Introduction

Microorganisms play an important role in biogeochemical cycles and recently have been assumed to have a considerable potential for agriculture use (Robe et al. 2003). Most of soil microorganisms have the ability to colonize plants, creating an association with them and increasing growth and yields. These microorganisms are commonly called plant growth promoting rhizobacteria (PGPR) (Maddonni et al. 2004). Among PGPR members of the genus Azospirillum are well known and commonly used bacteria in agriculture (Naiman et al. 2009). Bacteria with ability to fix nitrogen are frequent colonizer of grasses and cereal crops belonging to the genera Azospirillum, Acetobacter, Azoarcus, Enterobacter, and Herbaspirillum (Mehnaz et al. 2001). Recently much more attention has been paid to analyze the role of PGPR in improving plant growth under stress conditions (Díaz-Zorita et al. 2012; Zarea et al. 2012, Zarea 2017).

Azospirillum a Gram-negative, microaerophilic, non-fermentative soil bacterium lives in soil or found in association with plant. They are free-living nitrogen-fixing rhizosphere bacteria from the family Rhodospirillaceae. Azospirillum belongs to the group of bacteria known as associated bacteria with plant growth-promoting properties. At present, sixteen species of bacterial genus Azospirillum have been described (Zarea 2017); including 15 N-fixing and one non-N-fixing species (Reis et al. 2015). Mutualistic association between Azospirillum and various plant species, especially grain crops, has generated lots of interest. Growth promoting effect of Azospirillum on yield of staple crop under field conditions in different soils and climates has been elucidated (Zarea 2017). Positive response of various crops such as wheat, corn, soybean and rice to Azospirillum inoculation has been observed (Naiman et al. 2009). Positive impacts on plant growth following Azospirillum inoculation has been attained through several mechanisms including enhancement of macro- and micro nutrient content of plant, promotion of root development, production of growth regulators, nitrogen fixation and modulation of leaf anatomy (Okon 1994; García de Salamone et al. 1996; Naiman et al. 2009; Jafarian and Zarea 2016; Zarea 2017). A variety of Azospirillum species and other beneficial bacteria have been reported to have ability to colonize the root systems and above ground parts of plants such as rice (Khammas et al. 1989), wheat (Kopylov et al. 2009), maize (Mehnaz et al. 2007a, b), sugarcane, and other plants (Steenhoudt and Vanderleyden 2000). These bacteria benefit plant through several direct and indirect ways. Beneficial effects of PGPR have been attributed to the biological nitrogen fixation and productions of phytohormones such as IAA which results in promoting root development and consequently enhancing water uptake and nutrient absorption (Tien et al. 1979; Hartmann et al. 1983; Sharma et al. 2015; Puente et al. 2017).

Wheat (Triticum aestivum L.) is the world’s most cultivated and important cereal crop (Beche et al. 2014; Li et al. 2016; Feng et al. 2018). Wheat is the second most extensively grown crop throughout the world (Li et al. 2016). It is also one of the most important crops in arid and semi-arid areas of Iran. Genus Aegilops belong to the family Poaceace and have been assumed to have an important role in the evolution of bread wheat (Niranjana 2017).

The aim of our investigation was to isolate the native strains of Azospirillum from roots of wild wheat growing on mountainous regions of west Iran. This study was aimed to investigate and to determine the effect of the inoculation of these bacteria on grain yield and the nutrient content (N and P) of wheat plants grown under pot culture and dryland farming. Bacterial isolates were characterized and screened for plant growth promoting potential. The hypothesis of this study is that inoculation with indigenous PGPR can be an advantage and support establishment since native bacteria can easily adapt to the natural conditions and enhance the plant growth in this region (Zahid et al. 2015).

