Introduction

Brain iron accumulation has a critical role in brain damage following intracerebral hemorrhage (ICH) [1, 2]. Iron overload after ICH leads to oxidative stress, blood-brain barrier leakage, brain edema, and brain cell death [1, 3, 4].

Ceruloplasmin (CP) is an abundant plasma glycoprotein that has ferroxidase activity. It can oxidize ferrous iron (Fe2+) to less toxic ferric iron (Fe3+) [5]. CP plays a role in brain iron homeostasis [5]. Previous studies have shown that CP is expressed in the cerebral cortex, basal ganglia, hippocampus, and cerebellum in the central nervous system [6]. Accumulated evidence demonstrates that CP deficiency is associated with several neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, and aceruloplasminemia [7]. However, little is known about the role of CP in brain injury after ICH.

The current study examined brain CP expression in a rat model of ICH. The effect of exogenous CP on brain injury induced by ferrous iron was also examined.

Material and Methods

Animal Preparation and Intracerebral Infusion

The University of Michigan Institutional Animal Care and Use Committee approved all animal procedure protocols. A total of 78 adult male Sprague–Dawley (SD) rats (250 to 350 g, Charles River Laboratories, Portage, MI) were used in this study. Four rats died during surgery. Rats were anesthetized with pentobarbital (45 mg/kg; i.p.) and body temperature maintained at 37 °C with a feedback-controlled heating pad. Rats were then placed in a stereotactic frame (David Kopf Instruments, Tujunga, CA) and a cranial burr hole (1 mm) drilled on the right coronal suture 3.5 mm lateral to the midline. A 26-gauge needle was inserted stereotaxically into the right basal ganglia (coordinates: 0.2 mm anterior, 5.5 mm ventral, and 3.5 mm lateral to the bregma). Autologous whole blood, ferrous iron, ferrous iron plus ceruloplasmin or saline were injected into the right basal ganglia with a microinfusion pump (Harvard Apparatus Inc.) at a rate of 10 μL/min. Sham controls had only an intracerebral needle insertion. The needle was then removed, the burr hole sealed with bone wax, and the incision sutured.

Experimental Groups

This study included two parts. The rats were randomized by using selection of odd or even numbers. In part one, rats had either needle insertion or intracerebral injection of 100 μL autologous whole blood into the right basal ganglia. The ICH rats were euthanized at 4 h, days 1, 3, and 7 (n = 9 each group). Sham rats were euthanized at day 3 (n = 9). The brains were processed for histology and RT-PCR.

In part two, rats received a 50 μL intracerebral injection of either 0.2 mM ferrous chloride in saline (Sigma, n = 10), 0.2 mM ferrous chloride plus 10 μM ceruloplasmin (LSBio, 25.6 kDa, LS-G13090) in saline (n = 10), or saline alone (n = 9) into the basal ganglia. All rats had T2-weighted MRI and behavioral tests at 24 h after injection. They were then euthanized and the brains harvested for histological and Western blots.

MRI and T2 Lesion Measurement

Rats were anesthetized with 2% isoflurane/air mixture during MRI examination on a 9.4-T Varian MR scanner (Varian Inc., Palo Alto, CA). A T2 fast spin-echo sequence (TR/TE = 4000/60 ms) using a field of view of 35 × 35 mm2, matrix of 256 × 256 pixel, and 25 coronal slices (0.5 mm thick) was employed. All MRI images were measured using NIH ImageJ. The T2 lesion was outlined along the border of the hyperintense signal area in the basal ganglia. Total T2 lesion volume was obtained by combining slice thickness (0.5 mm) and multiplying by total areas [8].

Immunohistochemistry and Immunofluorescence Staining

Immunohistochemistry and immunofluorescence staining were performed as previously described [9, 10]. For immunohistochemistry staining, the primary antibodies were rabbit anti-ceruloplasmin IgG (Abcam, ab110449, 1:500), rabbit anti-DARPP-32 IgG (Cell Signaling, 2306S, 1:500), sheep anti-albumin IgG (Bethyl, A110–134, 1:4000), and rabbit anti-cleaved caspase-3 IgG (Cell Signaling, 9661S, 1:400). Negative controls omitted the primary antibody.

For immunofluorescence triple labeling, the primary antibodies were rabbit anti-ceruloplasmin IgG (Abcam, ab110449, 1:200), rabbit anti-NeuN IgG (Abcam, ab104225, 1:500), goat anti-GFAP IgG (Abcam, ab53554, 1:500), and goat anti-Iba-1 IgG (Abcam, ab107159, 1:500) Secondary antibodies were Alexa Fluor 488 donkey anti-rabbit IgG (Invitrogen, 1:500), Fluro 594 donkey anti rabbit IgG (Invitrogen, 1:500), and Fluor 594 donkey anti goat IgG (Invitrogen, 1:500). Nuclei were labeled with DAPI (Sigma-Aldrich, F6057).

