Introduction

Ticks are considered the second most important vectors of pathogens, after mosquitoes (Anderson 2002; Anderson and Magnarelli 2008; de la Fuente et al. 2008; Cortés-Vecino 2018). Tick fauna currently comprises approximately 955 species belonging to three families, namely, Ixodidae (736 species), Argasidae (218 species), and Nuttalliellidae (1 species) (Dantas-Torres et al. 2019). Local tick diversity is attributed to the variety of thermal floors and plant diversity, which facilitate plasticity in these arachnids for colonizing diverse habitats (Guglielmone et al. 2003a, 2010; Estrada-Peña 2008). Approximately one-fourth of known tick species are found in the Neotropical region and nearly 70–80% of their hosts are mammals (Nava et al. 2008, 2017; Hornok et al. 2016; Labruna et al. 2016). The family Ixodidae includes species of medical and veterinary importance since these transmit a variety of bacteria (e.g., Coxiella, Borrelia, Ehrlichia, Rickettsia), protozoa (e.g., Theileria), and viruses (e.g., Crimean-Congo hemorrhagic fever virus) (Sonenshine 2018; Cabezas-Cruz et al. 2019; Rizzoli et al. 2019). Accordingly, mammals are epidemiologically important in pathogen-vector-host interactions due mainly to their habitats, areas of occupation, physiology, and body size (Monsalve et al. 2009; Heine et al. 2017). Several small- and medium-sized mammals are potential reservoirs of tick-borne pathogens; however, it is uncertain if they have a direct role as vectors in the transmission of infectious agents (Larson et al. 2018; Mlera and Bloom 2018).

In Colombia, there are records on the occurrence of 58 tick species. According to the last review on Neotropical ticks (Guglielmone et al. 2003a), concerning 15 species of Argasidae and 37 species of Ixodidae, Ixodes fuscipes was excluded from the list of valid species for Colombia based on findings by Labruna et al. (2020). In addition, four species were reported for the country: Amblyomma parvum Aragão, 1908 (López and Parra 1985; confirmed by Nava et al. 2017), Ixodes affinis Neumann, 1889 (Mattar and López-Valencia 1998), Ixodes auritulus Neumann, 1904 (González-Acuña et al. 2005), and Dermacentor imitans Warburton, 1933 (Guglielmone et al. 2006). Nava et al. (2014) reevaluated the taxonomic status of A. cajennense and concluded that this taxon actually comprised six valid species, among which A. cajennense sensu stricto was not found in Colombia in the samples examined, and only Amblyomma patinoi Labruna, Nava, and Beati, 2014, and Amblyomma mixtum Koch, 1844, were confirmed for the country (Nava et al. 2014; Rivera-Páez et al. 2016). Apanaskevich and Bermúdez (2017) reported Ixodes bocatorensis Apanaskevich and Bermúdez 2017, in Colombia and, according to Bermúdez et al. (2015), the occurrence of I. brunneus needs to be confirmed.

In Colombia, many tick species are associated with small- and medium-sized wild and domestic mammals; however, several of these records raise uncertainty (Cortés-Vecino et al. 2010; Miranda et al. 2011; Faccini-Martínez et al. 2017; Acevedo-Gutiérrez et al. 2020). Despite the epidemiological importance and role of ticks in the transmission and circulation of infectious diseases, in Colombia, the literature records on ectoparasites associated with wild mammals are scarce and fragmented (Torres-Mejía and de la Fuente 2006; Londoño et al. 2017; Rivera-Páez et al. 2018; Acevedo-Gutiérrez et al. 2020). Given this, a comprehension of the dynamics of zoonosis (i.e., causes, factors, and mammals involved) is relevant to any country and contributes to understanding emerging and re-emerging tick-borne diseases (Betancur et al. 2015). Thus, this study provides an exhaustive review of tick-mammal relationships reported in specialized literature, as well as new reports of this type of relationship in Colombia to consolidate the information on ticks associated with mammals in the country.

Materials and methods

Systematic review

To gather the information on ticks associated with mammals in Colombia and provide new records, we reviewed the information available in the literature retrieved from Science Direct, Web of Science, SciELO Scopus, and Google Scholar search engines using the keywords ((Colombia*) AND (Tick*) AND (Ixodidae*) OR (Argasidae*)), without temporal restrictions (n = 2940) (1911—August of 2020). A total of 71 documents were compiled and selected, following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) method (Moher et al. 2009, 2012; Urrútia and Bonfill 2010). The information was complemented with suggested references on ectoparasites of mammals of Colombia (Gonzalez-Astudillo et al. 2016). Updated lists of mammals in Colombia were used to update mammal names and synonymies (Solari et al. 2013; Ramírez-Chaves et al. 2016, 2018). Tick taxonomy was determined according to Dantas-Torres et al. (2019).