Materials and methods

Isolation of nitrogen fixing bacteria from wild wheat

Bacterial isolates were procured from the roots of wild wheat, Aegilops triuncialis and Aegilops speltoides, naturally growing in mountainous regions of west Iran. Roots, collected from different regions, were thoroughly washed with distilled sterile water to detach adhering soil. Roots were then cut into 1 cm long pieces and immersed in 5% NaCl solution for 10 min. We used 5% NaCl solution in order to cause plasmolysis of root cortex cells. This procedure led to better release of endophytic bacteria from inside of the root tissues. Root segments were then submerged into 10 cm vial of semi-solid NFb (N-free malate medium) (Döbereiner and Day 1976) and incubated at 25 °C for 7 days. After incubation, a loopful of the pellicle which formed beneath the surface of the medium was streaked on plates of modified RC medium (Table 1). DL-malic acid served as carbon sources for Azospirillum spp. as previously advised by Caceres (1982) for Azospirillum isolation. Yeast extract used at the rate of 0.5 g mL−1 in the medium supplies bacteria with vitamins and other growth factors. Some bacteria require vitamins and other growth factors for optimum growth and yeast extract is rich in vitamins, amino acids such as glycine, serine, and tyrosine, and minerals (Fujita and Hashimoto 1985; Chen et al. 2007). Two distinct colonies (named Sp1 and Sp2) were streaked on modified Rojo Congo (Congo red; RC), medium (Table 1) supplemented with 0.01 g L−1 yeast extract. RC medium was first introduced by Caceres (1982) as proper medium for isolation of Azospirillum spp. Both bacteria strains absorbed Congo red dye and became scarlet and dried with time.

Table 1 Modified RC medium used for the distinction between isolated colonies
Full size table

Indoleacetic acid (IAA) production assay

The ability of bacterial isolates to produce IAA was determined qualitatively on NFb medium. A colorimetric technique was performed using the Salkowski’s method (Ehmann 1977). Both bacterial strains were grown in NFb medium amended with 100 mg L−1 tryptophan. After incubation for 24 h at 28 °C with continuous shaking at 125 rpm, the broth was centrifuged at 10,000 rpm, for 15 min. One mL aliquot of the supernatant was mixed with Salkowski’s reagent at the ratio of 1:2 and incubated for 20 min under darkness at room temperature (Gordon and Weber 1951). Development of pink-red color was the sign of IAA production. Absorbance of the pink-red color was measured at 530 nm. The concentration of IAA was quantified using a standard curve of pure IAA solution.

PCR-amplification and 16S rRNA sequence analysis

Selected isolates were subjected to 16S rRNA sequencing analyses. The crude DNA was extracted according to the method described by Cheng and Jiang (2006) with some modifications. Strains were cultured in NFb medium supplemented with 1.5 mg L−1 yeast extract. Bacterial cultures were then incubated at 27 °C for 4 days with continuous shaking at 120 rpm. To extract the bacterial DNA, 1 ml cell suspension was centrifuged at 10,000 rpm for 3 min. After removing the supernatant, the cells were washed with 300 µl STE buffer twice (Cheng and Jiang 2006). The cells were then centrifuged at 10,000 rpm for 3 min. The pellets were re-suspended in 200 µl TE buffer. 400 µl phenol saturated with Tris (pH 8.0) was added to the tubes to lyse the cells, followed by a vortex-mixing step of 60 s. To separate the aqueous phase from the organic phase, the samples were subsequently centrifuged at 13,000 rpm for 10 min at 4 °C. 200 µl upper aqueous phase was then mixed with 200 µl chloroform and centrifuged for 5 min at 13,000 rpm at 4 °C. Amplification was carried out using the Az16S–D sequencing primers (Forward, 5′CCGCGGTAATACGAAGGGGGC; Reverse, 5′GCCTTCCTCCGGCTTGTCACCGGC) (Shime-Hattori et al. 2011). Amplified PCR products were separated on 1% agarose gel stained with ethidium bromide. A reaction mixture of 25 µL, containing 3 µL (15 ng) of template DNA, 15 µL of Master Mix, and 1.5 µL of each 10 µM forward and reverse primers, was prepared. The PCR was performed in a thermal cycler with an initial denaturation at 94 °C for 5 min followed by 33 cycles with denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s, and extension at 72 °C for 1 min and final extension at 72 °C for 7 min. Sequence similarity was determined by comparing the sequences from GenBank (National Center for Biotechnology Information; NCBI) with the BLAST program. Phylogenetic analysis was performed using the software package MEGA program, version 6 (Tamura et al. 2013). Bootstrap analysis was performed to test the statistical reliability of the topology of the neighbour-joining tree with 1000 bootstrap resamples of the data. Phylogenetic trees were constructed by the maximum-likelihood method using MEGA program, version 6 (Tamura et al. 2013). The sequences were deposited in the NCBI databank under the accession numbers MG282188 (Sp1) and MG384967 (Sp2).

