Introduction

There are variety of prokaryotic and eukaryotic expression systems which have been developed for the synthesis of recombinant proteins (Zhu et al. 1986; Kim et al. 1997) including those from bacteria, yeasts, fungi, mammalian cells, insect cells, transgenic animals, and transgenic plants. Bacterial expression systems are generally unable to assemble glycan branches and disulfide bonds of glycoproteins and the expressed proteins fail to fold properly. Attempts to produce recombinant proteins in insect cells and Saccharomyces cerevisiae have been unsatisfactory due to poor secretion into the culture medium, hyperglycosylation and improper folding (Ogrydziak 1993). Thus, development of an alternative eukaryotic expression system capable of improving these problems is needed.

The family Trypanosomatidae (Euglenozoa, Kinetoplastida) includes several of the most serious vector-borne parasites of humans. The major human parasites include a number of species in the genera Leishmania and Trypanosoma (Hughes and Piontkivska 2003). Since 1986, it has been shown that Leishmania protozoan, a trypanosomatidae flagellate, could be used to express foreign genes (Zhang et al. 1995; Hughes and Piontkivska 2003). Among Trypanosomatidae family, Leishmania tarentolae is a non-pathogenic parasite of the gecko Tarentolae annularis and has been developed as a new potential eukaryotic expression system, as proven in the expression of erythropoietin and tissue plasminogen activator (Clayton et al. 1995; Breitling et al. 2002; Hemayatkar et al. 2010).

Human Interferon-γ is a secretory glycosylated protein with the total molecular weight of 25 kD and two potencial glycosylation sites (Sareneva et al. 1995). This glycoprotein is the product of activated T-lymphocytes and natural killer cells, and was originally described as an antiviral agent. As a result of its numerous functions, recombinant human IFN-γ (rhIFN-γ) is finding increasing therapeutic applications. In the treatment of chronic granulomatous disease (Seeger et al. 1998) and in severe malignant osteopetrosis (Van Slooten et al. 2000; Kocher and Kasser 2003; Marciano et al. 2004), rhIFN-γ has clinically accepted for beneficial effectiveness (US patent 6/333032). In the years 1982–1996 Interferon-γ has been expressed in E. coli. But as a bacterium, E. coli is unable to finalize the post-translational modifications (as mentioned above), thus, the protein produced was unglycosylated (Arora and Khanna 1996; Khalilzadeh et al. 2003). In 1983, Interferon-γ was cloned in Saccharomyces cerevisae under control of phosphoglycerate kinase (PGK), but the expression yield was not satisfactory (Derynck et al. 1983). Similarly, expression yield of hIFN-γ in chinese hamster ovary (CHO) cells was also unpromising (Zamani et al. 2006).

In the present study, cloning and expression of human IFN-γ cDNA was used to evaluate the usefulness of protozoa in the production of a small human recombinant pharmaceutical protein.

Materials and methods

Amplification of IFN-γ cDNA

The IFN-γ gene was isolated from phytohemaglutinin-stimulated peripheral blood mononuclear cells of an Iranian healthy individual blood donor using the RT–PCR technique. The cells were cultured as mentioned and incubated at 26°C for 72 h. Total RNA was extracted from 3 × 108 cells using TRIzol reagent (Gibco, UK) as follows. After washing the cells, the sediment was dissolved in 1.5 ml TRIzol, centrifuged for 10 min at 12,000g and 4°C, and kept at room temperature for 5 min. Then 0.2 ml chloroform was added for each 1 ml TRIzol and after shaking, it was kept at room temperature for 15 min. It was centrifuged for 15 min at 12,000g and 4°C, and the aqueous phase was collected. Then 0.75 ml isopropanol was added to the mixture and after keeping at room temperature for 10 min, it was centrifuged for 10 min at 12,000 g and 4°C. The RNA sediment was washed using ethanol 75% and finally dissolved in 30 μl RNase free (DEPC-treated) water. The cDNA was synthesized using Single-Stranded cDNA Synthesis kit (Fermentas, Lithuania) as recommended by the manufacturer: 1 μl oligo dT (50 pmol/μl) was added to 1–5 μg total RNA and the reaction volume was increased to 11 μl using RNase-free water. The reaction mixture was kept at 70°C for 5 min and then cooled rapidly on ice. Then 2 μl of 10 mM dNTPs, 2 μl RNase inhibitor and 4 μl 5x reaction buffer were added and the volume was increased to 19 μl using RNase-free water. The reaction mixture was kept at 37°C for 5 min and then 40 units of Moloney murine leukemia virus reverse transcriptase enzyme added. The reaction mixture was kept at 37°C for 60 min and at 70°C for 10 min, and finally frozen at −70°C.

