Introduction

The mangrove is essential ecosystem in conserving plants, vertebrates, invertebrates, and microorganisms biodiversity and provides an ideal habitat for aquatic and terrestrial animals [1, 2]. This ecosystem microbial community can continuously transform nutrients from dead vegetation into sources of carbon, nitrogen, and phosphorus [3]. In mangrove environments, bacteria and fungi represent about 91% of the microbial biomass, while algae and protozoa represents 7 and 2%, respectively [4, 5]. It is estimated that about 625 fungal species come from mangroves, representing only about 0.62% of the fungal species described in the world [6].

The state of Santa Catarina (SC), currently has brazilians fourth smallest area of mangroves, with approximately 10.4 thousand hectares where three autochthonous plant species, Avicennia schaueriana, Laguncularia racemosa, and Rhizophora mangle, and associated species, such as the grass Spartina alterniflora can be found [7]. The microbial community can establish in an ecosystem through microorganisms-plant interaction [8]. Endophytic microorganisms colonize internal plant tissues without causing apparent harm and may have a neutral or beneficial relationship with their host [9].

Endophytic fungi can secrete biologically active compounds that protect plants from pathogen attacks an these secondary metabolites and enzymes have various biotechnological, pharmacological and industrial applications, such as phytohormone, bioremediation, biofertilization, biocontrol, immunosuppressive, antiparasitic, antimicrobial, antitumor, and antioxidant activity [10,11,12].

In Brazil, there are reports of mangrove endophytic fungi isolated from plants in Pernambuco [13], in São Paulo [14], in Ceará [15], and Bahia [16]. Although the endophytic fungal communities associated with mangrove plants have been studied in other parts in the world, in Santa Catarina Island, endophytic fungi isolated from mangroves have been poorly studied, which makes it imperative for the microorganisms prospection from this ecosystem [17]. Many different (epiphytic, endophytic, and pathogenic) fungi species with different mode of nutrition are associated with forest ecosystem. Endophytic fungal biodiversity is represented by a large number of species which can produce a high variety of compounds that are still unknown and may have essential biotechnological applications [18].

It is well known that the unplanned growth of cities and the diverse anthropic activities can cause significant negative impacts on the natural environment. Over the last three decades, conversions to aquaculture, industrial activities, urbanization development among others have destroyed more than 50,000 hectares (approximately 4%) of the Brazilian mangroves [19]. Although endophytic fungi communities associated to plants from mangrove ecosystem have been studied in other parts of the world, there is still limited knowledge about the fungal community in the mangroves of Santa Catarina. Therefore, the objective of this study was to isolate and compare the species diversity of the endophytic fungal community found in leaves, stems, and roots of Avicennia schaueriana, Laguncularia racemosa, Rhizophora mangle, and Spartina alterniflora from impacted (Itacorubi) and non-impacted (Ratones) mangroves in Santa Catarina Island, Santa Catarina state, Brazil.

Materials and methods

Location of sample collection

This study took place in two mangroves along Santa Catarina Island: Itacorubi mangrove (27°34′14″ S, 48°30′07″ W), and Ratones mangrove (27°44'50" S, 48°55'48" W). The field samplings were carried out between January 2020 and May 2021. Itacorubi mangrove covering an area of 150 hectares has been impacted since 1980s by uncontrolled urbanization. The lack of sufficient sewage collection network has led to the discharge of both domestic sewage and solid waste in the rivers and streams that form the Itacorubi hidrographic basin [20, 21]. On the other hand, the Ratones mangrove covers an area of 890 hectares is situated within the Carijós Ecological Reserve, which is a preserved area free from anthropic action. According to the Köppen classification, the climate region is Cfa, humid subtropical without a characteristic dry season, with a reduction in rainfall from April to September. The average annual temperature is approximately 21°C, with annual precipitation superior to 1500 mm, and characterized by strong winds blowing from south to north [22].

Plant material

Three sampling points were carried out in the Itacorubi mangrove (I), collection A1, A2, and A3, in two sampling points and two collections in the Ratones mangrove (R) collection B1 and B2, in five sampling points from January 2020 to May 2021 (Supplementary material fig. S1). The biological material of four plant species (A. schaueriana, L. racemosa, R. mangle, and S. alterniflora) was collected with the aid of a pruner, packed in polyethylene bags, and transported to the Laboratory of Microorganisms and Biotechnological Processes (LAMPB) at UFSC. The samples were divided into healthy and fresh leaves (Le), stems (St), and roots (Rt). All collections of biological material were authorized by the Biodiversity Authorization and Information System (SISBIO) number 73719-2.