Pot experiment

A pot experiment was designed to evaluate the plant growth promoting effects of bacterial isolates on wheat. Wheat seeds were first surface sterilized with 3% sodium hypochlroide for 5 min and then washed seven times with sterilized water. Vernalization was done by short-term exposing the seeds to low temperatures (4 °C) for 7 d. Vernalized Seeds were germinated in a sterile 15-cm Petri plates lined with two layers of 50-mm diameter sterile filter paper saturated with sterile water. Petri dishes were then incubated at 20 °C till radicles and root hairs appeared. Bacterial isolates were grown in NFb medium. Germinated seed with radicles 2–3 cm long were inoculated with suspension of washed overnight bacterial culture (107–108 cells mL−1). Germinated seeds were soaked in this prepared culture and kept shaking for 30 min at 25 °C. Autoclaved inocula were used as controls. Wheat seedlings were then transferred into 7 kg pots, filled with 6 kg sterilized soil. Each pot received equal amount of urea as source of nitrogen (6 g nitrogen pot−1). Urea was broadcast and incorporated below the soil surface of the pot. Triple superphosphate as sources of P at a rate of 3 g pot−1 was incorporated into the soil before sowing the seeds. Each treatment (control, inoculated with Sp1, inoculated with Sp2) was replicated 4 times. Fifteen healthy germinated seeds were transplanted in each pot and were then thinned to leave 5 seedlings per pot. Pots were kept inside a greenhouse for 6 months. After 120 days of planting, each plant was harvested, at 5 cm from the above soil level, decapitated and the shoot systems were weighed. Total nitrogen (N) was determined according to method described by Page et al. (1982). Various agronomic traits such as total dry biomass, grain and straw weights, harvest index (%), tiller and spike numbers plant−1, seed number spike−1, plant and spike height and weight of thousand-seeds were recorded. Spike weight and dried biomass were recorded from five randomly chosen plants after oven-dried at 70 °C until no change in weight was observed.

Field experiment

A field experiment was carried out to evaluate the plant growth promoting effects of Sp2 on wheat. Experiment was done under a semi-arid region where precipitation was a limiting factor for wheat growth. The field experiment was established in agricultural lands in Dehgolan County, Kurdistan Province (35°17′N, 47°22E, West Iran), located in a cool temperate region. The soil contains approximately 2% organic matter and soil pH ranges from 7.2 to 7.6. Experimental design was a randomized complete block with three replications. The treatments consisted of the presence and absence of seed inoculation with Sp2. Fields were plowed in the fall and cultivated in the spring. Long time between plowing and seed-bed preparation is usual in semiarid and arid areas of Iranian croplands. Seed-bed preparation was made at autumn when soil moisture was adequate for seed germination. Sowing was made following the first rain in autumn. The amount of rain must be sufficient to provide adequate moisture for seed to germinate. Therefore actual time of sowing during 2 years was not similar and dependent on the time of first adequate rainfall. The soil is classified as clay-loamy. Plot size was 3 m2. Bacterial isolate, Sp2, was grown in NFb medium. Seeds were inoculated with 1 mL suspension of washed overnight bacterial culture (107–108 cells mL−1). Plant density was 200 plants m2. Yield components and grain yield were estimated at seed maturity. From each treatment, at grain maturity growth stage, a 1 m2 of interior rows was cut and total grain yield was estimated. Agronomic components were estimated from 10 randomizely picked plants. Total spike per m2 was calculated by means of spike per plant × plant density m−2. All samples were cut from the middle rows to avoid border effects. Before threshing the bundles, numbers of spikes in each bundle were counted. Twenty stems were randomly selected from each bundle and each stem was threshed separately by hand. The seed number and kernel weight of each stem were measured. Nitrogen and phosphorus content in grains were measured at maturity growth stage. Grain nitrogen content was measured according to the method described by Van Schouwenberg and Walinge (1973). Ammonium vanadate-molybdate method described by Chapman and Pratt (1961) was followed to measure the phosphorus contents in grains.