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

RT-PCR analyses were done as described previously [11]. To test the mRNA expression of ceruloplasmin in the brain, total RNA was extracted from the ipsilateral basal ganglia using RNeasy Mini Kit (Qiagen Inc., Valencia, CA). Reverse transcription was performed using the SuperScript First-Strand Synthesis Kit (Invitrogen, Carlsbad, CA). For semiquantitative PCR, 1 μL of target cDNA conversion mixture was amplified using Hotstar Taq DNA Polymerase (Qiagen) for 37 cycles at 94 °C for 20 s, at 53 °C for 25 s, and at 72 °C for 30 s. The PCR primers (NIH GenBank database) included ceruloplasmin (forward, 5′-TGCTTCTGGCAGTGAAGAAA-3′; reverse, 5′-AGGGCCTAGAGGCAAAGTTC-3′; 245 bp), GAPDH (forward, 5′- AAGATGGTGAAGGTCGGTGT-3′; reverse, 5′- GATCTCGCTCCTGGAAGATG -3′; 241 bp). PCR products were visualized by electrophoresis in agarose (1%) gels and stained with SYBR gel stain (Invitrogen). Photographs were taken with Gel Doc XR system (Bio-Rad, Hercules, CA). mRNA expression values were normalized to GAPDH and analyzed using NIH Image J.

Western Blot Analysis

Western blot analysis was performed as described previously [12, 13]. Ipsilateral basal ganglia tissues were sampled. Briefly, protein concentration was measured by Bio-Rad protein assay kit (Hercules, CA), and 50 μg protein of each sample was suspended in loading buffer, denatured at 95 °C for 5 min, and then separated by SDS-PAGE gel and transferred onto a hybond-C pure nitrocellulose membrane (Amersham, PA). Membranes were probed with the primary antibodies after 1 h blocking with nonfat milk buffer. The primary antibodies were sheep anti-albumin IgG (Bethyl laboratories, 1:10000), rabbit anti-DARPP-32 IgG (Cell Signaling Technology, 1:10000), and mouse anti-β actin (Sigma-Aldrich, 1:100000). The secondary antibodies were rabbit anti-sheep IgG (Bio-Rad, 1:2500), goat anti-rabbit IgG (Bio-Rad, 1:2500), and goat anti-mouse IgG (Bio-Rad, 1:5000). Protein band densities were detected by Kodak X-OMAT film. The relative protein densities of bands were performed with NIH ImageJ.

Terminal Deoxynucleotidyl Transferase (TdT)-Mediated dUTP Nick-End Labeling (TUNEL) Assay

According to the instruction of the TUNEL detection kit (S7100, Temecula, CA), double-strand DNA damage was detected by TUNEL staining.

Cell Counting

The number of positive cells was counted in three different areas of each brain coronal section. Using a digital camera to take three high-power images (× 40 magnification) in the cortex or basal ganglia. A blinded observer performed all counting which was repeated three times and the mean value calculated.

Behavioral Tests

Corner-turn and forelimb-use asymmetry tests were used for behavioral assessment as previously described [14]. The two behavioral tests were evaluated by an investigator blinded to treatment.

Statistical Analysis

All values are expressed as mean ± SD. Data were analyzed with Student’s t test, one-way ANOVA test with Tukey post hoc test or two-way ANONA with Sidak’s post hoc test. Significant levels were set at P < 0.05.

Results

There were few CP-positive cells in both ipsi- and contralateral cortex and basal ganglia at day 3 after sham operation. In contrast, CP-positive cells increased gradually in both ipsilateral cortex and basal ganglia at 4 h, peaked at day 3, and decreased at day 7 after ICH (P < 0.01; Fig. 1). There was also an increase in the number of CP-positive cells in the contralateral hemisphere at day 3 (Fig. 1b). However, the number of CP-positive cells in the ipsilateral hemisphere was significantly higher than in the contralateral hemisphere at each of the time points after ICH in both cortex and basal ganglia (P < 0.01; Fig. 1b).

Fig. 1
figure 1

Upregulation of ceruloplasmin (CP) in the brain after ICH. a CP immunoreactivity in the ipsi- and contralateral cortex and basal ganglia. Scale bar, 20 μm. b The number of CP-positive cells in the ipsi- and contralateral cortex and basal ganglia (BG) at different times after ICH and day 3 after sham operation. Values are means ± SD; n = 6, #P < 0.01 versus the other groups, **P < 0.01 versus the contralateral side, ##P < 0.01 versus the sham group

Full size image

To determine which cell types express CP, triple immunofluorescence staining was performed at day 3 after ICH. The results showed that CP immunoreactivity colocalized with NeuN (a neuronal marker, Fig. 2a) and GFAP (an astrocyte marker, Fig. 2b) in the perihematomal area after ICH. It did not co-localize with Iba-1 (a microglia/macrophage marker, Fig. 2c).