Fungal culture media

To access fungal biodiversity and isolation of endophytic fungi, four culture media (Table 1) adapted from Ananda and Sridhar [23] were used. Potato dextrose agar (PDA) and Sabouraud agar (SA) media (Kasvi, Brazil) were sterilized by autoclaving (121°C and 20 min) and supplemented with Streptomycin (50 μg/mL) and Thiamphenicol (50 μg/mL) for bacterial growth inhibition.

Table 1 Composition of culture media used for fungal isolation
Full size table

Endophytic fungi isolation

Endophytic fungi were isolated from fresh leaves, stems, and roots. Plant tissues were subjected to washing in running water to remove dirt and subsequently, the surface disinfection steps was performed by a sequence of soaking in the following solutions: 70% ethanol (1 min), 2% sodium hypochlorite (4 min), 70% ethanol (30 s) and rinsed twice in sterile distilled water (1 min) [14]. After disinfection, the leaves, stems, and roots were cut into fragments (5 mm2) using a sterilized scalpel.

Five plant fragments from each plant part were randomly chosen and placed into Petri dishes containing the culture media (1, 2, 3, and 4) and maintained in a BDO incubator (25°C for 7–30 days). After fungal growth, colonies were repeatedly transferred to new culture media until pure colonies were obtained. To evaluate disinfection efficiency, 100 μl of the last wash water was inoculated in Petry dishes containing PDA and SA media and plates were incubated at 25°C for ten days.

Morphological fungi identification

Morphological identification of fungi strains was performed by observing the macroscopic and microscopic characteristics. Strains were cultivated in Petry dishes containing PDA medium (25°C, 7 days) through a punctual inoculation, and colonies characteristics were accessed. Microscopic structures were visualized by the slide microculture technique using PDA medium [24]. After incubation at 25°C for 7 to 14 days for fungal growth, each coverslip was removed, fixed with lactophenol with or without cotton blue, and mounted on a microscope slide. Microscopic structures were observed under an optical microscope at 400X and compared to the literature [25, 26].

Molecular fungi identification

The endophytic fungi DNA extraction, amplification, and sequencing procedures were carried out by the company Neoprospecta. An amount of 1 cm2 of each fungal colony growth on PDA (25°C, 7 days) was transferred to microtubes containing a buffer solution (Neosample X) and shipped to the company. DNA extraction was done with the DNA/RNA mini Kit QIAGEN® ID: 80004. The internal transcribed spacer region was amplified with primers ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) [27] and amplification conditions were done according Neoprospecta Company protocol. The amplicons were sequenced using the MiSeq Sequencing system (Illumina Inc., USA) and the sequences quality were analyzed by Phred/Phrap (QP) and obtained through the Sentinel pipeline using the FastQC v.0.11.8 program. Taxonomic identification was performed through Blastn v.2.6.0+ using the NCBI database as a reference. The ITS1 region sequences obtained were compared with the ITS1 region sequences deposited in the GenBank Nucleotide Collection database.

Strains preservation

The endophytic fungi obtained in this study are storaged in Ultrafreezer (-80°C) in tubes with inclined PDA overlayed with mineral oil and cryopreserved in liquid nitrogen [25, 26] and deposited in the Culture Collection of Microorganisms at the Laboratory of Microorganisms and Biotechnological Processes, Biological Science Center, Federal University of Santa Catarina, Brazil.

Statistical analysis

Analysis of variance was performed considering plant tissue, plant species, and mangrove, from the endophytic fungal frequency data (Ffe), calculated by equation according [14].

$$\mathrm{Ffe}=\frac{\mathrm{number}\ \mathrm{of}\ \mathrm{endophytic}\ \mathrm{fungal}\ \mathrm{colonies}\ }{\mathrm{number}\ \mathrm{of}\ \mathrm{plant}\ \mathrm{tissue}\ \mathrm{fragments}\ \mathrm{with}\ \mathrm{fungal}\ \mathrm{growth}}$$
(1)

The Ffe data were transformed (\(\sqrt{x+1}\) ) and normalized data were analyzed using the Shapiro-Wilk normality test. It was considered that Ffe data are non-parametric, and a generalized mixed model or mixed linear effects model was used, leaving repetition as a random effect, both with Poisson error distribution, since the number of repetitions (collections) was not the same, making it necessary to use the random effect. Therefore, the data that had p<0.01 was considered only as a significant difference for greater reliability. Analysis of variance was performed using the R version 4.2.1 program.