Statistical analysis

Pot experiment was a randomized complete blocks with four replications of treatments. Field experiment was a randomized complete block design with four replications. Error variances for the 2 years were tested for homogeneity by Bartlett’s test. Combined analysis of variance was done. Traits had homogeneous error variances for both years. Collected, pooled data were subjected to ANOVA. For both pot and field experiments treatment effects were considered significant at P < 0.05. Least significant differences (LSD) tests (P < 0.05) were used to compare means within treatments.

Results

Isolation, characterization, and identification of strains

Root samples were collected from wild wheat roots, naturally growing in mountain region. Two distinct bacterial isolates were purified using NFb medium. Some biochemical and physiological characteristics of two isolates are listed in Table 2. Both bacterial isolates were able to grow on nitrogen-free medium. They did not grow properly when other carbohydrate compounds, glucose and sucrose, were served as sole carbon sources. Both bacterial isolates showed extremely slow growth on glucose as sole carbon source. Colonies of isolate Sp2 appeared to be longer in diameter than Sp1 in modified RC medium. Bacterial isolate Sp2 formed curved shaped colonies on modified RC medium in comparison to colonies of Sp1.

Table 2 Indole-3-acetic acid (IAA) of two bacterial isolates grown in NFb liquid medium supplemented with (+) and without (−) l-tryptophan (100 μg ml−1) (Means followed by same letters are not significantly different at 5% level)
Full size table

Indole-3-acetic acid (IAA) measured by colorimetric technique

The ability of both bacterial isolates to produce IAA was checked with use of Salkowski reagent. Isolates synthesized different IAA levels. Isolate Sp2 was more proficient producer of IAA in comparison to Sp1 (Table 2). Adding tryptophan to the NFb medium resulted in more IAA production compared with NFb without tryptophan. Sp2 produced 39.10 μg ml−1 IAA while Sp1 produced 36.97 μg ml−1 in NFb medium amended with 100 µg/ml dl-tryptophan. The photograph presented in Fig. 1 shows the phenotype of 1 and 4-day-old wheat plants inoculated with bacterial inoculum, Sp1 and Sp2.

Fig. 1
figure 1

Application of supernatants of Sp2 on early root growth (a) and in the seedling growth of bread wheat (b)

Full size image

16S rRNA Sequence analysis

Bacterial isolates were identified by using 16S rRNA. Figure 2 shows the phylogenetic tree based on 16S rRNA gene sequence, constructed by using the neighbour-joining method. Both bacterial isolates displayed homologies with other recognized species within the genus Azospirillum. Sp1 showed 99% homologies with the sequences in the GenBank database of Azospirillum brasilense. Homology of Sp2 with Azospirillum zeae strain Gr24 was 99%. The 16S rRNA gene sequences were deposited in the NCBI databank under the accession numbers MG282188 (Sp1) and MG384967 (Sp2).

Fig. 2
figure 2

Neighbor-joining tree phylogenetic analysis, with bootstrap values of 1000 replications at branch nodes, of isolates based on 16S rRNA gene sequences

Full size image

Efficacy of isolated strains in growth promotion of wheat under pot culture

Bacterial isolates were screened for their plant growth promoting ability. Wheat straw, grain yield, harvest index, plant and spike height, spike weight, and grain yield components, tiller number, seed number, 1000-seed weight, were significantly improved by both bacterial isolates (Table 3). However, both the parameters were significantly higher in plants inoculated with Sp2 than in plants inoculated with Sp1 (Table 3). Plants inoculated with Sp2 produced higher rates of wheat straw (14.94%), grain yield (23.12%), harvest index (6.9%), plant height (4.1%), spike height (9.2%), spike weight (8.2%), tiller number (10.5%), seed number (2.6%) and 1000-seed weight (11.81%) over those of plants inoculated with Sp1. Nitrogen content of grains was significantly increased by both isolates (Table 3). Plants inoculated with Sp2 had higher concentration of N (11.8%) in their grains over those of plants inoculated with Sp1.

