents the conversion of FFAs to acetyl-CoA (Table 2 and Fig. 2).
Our data shows that defective transcriptional control of β-oxidation genes is one contributing factor for observed poor growth phenotypes of the Δasg1 strain on fatty acids and oils. The deletion of ASG1 results in poor growth on several fatty acids (in FY73 background) and renders the cells sensitive to oxidative agents (Fig. 1). Since the impaired utilization on oleate and linoleate of the Δasg1 is specific to the FY73 background, it implies that the observed defective growth is partly contributed by deletion of ASG1 gene while the other causes also possibly contribute. Deletion in the ASG1 gene is tolerated differently by laboratory strains of S. cerevisiae, being viable in the BY4742 and W303 backgrounds on oleate and other non-fermentable carbon sources (Fig. 1 and data not shown) but dead in the FY73 (S288C-derived) background, suggested that the lethality of ASG1 deletions in the FY73 background may be suppressed by an allele specific to the BY4742 or W303 background. A similar example of the observed phenotypic variation has been elegantly demonstrated, using the synthetic genetic array analysis and mapping approach to identify suppressor of the lethality linked to the Cbk1 kinase signaling pathway (Jorgensen et al. 2002). In fact, several genes whose products buffer one another or impose on the same essential pathway have been uncovered in S. cerevisiae (Tong and Boone 2006). Second, impaired peroxisomal proliferation and morphology may also be possible as shown by S. cerevisiae the Δpip2, the Δtog1, and the Δadr1 strains with deletion in genes encoding activators of β-oxidation and peroxisomal genes. The Δpip2 mutant lacking the peroxisomal activator Pip2 displays a reduction of peroxisomal content with many lipid droplets in the cells and low expression level of PMP27 that is required for incorporating peroxisomal membrane proteins (Rottensteiner et al. 1996). Similarly, the Δtog1 strain in the FY73 background shows reduced numbers of peroxisomes when cells are shifted from glucose to oleate (Thepnok et al. 2014). Lower expression of PEX11 encoding peroxin, for peroxisome proliferation, has also been observed for the Δadr1 strain (Gurvitz et al. 2001). Also, the mitochondrial stability may differ for the each yeast backgrounds, and this could influence growth and phenotypic outcomes. Thirdly, the poor growth of the ∆asg1 strain (FY73 background) on some fatty acids and hypersensitivity to oxidizing agents of the Δasg1 strain in the FY73 background may be partly due to the toxicity from the excessive accumulation of FFAs. It has been reported that high FFAs promote the formation of harmful reactive intermediates (ROS) and ceramide (Listenberger et al. 2003; Sorger and Daum 2003) or reduced expression levels or enzymatic activity of oxiding enzymes. Lastly, Asg1 appears to have a redundant function in fatty acid or non-fermentable carbon utilization with other regulators in the regulatory network of non-fermentable carbon metabolism in S. cerevisiae, including Oaf1, Pip2, Znf1, Tog1, Cat8, Sip4, Adr1, and Rds2 (Gurvitz and Rottensteiner 2006; Soontorngun et al. 2012; Tangsombatvichit et al. 2015; Thepnok et al. 2014; Turcotte et al. 2010) as shown by some overlapping target genes (Figs. 2 and 3) which explains for functional redundancy. Nevertheless, a phenotypic screening of Candida albicans mutants reveals that C. albicans ASG1 is also necessary for growth on non-fermentative carbon sources (Coste et al. 2008).