Fig. 2
figure 2

Triple immunofluorescence labeling of CP, NeuN (a), GFAP (b), Iba-1 (c) in the perihematomal area at day-3 after ICH. Scale bar, 20 μm. Colocalization of CP with NeuN (neuronal) and GFAP (astrocytic) but not Iba-1 (microglial). d Expression of CP mRNA was determined by RT-PCR in the ipsilateral basal ganglia at day 3 after ICH and sham operation. Values (ratio to GAPDH) are means ± SD; n = 3, #P < 0.01

Full size image

To test whether CP can be produced in the brain, CP mRNA was analyzed by RT-PCR. CP mRNA was detected in sham and ICH brains. Compared with the sham group, a significant increase CP mRNA expression in the basal ganglia was found in the day-3 ICH group (CP/GAPDH: 0.99 ± 0.03 versus 0.52 ± 0.08, P < 0.01; Fig. 2d).

T2 hyperintensity on MRI was used to indicate brain injury (T2 lesion) at 24 h after the injection of Fe2+ or Fe2+ + CP. Compared with saline injection, Fe2+ injection induced marked T2 lesion (36 ± 6 mm3 versus 3 ± 1 mm3 with saline; P < 0.01; Fig. 3a). Co-injection of CP with Fe2+ significantly reduced T2 lesion volume (14 ± 4 versus 36 ± 6 mm3 with Fe2+ alone; P < 0.01; Fig. 3a).

Fig. 3
figure 3

Effects of intracerebral injection of ferrous iron with and without ceruloplasmin (CP) or saline on T2-weighted lesion size and behavioral deficits. a T2-weighted MRI lesions at day 1. Values are means ± SD; n = 9–10 per group, #P < 0.01 versus the other groups. b Corner-turn tests score and forelimb-use asymmetry at day 1. Values are means ± SD; n = 9–10 per group, #P < 0.01 versus the other groups

Full size image

To assess neurological deficits, corner-turn and forelimb-use asymmetry tests were used at day 1 after the injection of saline, Fe2+ or Fe2+ + CP. Compared with saline injection, ferrous iron injection induced significant neurological deficits (Fig. 3b). CP treatment significantly ameliorated neurological deficits induced by Fe2+ (P < 0.01; Fig. 3b).

DARPP-32 is a specific and reliable marker for neuronal injury in the basal ganglia [9]. In this study, DARPP-32 levels in the ipsilateral basal ganglia were measured by immunochemistry staining and Western blot analysis at day 1 after iron injection. DARPP-32 protein levels in Fe2+ group were decreased significantly compared with saline group (DARPP/β-actin: 0.66 ± 0.08 versus 0.95 ± 0.08, P < 0.01; Fig. 4). CP treatment significantly reduced Fe2+-induced basal ganglia neuronal death (DARPP-32/β-actin: 0.85 ± 0.09 versus 0.66 ± 0.08 P < 0.05; Fig. 4).

Fig. 4
figure 4

Neuronal death in the basal ganglia at 24 h after intracerebral injection of ferrous iron with and without ceruloplasmin (CP) or saline. a) DARPP-32 immunoreactivity. Scale bar, 1 mm. b DARPP-32 protein levels determined by Western blot analysis in the ipsilateral basal ganglia. Values (ratio to β-actin) are means ± SD; n = 3–4 per group, #P < 0.01 versus saline group, *P < 0.05 versus Fe2+ + CP group

Full size image

Albumin was measured by immunohistochemistry and Western blots to assess the BBB disruption in the ipsilateral basal ganglia at day 1 after operation. Intracaudate Fe2+ injection caused marked BBB disruption (albumin/β-actin: 0.86 ± 0.09 versus 0.21 ± 0.08 in saline group; P < 0.01; Fig. 5). This was significantly reduced in the Fe2+ + CP group (albumin/β-actin: 0.46 ± 0.11 versus 0.86 ± 0.09 in Fe2+ group; P < 0.01; Fig. 5).