Table 3 Effect of Azospirillum sp. isolated from wild wheat on some agronomic traits of bread wheat in 180-day-old plants under pot conditions
Full size table

Field efficacy of isolate Sp2

Isolate Sp2 was used to evaluate wheat yield response in the field. Isolate Sp2 produced a significant increase in the grain yield of wheat under dryland farming conditions. This resulted to a 18% increase over the uninoculated control (Table 4). Isolate Sp2 increased the 1000-seed weight by 7.81% in comparison to those of control plants. The number of spikes per m2 and seed number per spike of the inoculated plants were not significantly different from those of the non-inoculated plants. Phosphorus contents in the grains of the inoculated plants were not found to be significantly different from those of the uninoculated control plants (Table 4). Nitrogen content of grains were positively influenced by isolate Sp2 (Table 4). Inoculation increased the N content of grains by about 5.8%.

Table 4 Effect of Sp2 on wheat yield and nitrogen and phosphorus content of grains under dry land farming
Full size table

Discussion

In the present study, we isolated two bacterial strains of the genus Azospirillum from root interior of wild wheat naturally grown in the mountain region. Both bacterial strains showed excellent growth in the NFb medium, which is a putative selective medium for Azospirillum (Okon et al. 1977). Bacterial isolates were examined and characterized through molecular approach. Isolate Sp1 showed 99% similarity with A. brasilense which has been previously reported as a plant associated bacterium. The isolate Sp2 was identified as A. zeae having 99% homology with the reported gene sequence which has been reported as a plant growth promoting bacterium (Mehnaz et al. 2010). A. brasilense has been isolated from roots of diverse plants such as finger millet (Rai 1991), Triticum durum (Boyko et al. 2011) and strawberry (Fontana et al. 2018). A. zeae have been isolated from root of wheat (Venieraki et al. 2011) and rhizosphere soil of corn (Mehnaz et al. 2007a) and wheat (Ayyaz et al. 2016). Our findings showed that the wild wheat root is colonized by A. brasilense as well as A. zeae. This is the first report revealing the existence of A. zeae in the root of wild wheat in Iran. A. zeae was first isolated from roots of maize in Canada (Mehnaz et al. 2007a) and was reported as A. lipoferum (Mehnaz and Lazarovits 2006) but was later redescribed on the basis of a polyphasic taxonomic technique. Both bacterial strains failed to grow in NFb medium amended with sucrose or glucose. Previous studies indicated that Azospirillum cannot utilize disaccharides and prefer organic acids, such as malic over disaccharides sources (Westby et al. 1983).

Quantitative analysis revealed that both bacterial isolates have the ability to produce IAA. However, higher production was observed by Sp2. The present findings seem to be consistent with other researches which report that the ability to produce IAA is a major property of species of Azospirillum. The ability to form plant hormones has been postulated as a major property of PGPR in general and specifically, by the species of Azospirillum (Tsavkelova et al. 2006). Verma et al. (2011) showed that 88% of the evaluated Azospirillum strains (50 isolates) from maize soils were poor in IAA production indicating a substantial variability among Azospirillum strains for IAA production. The variation in the ability of plant growth promoting bacteria to produce IAA had also been observed earlier (Zahir et al. 2000; Majeed et al. 2015). Several factors have been assumed to be involved in IAA biosynthesis including genes involved and the presence of enzymes responsible for converting free IAA into conjugated forms (Patten and Glick, 1996). Both bacterial isolates preferred tryptophan for IAA production. l-Tryptophan is generally considered as an IAA precursor and its addition into culture medium results in enhancing of IAA biosynthesis by the IAA producing bacteria (Costacurta and Vanderleyden 1995). In the present study, the quantity of IAA produced by Sp2 in NFb supplemented with tryptophan was 39.10 μg ml−1. Venieraki et al. (2011) reported IAA production ranging from 29.8 and 194.8 mg L−1 by two A. zeae strains.