Furthermore, the inability of the Δasg1 strain (FY73 background) to break down fatty acids provides some important advantages, suggesting a new approach to increase the content of FFAs in addition to disruption of individual genes of β-oxidation pathway which has been previously demonstrated (Li et al. 2014). Importantly, the Δasg1 strain grows normally in glucose (Fig. 1) and contains approximately four times higher lipid yield and double FFA percentage abundance compared to the wild-type FY73 strain under glucose conditions (Table 2). Thus, this strain in the FY73 background is more suitable for glucose-based lipid production. Despite the poorer growth of the Δasg1 strain in oleate-containing plates (Fig. 1), this strain accumulates extracellular FFAs (Table 2). This may be beneficial in bioremediation for treating and recycling industrial wastewater, containing high FFA content. The yeast with FFA/lipid accumulation could also be harnessed for microbial lipid extraction (Haddouche et al. 2011; Runguphan and Keasling 2014; Scharnewski et al. 2008; Sitepu et al. 2014). In support, previous research on some mutants of S. cerevisiae and Y. lipolytica also demonstrate that yeast can accumulate a large amount of lipids in cells which are disrupted in POX1-6 genes, encoding peroxisomal acyl-CoA oxidases. Resulting Δpox1-6 deletion strain lacks the ability to utilize fatty acids as a sole carbon source which leads to increased cellular lipid accumulation (Beopoulos et al. 2008). Inactivation of TGL3 and/or TGL4 has been shown to double the amount of lipids and increase the accumulation of TAGs in Y. lipolytica (Dulermo et al. 2013). Some studies have successfully applied the Yarrowia yeast for the production of microbial lipids from industrial waste, promising a renewable and low-cost source of starting raw materials (Azocar et al. 2010; Cheirsilp and Louhasakul 2013; Koch et al. 2014; Louhasakul and Cheirsilp 2013). Increased understanding of Asg1’s function in lipid metabolism of the model yeast S. cerevisiae may offer new strategies for metabolic engineering and construction of oleaginous yeast strains lacking Asg1 homologs for fatty acid- or triacylglycerol-derived biofuel production. Despite the complexity of lipid metabolism and complicated cellular processes, genetic manipulation in S. cerevisae merits further investigation.
References
Abramova NE, Cohen BD, Sertil O, Kapoor R, Davies KJA, Lowry CV (2001) Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae. Genetics 157(3):1169–1177
Akache B, Wu K, Turcotte B (2001) Phenotypic analysis of genes encoding yeast zinc cluster proteins. Nucleic Acids Res 29(10):2181–2190
Athenstaedt K, Daum G (2003) YMR313c/TGL3 encodes a novel triacylglycerol lipase located in lipid particles of Saccharomyces cerevisiae. J Biol Chem 278(26):23317–23323
Azocar L, Ciudad G, Heipieper HJ, Munoz R, Navia R (2010) Improving fatty acid methyl ester production yield in a lipase-catalyzed process using waste frying oils as feedstock. J Biosci Bioeng 109(6):609–614
Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Cullin C (1993) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21(14):3329–3330
Beopoulos A, Nicaud JM, Gaillardin C (2011) An overview of lipid metabolism in yeasts and its impact on biotechnological processes. Appl Microbiol Biotechnol 90(4):1193–1206
Beopoulos A, Mrozova Z, Thevenieau F, Le Dall MT, Hapala I, Papanikolaou S, Chardot T, Nicaud JM (2008) Control of lipid accumulation in the yeast Yarrowia lipolytica. Appl Environ Microbiol 74(24):7779–7789
Bourot S, Karst F (1995) Isolation and characterization of the Saccharomyces cerevisiae SUT1 gene involved in sterol uptake. Gene 165(1):97–102
Cheirsilp B, Louhasakul Y (2013) Industrial wastes as a promising renewable source for production of microbial lipid and direct transesterification of the lipid into biodiesel. Bioresour Technol 142:329–337
Chen L, Zhang J, Chen WN (2014) Engineering the Saccharomyces cerevisiae β-oxidation pathway to increase medium chain fatty acid production as potential biofuel. PLoS One 9(1):e84853