Fig. 5
figure 5

Blood-brain barrier disruption after intracerebral injection of ferrous iron with and without ceruloplasmin (CP) or saline. a Albumin immunoreactivity at day 1 after injection. Scale bar, 1 mm. b Albumin protein levels, Western blot analysis, in the ipsilateral basal ganglia. Values (ratio to β-actin) are means ± SD; n = 3–4 per group, #P < 0.01 versus other groups

Full size image

Brain cell death was examined by TUNEL staining at day 1 after intracerebral injection. Abundant TUNEL-positive cells were found in the ipsilateral basal ganglia after Fe2+ injection (Fig. 6a). CP treatment caused a significant reduction in TUNEL-positive cells around the injection area in the ipsilateral basal ganglia (238 ± 62/mm2 versus 1558 ± 318/mm2 in Fe2+ alone group; P < 0.01; Fig. 6a). The number of cleaved caspase 3-positive cells in Fe2+ + CP group was also much less than in the Fe2+ alone group (186 ± 37/mm2 versus 445 ± 71/mm2; P < 0.01; Fig. 6b).

Fig. 6
figure 6

Cell death after intracerebral injection of ferrous iron with and without ceruloplasmin (CP) or saline. a TUNEL-positive cells in ipsilateral basal ganglia of rats at day 1 after injection. Values are mean ± SD; n = 6, #P < 0.01 versus the other groups. Scale bars, 200 μm and 20 μm. b Cleaved caspase-3 immunoreactivity and number of positive cells in ipsilateral brain at day 1 after injection. Values are mean ± SD; n = 6, #P < 0.01 versus the other groups. Scale bar, 20 μm

Full size image

Discussion

The major findings in the current study are as follows: (1) Brain CP levels are increased after ICH; (2) CP is expressed on neurons and astrocytes in cortex and basal ganglia after ICH; and (3) CP attenuates ferrous iron-induced brain injury and neurological deficits.

Ceruloplasmin is an important multi-copper oxidase with ferroxidase activity that oxidizes toxic Fe2+ to less-toxic Fe3+, and promotes the combination of iron and transferrin, indirectly regulating the utilization and storage of iron [5, 15]. Brain iron accumulation caused by a lack of ceruloplasmin correlates with several neurodegenerative diseases, including Alzheimer’s and Parkinson’s disease [7, 16,17,18].

CP is an abundant plasma α2-glycoprotein, being mainly synthesized by hepatocytes and secreted into blood [19]. It cannot pass blood-brain barrier (BBB) in wild-type animals, although there is evidence that it can in CP knockout mice [15, 20, 21]. Previous studies have confirmed that the glycosylphosphatidylinositol (GPI)-anchored form of CP is expressed in the brain of human and rats, including in the cerebral cortex, basal ganglia, hippocampus, and cerebellum [6, 22]. The current study showed that CP mRNA as well as protein is expressed in the brain and upregulated after ICH. These results suggest that the nervous tissue can synthesize and secrete CP. Further studies are needed to determine how much brain CP after ICH is brain-derived rather than hematoma/blood-derived.

Thrombin and iron are two major players in ICH-induced brain injury, and both can upregulate brain CP levels. Thus, our previous experiments showed that thrombin upregulates brain CP mRNA and protein levels [23] and that intracerebral injection of iron also increases brain CP levels [24]. Iron, a hemoglobin degradation product, plays a crucial role in ICH-induced brain injury [2]. After ICH, erythrocyte lysis releases iron into the perihematomal zone. Iron overload can lead to brain edema, brain cell death, and neurological deficits after ICH [25,26,27,28,29,30]. Here, we found that Fe2+ causes marked brain cell death. Many dead cells had double-strand DNA damage (TUNEL-positive) and some were apoptotic (caspase-3 activation). It should be noted that serum CP concentrations are very high (300–450 μg/ml) [31]. We did not test whether or not exogenous CP can attenuate ICH-induced brain injury. In the current study, therefore, a Fe2+ injection rat model was used to examine whether exogenous CP can reduce Fe2+-related brain injury. According to our previous study, Fe2+ (0.2 mM) with or without CP (10 μM) in 50 μl saline were used [23]. We found that CP can reduce Fe2+-induced brain injury.

In this proof-of-concept study, we co-injected CP with Fe2+ to examine whether it would reduce brain injury by oxidizing toxic Fe2+ to the less toxic Fe3+. Co-injection of CP significantly reduced BBB permeability, DNA damage, neuronal cell death, and neurological deficits at the first day. Future studies should examine whether CP can reduce acute and chronic brain injury after ICH. CP is the key regulator of iron homeostasis, and its deficiency has been shown to induce iron dysregulation in humans and animal models [7, 16, 21, 32]. There is some evidence indicating that CP loss increases neuronal susceptibility to ischemic injury and leads to neurodegeneration [15, 33]. CP is an important antioxidant that is effective in inhibiting lipid peroxidation and superoxide and inhibiting free-radical damage stimulated by iron [20, 31, 34].

In summary, the current study showed that CP expression is increased in neurons and astrocytes after ICH. This was associated with an increase in brain CP mRNA. Exogenous CP reduced ferrous iron-induced brain injury. These results suggest a role of CP in brain injury following ICH.