Tick identification and new records

A morphological analysis was performed on 213 ticks collected during samplings conducted in the departments of Antioquia, Caldas, and Cundinamarca (Colombia) between 2015 and 2018. The ticks were identified to the species level following the dichotomous keys of Robinson (1926), Aragão and Fonseca (1961), Jones et al. (1972), Barros-Battesti et al. (2006), Melhorn (2008), Nava et al. (2014, 2017), and Dantas-Torres et al. (2019), using a light microscope. Furthermore, a molecular analysis was performed to confirm the morphological identifications of the tick species. Twenty-two samples were analyzed, which included at least one individual from each morphotype per host and collection site. DNA was isolated using the DNeasy Blood and Tissue kit (Qiagen), according to the manufacturer’s protocol. PCR amplification of fragments from two mitochondrial genes, namely, the 5′ region of the cytochrome oxidase I (COI) gene with primers LCO1490 (F) 5’-GGTCAACAAATCATAAAGATATTGG-3′ and HCO2198 (R) 5’-TAAACTTCAGGGTGACCAAAAAATCA-3′ (Folmer et al. 1994), and the 16S rDNA gene using primers F 5′– CTGCTCAATGATTTTTTAAATTGCTGTGG–3′ and R 5′– CCGGTCTGAACTCAGATCAAGT-3′ (Norris et al. 1996), was performed. The amplicons were purified and sent to Macrogen (Geumcheon-gu, Seoul, South Korea) for Sanger sequencing. The sequences were assessed and edited using Geneious Trial v8.14 (Drummond et al. 2009). Furthermore, the sequences were searched against public databases, including GenBank and BOLD (Barcode of Life Data Systems, www.barcodinglife.com), using BLAST.

Results

In this review, 51 tick species are reported in association with mammals in Colombia (also includes records of Amblyomma cajennense s.l.). The ticks belong to the families Ixodidae (39 species) and Argasidae (12 species). Among these, 25 ectoparasite species (16 ixodids and 9 argasids) are reported exclusively in at least 42 wild mammal species. In Colombia, 18 species of hard ticks (Ixodidae) interact with at least 10 domestic mammal species; two are associated with one hybrid (Equus caballus x E. asinus); three species are reported from three exotic-invasive species (Mus musculus, Rattus rattus, and R. norvegicus); 18 are associated with domestic and wild mammals; and one species (Dermacentor imitans) is reported exclusively from humans (Table 1).

Table 1 Literature reports of relationships between ticks and mammals in Colombia
Full size table

A total of 213 tick specimens (133 adults, 43 nymphs, and 37 larvae) were collected from 19 host individuals belonging to six mammalian orders: one individual of Didelphis marsupialis and one Monodelphis adusta (Didelphimorphia), two Tamandua mexicana (Pilosa), three Cerdocyon thous (Carnivora), five Equus caballus (Perissodactyla), three Homo sapiens (Primates), and three Heteromys anomalus and one Nectomys grandis (Rodentia). All ticks were morphologically examined and adults and nymphs were identified. In total, eight species were recorded: Amblyomma calcaratum, Amblyomma dissimile, Amblyomma mixtum, Amblyomma nodosum, Amblyomma ovale, Amblyomma varium, Ixodes luciae, and Ixodes tropicalis. Larvae were identified to the genus level. The hosts and collection localities for each tick species are shown in Table 2. After the morphological identification, molecular methods were used to confirm the identity of A. calcaratum (one female and one male), A. dissimile (three males), A. mixtum (one female and one male), A. nodosum (two females), A. ovale (one female and one male), A. varium (one female and two larvae), I. luciae (four females), and I. tropicalis (one female and three nymphs).

Table 2 Morphological and molecular information with its corresponding mammal host
Full size table

From the samples collected, nine new relationships between ticks and mammals in Colombia were established, including eight new relationships between hard ticks and wild mammals. Furthermore, the first record of A. varium parasitizing humans is reported for Colombia. Records of A. calcaratum and I. tropicalis were molecularly confirmed, providing updated information for these species since previous reports were outdated (Table 2). The partial nucleotide sequences generated in this study were deposited in GenBank under accession numbers [MN879555 – MN879567] for the mitochondrial 16S rRNA gene, and [MT000155 – MT000161] for the COI gene. The voucher specimens were deposited in the Collection of Ectoparasites of the Museo de Historia Natural de la Universidad de Caldas (Ramírez-Chaves et al. 2019).