Costa V, Moradas-Ferreira P (2001) Oxidative stress and signal transduction in Saccharomyces cerevisiae: insights into ageing, apoptosis and diseases. Mol Asp Med 22(4–5):217–246
Coste AT, Ramsdale M, Ischer F, Sanglard D (2008) Divergent functions of three Candida albicans zinc-cluster transcription factors (CTA4, ASG1 and CTF1) complementing pleiotropic drug resistance in Saccharomyces cerevisiae. Microbiology 154(Pt 5):1491–1501
Czabany T, Athenstaedt K, Daum G (2007) Synthesis, storage and degradation of neutral lipids in yeast. Biochim Biophys Acta 1771(3):299–309
Drolet J (2007) Evidence for the involvement of the zinc cluster protein Asg1p in the transcriptional regulation of some stress response genes in Saccharomyces cerevisiae. McGill University, Montreal, Canada
Dulermo T, Treton B, Beopoulos A, Kabran Gnankon AP, Haddouche R, Nicaud JM (2013) Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: new insights into the role of intracellular lipases and lipid body organisation. Biochim Biophys Acta 1831(9):1486–1495
Dyer JM, Chapital DC, Kuan JW, Mullen RT, Pepperman AB (2002) Metabolic engineering of Saccharomyces cerevisiae for production of novel lipid compounds. Appl Microbiol Biotechnol 59(2–3):224–230
Erdmann R (1994) The peroxisomal targeting signal of 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae. Yeast 10(7):935–944
Fernandez E, Moreno F, Rodicio R (1992) The ICL1 gene from Saccharomyces cerevisiae. Eur J Biochem 204(3):983–990
Gurvitz A, Rottensteiner H (2006) The biochemistry of oleate induction: transcriptional upregulation and peroxisome proliferation. Biochim Biophys Acta 1763(12):1392–1402
Gurvitz A, Wabnegger L, Rottensteiner H, Dawes IW, Hartig A, Ruis H, Hamilton B (2000) Adr1p-dependent regulation of the oleic acid-inducible yeast gene SPS19 encoding the peroxisomal β-oxidation auxiliary enzyme 2,4-dienoyl-CoA reductase. Mol Cell Biol Res Commun 4(2):81–89
Gurvitz A, Hiltunen JK, Erdmann R, Hamilton B, Hartig A, Ruis H, Rottensteiner H (2001) Saccharomyces cerevisiae Adr1p governs fatty acid β-oxidation and peroxisome proliferation by regulating POX1 and PEX11. J Biol Chem 276(34):31825–31830
Haddouche R, Poirier Y, Delessert S, Sabirova J, Pagot Y, Neuveglise C, Nicaud JM (2011) Engineering polyhydroxyalkanoate content and monomer composition in the oleaginous yeast Yarrowia lipolytica by modifying the β-oxidation multifunctional protein. Appl Microbiol Biotechnol 91(5):1327–1340
Hartman JL, Garvik B, Hartwell L (2001) Cell biology—principles for the buffering of genetic variation. Science 291(5506):1001–1004
Hatem E, Berthonaud V, Dardalhon M, Lagniel G, Baudouin-Cornu P, Huang M-E, Labarre J, Chédin S (2014) Glutathione is essential to preserve nuclear function and cell survival under oxidative stress. Free Radic Biol Med 67:103–114
Hiltunen JK, Mursula AM, Rottensteiner H, Wierenga RK, Kastaniotis AJ, Gurvitz A (2003) The biochemistry of peroxisomal β-oxidation in the yeast Saccharomyces cerevisiae. FEMS Microbiol Rev 27(1):35–64
Janssen HJ, Steinbüchel A (2014) Production of triacylglycerols in Escherichia coli by deletion of the diacylglycerol kinase gene and heterologous overexpression of atfA from Acinetobacter baylyi ADP1. Appl Microbiol Biotechnol 98(4):1913–1924
Jorgensen P, Nelson B, Robinson MD, Chen Y, Andrews B, Tyers M, Boone C (2002) High-resolution genetic mapping with ordered arrays of Saccharomyces cerevisiae deletion mutants. Genetics 162(3):1091–1099
Kamisaka Y, Noda N, Tomita N, Kimura K, Kodaki T, Hosaka K (2006) Identification of genes affecting lipid content using transposon mutagenesis in Saccharomyces cerevisiae. Biosci Biotechnol Biochem 70(3):646–653
Karpichev IV, Small GM (1998) Global regulatory functions of Oaf1p and Pip2p (Oaf2p), transcription factors that regulate genes encoding peroxisomal proteins in Saccharomyces cerevisiae. Mol Cell Biol 18(11):6560–6570
Karpichev IV, Luo Y, Marians RC, Small GM (1997) A complex containing two transcription factors regulates peroxisome proliferation and the coordinate induction of β-oxidation enzymes in Saccharomyces cerevisiae. Mol Cell Biol 17(1):69–80