In order to evaluate the association between wheat and bacterial isolates, Sp1 and Sp2, a pot experiment was done. Based on the obtained result of pot trial, isolate Sp2 was used to assess wheat yield response in the field. Sp2 increased the yield of wheat under field conditions. The beneficial effect of Azospirillum as PGPR on increasing the yield of wheat under non-stress and stress conditions have been previously reported (Zarea et al. 2012; Jafarian and Zarea 2016; Zarea 2017). The plant growth promotion could be attributed to the result of plant growth hormone production, nitrogen fixation, and P solubilization. However Sp2 succeeded to increase the nitrogen content of the produced grains, suggesting the biological nitrogen fixation activity of this strain, but failed to increase the phosphorus content of grains, indicating no activity of phosphate solubilization under filed conditions. Phosphate-solubilizing activity of the Sp2 was assessed in vitro and it could solubilize insoluble inorganic phosphate in the modified Pikovskaya medium (data not shown). Ayyaz et al. (2016) have also reported failures of inoculations with three strains of Azospirillum to increase phosphorus contents in wheat grains and shoots. In the present study, Sp2 increased grain weight and total yield of wheat under field condition. Previous study indicated that total yield of wheat was significantly correlated (P < 0.01) with initial seed weights (Austen-Son and Walton 1970). Pervious experiments also showed that inoculation of wheat with Azospirillum increases the productivity of wheat (Santa et al. 2004; Piccinin et al. 2011, 2013; Ayyaz et al. 2016).

Auxin production has been assumed to have a major effect on attaining the early growth promotion in wheat (Khalid et al. 2004). Auxin is involved in root initiation and development and increases root surface area (Ivanchenko et al. 2010) and consequently assist the plant in increasing nutrient absorption by increased formation and development of better root systems (Dey et al. 2004; Gray and Smith 2005; Sukumar et al. 2013). Enhanced grain yield and N content of grains may also be related to the developed root system due to isolate application.

The field experiment was conducted under dryland farming. Drought is the most prevalent environmental stress and considered as one of the most important factor limiting wheat production under semi-arid and arid areas of Iran. Root system is the major organ of plants responsible for water and nutrient absorption. Root system influences plant growth and grain productivity (Palta and Yang 2014). Several PGPR (Azospirillum, Azoarcus, Azotobacter, Bacillus polymyxa, Burkholderia, Gluconoacetobacter or Herbaspirillum) have been known to fertilize several important crops such as wheat (Boddey et al. 1986). Inoculation of these PGPR with plants usually results in increase in plant’s dry weight, flowering and grain production (Pérez-Montaño et al. 2014). Improvement of yield caused by these PGPR could often be attributed to an increase in root development (Okon et al. 1998; Bashan et al. 2004; Pérez-Montaño et al. 2014). Developed root system allows plant to uptake water and minerals in a better way (Okon et al. 1998; Bashan et al. 2004; Pérez-Montaño et al. 2014). In the present study, bacterial isolates showed ability to produce IAA in vitro. Khalid et al. (2004) showed that those PGPR strains that produce high quantity of auxins in non-sterilized soil, cause maximum improvement in growth and yield of the wheat crop. In the present study, plants inoculated with Sp2 had higher amount of N content in their grains as well. Nitrogen nutrition has been elucidated to mitigate drought stress in crops. Nitrogen nutrition maintains metabolic activities of plant even at low tissue water potential (Zlatev and Lidon 2012; Abid et al. 2016). Pervious study demonstrated that photosynthetic rate under drought stress is closely related to the chlorophyll and N contents of the leaf (Park and Lee 2003). Previous studies have also reported that low N is the major constraint to wheat yield under drought stress (Madani et al. 2010; Abid et al. 2016). Nawaz et al. (2012) reported that early and late drought stress significantly decreases the N uptake by the wheat.

In the present study we report two strains of Azospirillum species associated with wild wheat, growing in mountainous regions of Iran. Both isolated bacterial strains have capability of IAA-production. Isolate A. zea Sp2 that produced higher level of auxins in vitro, and also caused higher N content in the grains under pot experiment, also enhanced growth and yield of the wheat under field conditions. Crop productivity in semiarid regions is mostly restricted by water availability. The results of this study show that under semiarid area conditions of Iran the production of wheat could be improved by using A. zea Sp2 leading to sustainable agriculture in these regions.