Fungal diversity

The diversity of the endophytic fungal community associated with mangrove plants was evaluated using frequency and diversity indices. The total and partial abundance (AbT and Ab) of each fungal genera was calculated (Eq. (2)) for isolation mangrove, plant species, tissue, and culture medium, where Ni= number of isolates of genus A and N= sum of all isolated genera.

$${\mathrm{Ab}}_{\mathrm{total}}\ \mathrm{or}\ \mathrm{Ab}=\frac{{\mathrm{N}}_{\mathrm{i}}}{\mathrm{N}}\ast 100$$
(2)

AbT or Ab= (Ni/N) *100

To assess the diversity of endophytic fungal genera from different isolation sites, host species, tissue, and culture media, the Shannon index (H) was used (Eq. (4)) in PAST software, where Ni = number of isolates of genus A and N = sum of all isolated genera.

$$\mathrm{H}=-\sum \left(\frac{\mathrm{N}\mathrm{i}}{\mathrm{N}}\right)\ln \left(\frac{\mathrm{N}\mathrm{i}}{\mathrm{N}}\right)$$
(3)

Results and discussion

Endophytic fungi isolation

A total of 373 isolates were obtained from plant tissue fragments, of which 96 and 277 strains were obtained from the Itacorubi (impacted) and Ratones (non-impacted) mangroves, respectively. Three hundred and sixty four strains were identified as endophytic fungi by microscopic caracteristics and nine were identified as endophytic bacteria, which are not the subject of the present study. After the plant tissue disinfection, inoculation of the last washing water (negative control) was performed and showed no microorganisms growth.

The variance analysis was performed based on endophytic fungal frequency data (Ffe) presented in Table 2. The following parameters were analyzed: plant part (leaf, stem, and root), sampling site (Itacorubi and Ratones), species (A. schaueriana, L. racemosa, R. mangle, and S. alterniflora), and culture media (PDA and SA with and without sea water).

Table 2 Variance analysis of the endophytic fungal frequency data considering plant species, plant part, culture media, and sampling site
Full size table

The results showed that the variation factors (species and sampling site) had significant effects (p<0.01 and <0.05) on the number of endophytic fungi isolated from the two mangroves. Plant species significantly influenced (p= 0.0002) endophytic fungi frequency (Table 2). Although the fungal frequency between A. schaueriana and L. racemosa did not differ, it showed significant differences against R. mangle and S. alterniflora (Fig. 1A).

Fig. 1
figure 1

Endophytic fungal frequency of mangrove plant species from Santa Catarina Island. A Fungal frequency according to plant species. B Fungal frequency according to impacted and non-impacted mangrove. C Fungal frequency according to plant tissue. D Fungal frequency according to the culture medium. Different letters represent significant statistical differences. Data transformed by \(\sqrt{\mathrm{X}+1}\)

Full size image

In terms of absolute number of isolates (Table S1), L. racemosa presented the highest number of isolates per species (140), followed by A. schaueriana (135), S. alterniflora (58), and R. mangle (40). In a study of the endophytic fungal community in mangroves plants in São Paulo state, L. racemosa was the was the most colonized plant species by endophytic fungi, whereas A. schaueriana hosting the smaller endophytic fungal population[14]. In the present study, the smallest endophytic fugal population was observed in R. mangle.

Regarding to fungal frequency between the non-impacted and impacted mangrove, the results showed a significant difference between them (p=0.0061). The non-impacted mangrove had a higher fungal frequency and a more considerable number of isolates (Fig. 1B). In the study of Sebastianes et al. [14], a significant lower endophytic frequency was observed in non-impacted mangrove. Considering the fungal frequency between plants part (leaf, stem, and root), the statistical analysis did not show significant differences (Fig. 1C). However, the highest number of isolates were obtained from leaves (184), followed by stems (107) and roots (82).

Culture media may play an important role in fungi isolation. The statistical analysis revealed significant differences between the culture media used (P= 0.0017). However, this difference only occurred between typical PDA and PDAS (Fig. 1D).