Koch B, Schmidt C, Daum G (2014) Storage lipids of yeasts: a survey of nonpolar lipid metabolism in Saccharomyces cerevisiae, Pichia pastoris, and Yarrowia lipolytica. FEMS Microbiol Rev 38(5):892–915
Kohlwein SD, Veenhuis M, van der Klei IJ (2013) Lipid droplets and peroxisomes: key players in cellular lipid homeostasis or a matter of fat—store 'em up or burn 'em down. Genetics 193(1):1–50
Kunau WH, Hartig A (1992) Peroxisome biogenesis in Saccharomyces cerevisiae. Antonie Van Leeuwenhoek 62(1–2):63–78
Kurita O (2003) Overexpression of peroxisomal malate dehydrogenase MDH3 gene enhances cell death on H2O2 stress in the ald5 mutant of Saccharomyces cerevisiae. Curr Microbiol 47(3):192–197
Larochelle M, Drouin S, Robert F, Turcotte B (2006) Oxidative stress-activated zinc cluster protein Stb5 has dual activator/repressor functions required for pentose phosphate pathway regulation and NADPH production. Mol Cell Biol 26(17):6690–6701
Lennen RM, Pfleger BF (2013) Microbial production of fatty acid-derived fuels and chemicals. Curr Opin Biotechnol 24(6):1044–1053
Li X, Guo D, Cheng Y, Zhu F, Deng Z, Liu T (2014) Overproduction of fatty acids in engineered Saccharomyces cerevisiae. Biotechnol Bioeng 111(9):1841–1852
Listenberger LL, Han X, Lewis SE, Cases S, Farese RV Jr., Ory DS, Schaffer JE (2003) Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc Natl Acad Sci U S A 100(6):3077–3082
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔ C T method. Methods 25(4):402–408
Louhasakul Y, Cheirsilp B (2013) Industrial waste utilization for low-cost production of raw material oil through microbial fermentation. Appl Biochem Biotechnol 169(1):110–122
MacPherson S, Larochelle M, Turcotte B (2006) A fungal family of transcriptional regulators: the zinc cluster proteins. Microbiol Mol Biol Rev 70(3):583–604
Minard KI, McAlister-Henn L (1991) Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol Cell Biol 11(1):370–380
Minard KI, McAlister-Henn L (1999) Dependence of peroxisomal β-oxidation on cytosolic sources of NADPH. J Biol Chem 274(6):3402–3406
Ness F, Bourot S, Regnacq M, Spagnoli R, Berges T, Karst F (2001) SUT1 is a putative Zn[II]2Cys6-transcription factor whose upregulation enhances both sterol uptake and synthesis in aerobically growing Saccharomyces cerevisiae cells. Eur J Biochem 268(6):1585–1595
Nielsen J, Jewett MC (2008) Impact of systems biology on metabolic engineering of Saccharomyces cerevisiae. FEMS Yeast Res 8(1):122–131
Papanikolaou S, Chevalot I, Komaitis M, Marc I, Aggelis G (2002) Single cell oil production by Yarrowia lipolytica growing on an industrial derivative of animal fat in batch cultures. Appl Microbiol Biotechnol 58(3):308–312
Rottensteiner H, Kal AJ, Filipits M, Binder M, Hamilton B, Tabak HF, Ruis H (1996) Pip2p: a transcriptional regulator of peroxisome proliferation in the yeast Saccharomyces cerevisiae. EMBO 15(12):2924–2934
Runguphan W, Keasling JD (2014) Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid-derived biofuels and chemicals. Metab Eng 21:103–113
Sandager L, Gustavsson MH, Stahl U, Dahlqvist A, Wiberg E, Banas A, Lenman M, Ronne H, Stymne S (2002) Storage lipid synthesis is non-essential in yeast. J Biol Chem 277(8):6478–6482
Scharnewski M, Pongdontri P, Mora G, Hoppert M, Fulda M (2008) Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling. FEBS J 275(11):2765–2778
Schneider BL, Seufert W, Steiner B, Yang QH, Futcher AB (1995) Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae. Yeast 11(13):1265–1274
Schüller HJ (2003) Transcriptional control of nonfermentative metabolism in the yeast Saccharomyces cerevisiae. Curr Genet 43(3):139–160
Sikorski RS, Hieter P (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122(1):19–27
Sitepu IR, Garay LA, Sestric R, Levin D, Block DE, German JB, Boundy-Mills KL (2014) Oleaginous yeasts for biodiesel: current and future trends in biology and production. Biotechnol Adv 32(7):1336–1360
Soontorngun N, Larochelle M, Drouin S, Robert F, Turcotte B (2007) Regulation of gluconeogenesis in Saccharomyces cerevisiae is mediated by activator and repressor function of Rds2. Mol Cell Biol 27(22):7895–7905