Discussion

The current information on tick-mammal associations for Colombia comprises records of 51 tick species associated with wild and domestic, exotic, human mammal hosts. This review consolidated information on mammals in Colombia in the last century, concerning their association with ticks and changes in tick-mammal relationships throughout this period (Guglielmone et al. 2003a, 2006, 2014; Guglielmone and Robbins 2018; Nava et al. 2017). Species such as Amblyomma incisum Neumann, 1906; Amblyomma pecarium Dunn, 1933; Amblyomma tigrinum Koch, 1844; and Ixodes loricatus Neumann, 1899, as well as other tick species reported by López-Valencia (2017), are recorded in association with mammals in Colombia (Acevedo-Gutiérrez et al. 2020). The confirmation of these species would broaden the list of valid species in Colombia. However, Guglielmone et al. (2011) and Guglielmone and Robbins (2018) did not report these species in Colombia. In this study, these species were not considered since their records must be confirmed and they can be confused with other species.

The morphological confirmation and generation of new genetic sequences of ticks associated with mammals in Colombia allowed inferring the state of the knowledge on these interactions in the country compared with other countries in America (Nava et al. 2014; Rivera-Páez et al. 2018; Dantas-Torres et al. 2019). We highlight the need to review and support several vector-host relationships between ticks and mammals in Colombia (e.g., Amblyomma geayi with Bradypus variegatus; Haemaphysalis leporispalustris with Homo sapiens). Especially, there are several outdated records and morphological and molecular confirmations are needed for several species according to new studies in America (e.g., Labruna et al. 2020; Onofrio et al. 2020) that describe new tick species, synonymies, and reinstatement of species. In addition, new records of Ixodes species from Colombia, which yielded DNA sequences lacking high identity (≤ 95%) to any species in GenBank (Martínez-Sánchez et al. 2020).

Moreover, several mammal species, such as Dasypus novemcinctus, D. marsupialis, Hydrochoerus hydrochaeris, Myrmecophaga tridactyla, and Tamandua tetradactyla, are associated with a high species richness of ticks (14 species), which agrees with reports for other Neotropical countries (Muñoz-García et al. 2019; Nava et al. 2017). Furthermore, several associations were specific; for example, Sigmodon alstoni is exclusively associated with a single tick species (Amblyomma auricularium). These specific relationships were reported in other countries of the American continent (Wells et al. 1981; Lopes et al. 2016).

This study reports the first record for Colombia of A. varium from humans; particularly, this species rarely parasitizes humans and has only been confirmed in this association in Panama and Costa Rica (Guglielmone and Robbins 2018). Among 39 hard tick species associated with mammals in Colombia, according to Guglielmone and Robbins (2018), eight species are confirmed parasitizing humans: A. dissimile, A. mixtum, A. oblongoguttatum, A. ovale, D. imitans, D. nitens, R. microplus, and R. sanguineus s. l. Furthermore, Guglielmone and Robbins (2018) did not include H. leporispalustris in the list of species that parasitize humans in Colombia, although Osorno Mesa (1940) found a nymph of Haemaphysalis proxima Aragão on a human from Colombia, and this name is treated as a synonym of H. leporispalustris by Camicas et al. (1998) and others. However, this synonymy was not accepted by Guglielmone and Nava et al. (2014), who classified H. proxima as a nomen dubium. In this study, the record from Osorno-Mesa (1940) is included in Table 2. In addition to providing the first record of A. varium parasitizing humans in Colombia, this study also gathered records for Amblyomma patinoi, Amblyomma sabanerae, Ornithodoros puertoricensis (Quintero et al. 2020), and Ornithodoros rudis (Dunn 1929; Osorno-Mesa 1940; Jones et al. 1972) parasitizing humans in Colombia. Overall, 14 out of 51 tick species associated with mammals were found parasitizing humans in the Colombian territory.

A large fraction of these tick species comprises endemic vectors of pathogens with global epidemiological impact in recent decades (Guglielmone et al. 2003a, 2006, 2014; Estrada-Peña 2008; Barros-Battesti et al. 2013; Nava et al. 2017; López-Valencia 2017; Dantas-Torres et al. 2019; Acevedo-Gutiérrez et al. 2020). On this basis, the study of tick-borne pathogens in Colombia requires greater sampling efforts since many tick species reported in Colombia are confirmed vectors of infectious pathogens of medical and veterinary importance (McCown et al. 2014; Osorio et al. 2018; Santodomingo et al. 2019). Research on this topic should include wildlife, exotic, and domestic mammals as a whole.