Morphological endophytic fungi identification

Based on macro and micromorphological characteristics, 373 isolates were identified as filamentous fungal strains (364 strains) and filamentous bacteria (9 strains), which were not the goal of this study. There was no isolation of yeast-like fungi in this study. Initially, the isolates were grouped into 62 morphogroups according to morphological characteristics (Supplementary material Fig. S1S2, S3, and S4). The 62 morpho groups are distributed among 16 different genera (Fig. 2). However, 109 isolates could not be identified since they did not produce reproductive structures at tested conditions.

Fig. 2
figure 2

Number of endophytic fungi genera and fungal isolates from mangrove plants of Santa Catarina Island based on morphological characteristics

Full size image

Although morphological characteristics, such as reproductive and vegetative structures, are essential for describing new species or identifying described fungi, several endophytic fungi strains do not show these characteristics in culture condition [28]. Several factors as the carbon source, substrate concentration, light, pH, and temperature may influence morphological characteristics production [28].

Molecular fungi identification

Among 62 morphogroups of endophytic fungi previously clustered, 51 morphogroups were submitted to high-performance sequencing of the ITS1 region by Neoprospecta Microbiome Technologies company, Brazil. One representative strain of each morphogroup was molecularly identified (Table 3). The ITS1 sequences were obtained through the Sentinel pipeline using the FastQC v.0.11.8 program and compared with sequences deposited in the GenBank database (NCBI) (Table 3). The highest similarity (<97%) and bit-score values and the lowest e-value values were considered to determine the taxonomic classification of the evaluated fungi. In the present study, the 19 genera identified by ITS sequencing belong to the Ascomycota phylum (94,12%), which includes three classes: Eurotiomycetes, Sordariomycetes e Dothideomycetes and Basidiomycota phylum representing 5,88% with one class: Agaricomycetes. The predominance of Ascomycota phylum among endophytic fungi of mangrove plants also had been reported by Sebastines [14], which obtained 99,4% of ascomycetes from Eurotiomycetes, Sordariomycetes, Dothideomycetes, and Saccharomycetes. Even though only the sequences of two strains presented similarity lower than 97%, several strains were identified only at genus or section level, e.g., Aspergillus, Penicillium, Trichoderma, and Fusarium. This occurred because the identification of some fungal species required the use of multiple genetic markers and even a polyphasic approach [25].

Table 3 Morphological and molecular identification of endophytic fungi isolated from leaf, stem, and root of Avicennia schaueriana, Laguncularia racemosa, Rhizophora mangle, and Spartina alterniflora from impacted (Itacorubi) and non-impacted (Ratones) mangroves of Santa Catarina Island by ITS1 region sequencies
Full size table

Diversity of the endophytic fungal community

Fungal community diversity (frequency and diversity index) was calculated based on fungi identification at the genera or species level. The only exception was for the strain identified as the Xylariaceae family, which was also included, totaling 263 isolates. It was considered high fungi frequencies above 10% and minor frequencies smaller than 3%.

The total and partial frequency of endophytic fungal genera in mangroves ranged from 0.38 to 15.48% (Table 4). The genera with more isolates and highest frequencies were Fusarium (41), Trichoderma (37), and Colletotrichum (34). Fusarium genus represent 15.59% of the isolated fungal population. Strains from this group have been isolated as an endophyte from various hosts in subtropical and tropical regions, mainly in mangrove plants from Brazil, Nigeria, Malaysia, and Bangladesh [14, 16, 24, 29, 30]. In our study, the Fusarium community was not affected by the anthropic action since strains were obtained in similar frequency in impacted (16.67%) and non-impacted mangroves (15,18%). Similar results were reported for Fusarium in a study on impacted and non-impacted mangroves in São Paulo [14]. The authors did not observe statistical differences in the frequency of endophytes in impacted mangrove compared to non-impacted one. However, the Fusarium incarnatum-equiseti complex (Table 3) was isolated only from A. schaueriana collected from the non-impacted mangrove.