Soontorngun N, Baramee S, Tangsombatvichit C, Thepnok P, Cheevadhanarak S, Robert F, Turcotte B (2012) Genome-wide location analysis reveals an important overlap between the targets of the yeast transcriptional regulators Rds2 and Adr1. Biochem Biophys Res Commun 423(4):632–637
Sorger D, Daum G (2003) Triacylglycerol biosynthesis in yeast. Appl Microbiol Biotechnol 61(4):289–299
Stohs SJ, Bagchi D (1995) Oxidative mechanisms in the toxicity of metal ions. Free Radic Biol Med 18(2):321–336
Tang X, Feng H, Chen WN (2013) Metabolic engineering for enhanced fatty acids synthesis in Saccharomyces cerevisiae. Metab Eng 16:95–102
Tangsombatvichit P, Semkiv MV, Sibirny AA, Jensen LT, Ratanakhanokchai K, Soontorngun N (2015) Zinc cluster protein Znf1, a novel transcription factor of non-fermentative metabolism in Saccharomyces cerevisiae. FEMS Yeast Res 15(2):1–16
Thepnok P, Ratanakhanokchai K, Soontorngun N (2014) The novel zinc cluster regulator Tog1 plays important roles in oleate utilization and oxidative stress response in Saccharomyces cerevisiae. Biochem Biophys Res Commun 450(4):1276–1282
Tong AH, Boone C (2006) Synthetic genetic array analysis in Saccharomyces cerevisiae. Methods Mol Biol 313:171–192
Turcotte B, Liang XB, Robert F, Soontorngun N (2010) Transcriptional regulation of nonfermentable carbon utilization in budding yeast. FEMS Yeast Res 10(1):2–13
Valdes-Hevia MD, de la Guerra R, Gancedo C (1989) Isolation and characterization of the gene encoding phosphoenolpyruvate carboxykinase from Saccharomyces cerevisiae. FEBS Lett 258(2):313–316
Veen M, Lang C (2004) Production of lipid compounds in the yeast Saccharomyces cerevisiae. Appl Microbiol Biotechnol 63(6):635–646
Winston F, Dollard C, Ricupero-Hovasse SL (1995) Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C. Yeast 11(1):53–55
Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H, Chu AM, Connelly C, Davis K, Dietrich F, Dow SW, El Bakkoury M, Foury F, Friend SH, Gentalen E, Giaever G, Hegemann JH, Jones T, Laub M, Liao H, Liebundguth N, Lockhart DJ, Lucau-Danila A, Lussier M, M'Rabet N, Menard P, Mittmann M, Pai C, Rebischung C, Revuelta JL, Riles L, Roberts CJ, Ross-MacDonald P, Scherens B, Snyder M, Sookhai-Mahadeo S, Storms RK, Veronneau S, Voet M, Volckaert G, Ward TR, Wysocki R, Yen GS, Yu K, Zimmermann K, Philippsen P, Johnston M, Davis RW (1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285(5429):901–906
Zhou YJ, Buijs NA, Siewers V, Nielsen J (2014) Fatty acid-derived biofuels and chemicals production in Saccharomyces cerevisiae. Front Bioeng Biotechnol 2(32):1–6
Acknowledgments
We would like to express our deepest gratitude to Drs. B. Turcotte (McGill University, Canada) and L.T. Jensen as well as C. Booncherd (Mahidol University, Thailand) for their generous gift of strains, pRS316 vector and some chemical reagents, K. Aryusuk, K. Poomputsa, N. Jeyashoke, S. Cheevathanarak, and K. Rattanakhanokchai (KMUTT, Thailand) for kind pieces of advice. We wish to acknowledge S. Watanachaisereekul, P. Thepnok, P. Tangsombatvichit, A. Poonsawad, and A. Siriatcharanon (KMUTT, Thailand) for technical assistance. We also express our sincere thanks to L.T. Jensen (Mahidol University, Thailand), L. Szmelc and C. Butler (KMUTT, Thailand) for critical reading of the manuscript.
This work is supported by a grant from the National Research Council of Thailand (NRCT) to NS and NRTC graduate studentship to SJ. We also thank KMUTT for providing facilities, travel grants and additional support.
Author information
Authors and Affiliations
Corresponding author
Ethics declarations
Ethical statement
This article does not contain any studies with human participants or animals performed by any of the authors.
Conflict of interest
The authors declare that they have no competing interests.
Rights and permissions
About this article
Cite this article
Jansuriyakul, S., Somboon, P., Rodboon, N. et al. The zinc cluster transcriptional regulator Asg1 transcriptionally coordinates oleate utilization and lipid accumulation in Saccharomyces cerevisiae . Appl Microbiol Biotechnol 100, 4549–4560 (2016). https://doi.org/10.1007/s00253-016-7356-4
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00253-016-7356-4