Table 4 Total and partial frequency index of endophytic fungi isolated from mangrove plants Avicennia schaueriana, Laguncularia racemosa, Rhizophora mangle, and Spartina alterniflora from impacted (Itacorubi) and non-impacted (Ratones) mangroves of Santa Catarina Island
Full size table

The genus Trichoderma was found to be the second most frequently isolated among mangrove plants accounting for approximately 14.07% of the isolates. Similar findings, these fungi have been reported in previous studies conducted in China and Brazil, where Trichoderma fungi were also isolated from mangrove plants [14, 16, 31]. In Brazil, endophytic strains of Trichoderma have been specifically identified in A. schaueriana, L. racemosa, and R. mangle within the Brazilian mangrove ecosystem [14]. Although Trichoderma spp. were isolated in both (Itacorubi and Ratones) mangroves, statistical analysis revealed significant differences in their frequency, with a higher occurrence observed in the non-impacted mangrove (Table 4). This suggests that anthropic action might have a impacted on the frequency of these fungi. In a study conducted in mangroves of São Paulo, Trichoderma was the fourth most abundant genus, with minor variations frequency observed between impacted and non-impacted mangroves [13, 14, 32].

Colletotrichum was the third most frequent genera in the evaluated community (12.93%). This group has already been isolated as an endophytic fungus in mangroves in Brazil, Bangladesh, Thailand, and Nigeria [14,15,16, 30, 33]. Similar to Fusarium and Trichoderma, Colletotrichum community was unaffected by anthropic action since strains were isolated in both mangroves. However, Colletotrichum spp. showed a higher difference in frequency and isolate numbers in Itacorubi mangrove (14.14%) than Ratones mangrove (9.72%). Unlike our result, Sebastines et al. [14] found a higher frequency (17.05%) in the impacted mangrove than the non-impacted mangrove (7.06%) in the São Paulo state.

The genera that showed a lower frequency and a lower number of isolates from the evaluated fungal population were Arthrinium, Diaporthe/Phomopsis, Pseudogymnoascus, Venturia, Stemphylium, Buergenerula, Neofusicoccum, Phlebia, and Scopulariopsis (Table 4). Strains from Buergenerula, Neofusicoccum, and Stemphylium genera were obtained only from mangrove areas impacted by anthropic action. However, in the Itacorubi mangrove Arthrinium, Diaporthe/Phomopsis, Scopulariopsis, and Venturia were not isolated from any plant, suggesting that pollution may affect the diversity of fungal communities.

Species of Neofusicoccum, Diaporthe/Phomopsis, Scopulariopsis, and Stemphylium have already been isolated as endophytes from Brazilian [13,14,15] and Asian mangroves [34,35,36,37,38]. However, other genera, such as Buergenerula, Arthrinium, Pseudogymnoascus, and Venturia, have not been yet reported as endophytes of mangrove plants. Therefore, this study documented for the first time the occurrence of endophytic fungi belonging to these genera in endemic mangrove plants.

Diversity index

The diversity of endophytic fungi was performed using the Shannon index (H'), and showed a similar index between non-impacted mangrove (H'= 2.38) and impacted mangrove (H'=2.33) (Table S2 Supplementary material). The very close values found may be related to genera number associated with impacted (14) and non-impacted (17) mangroves. However, the total frequency of isolates was 2.6 fold higher for the non-impacted mangrove. Similar results of diversity index were also reported between Bertioga (oil-affected) and Cananeia (unaffected) mangroves in the state of São Paulo [14].

Other sources of variation as plant species, plant part, and culture media also presented close Shannon index (Table S2). In a study conducted in São Paulo coast mangroves, a resembling Shannon index was reported between R. mangle, L. racemosa and A. nitida endophytes [14]. Even though our results showed similar genera diversity index, the total frequency of each fungal genus was different between impacted (27.38%) and non-impacted (72.62%) mangroves. These results may suggest that anthropic action in/around the Santa Catarina mangroves impacted negatively the endophytic fungi frequencies, reinforcing the importance of preserving these environments to maintain fungal community diversity.

Conclusion

The endemic plants of two mangroves (one impacted an other non-impacted) at Santa Catarina Island evaluated in this study are colonized by a diverse community of endophytic fungi belonging to at least 19 genera, such as Buergenerula, Arthrinium, Pseudogymnoascus, and Venturia, that have not been yet reported as endophytes of mangrove plants. The Shannon index showed similar fungal genera diversity between impacted and non-impacted mangrove. However, significant statistical differences in the endophytic fungal frequency between the plant species, plant tissues, and culture media were observed, suggesting the importance of preserving this ecosystem for maintenance of the fungal community present.