Construction of recombinant expression vectors

The purified amplicon was cloned in pTZ57R using InsT/AcloneTM PCR Product Cloning Kit (Fermentas, Lithuania) as instructed by the manufacturer. The recombinant plasmid was analysed by sequencing. The cloned IFN-γ gene was amplified with the primers F-IFN 5′GGCGGATCCATGCAGGACCCATATGTA3′ and R-IFN 5′GGCGGATCCTTACTGGGATGCTCTTCGACC3′ which contained BamHI restriction sites in each 5′ end (underlined). The PCR product obtained was cloned in pET-32a cloning vector as intermediate vector. The hIFN-γ included vector (pET-32a-IFNγ) was digested with BamHI restriction enzyme and purified IFN-γ fragment was cloned into pFX1.4sat and pFX1.4hyg plasmids (Jena Bioscence, Jena, Germany) which had been digested by BglII previously. The recombinant pFX1.4sat-IFNγ and pFX1.4hyg-IFNγ plasmids were purified by a commercial plasmid extraction kit (Macherey–Nagel, Germany). The presence of the IFN-γ gene was confirmed by several restriction-enzyme analysis and sequencing using M13 forward and reverse primers.

Cultivation and transfection of L. tarentolae

Leishmania tarentolae was cultivated in Brain Heart Infusion (BHI) broth medium (DIFCO, USA) supplemented by 5 μg/ml hemin (Sigma, USA). Transfections were performed by electroporation of in vitro cultivated promastigotes as described by Beverley and Clayton (1993). The Leishmania expression vectors containing IFN-γ cDNA were digested by SwaI restriction enzyme (Fermentas, Lithuania) and the heavier fragment containing IFN-γ was purified. Of this purified fragment 10 μg was transformed into L. tarentolae cells by electroporation. Selection of single colonies would be on solidified BHI media containing nourseothricin (ClonNAT, Jena, Germany) or hygromycin B (Sigma, USA) and both.

Screening of transformed L. tarentolae colonies

To confirm the integration of the IFN-γ-containing cassettes into the Leishmania genome, PCR was performed on the genomic DNA of nourseothericin- and hygromicin-resistant colonies using IFNγ, sat- and hyg-specific primers. For further confirmation of homologous recombination integration in the 18 s rRNA site, an amplification of the fragments with hyg or sat forward and ssu specific reverse primers was performed.

SDS–PAGE and Western blotting

Total protein was obtained from the cell lysate of the transformed and the wild colonies (Hemayatkar et al. 2010). 20 μg of each acquired sample was loaded on 12% SDS–PAGE. The polyacrylamide gel was stained with Coomassie blue G-250 and de-stained with MQ water. Western blotting was performed on similarly prepared acrylamide gel according to the standard procedure (Coligan et al. 2003). Rabbit polyclonal antibody to human IFN-γ (Abcam UK) was used as the primary and the goat polyclonal anti-rabbit IgG HPR (Dako, UK) as the second antibody.

Immunoassay quantification of rhIFN-γ

In order to detect the rhIFN-γ, solid phase was coated with the rabbit polyclonal anti-human IFN-γ antibody (Abcam, UK). The standard enzyme-linked immunosorbent assay (ELISA), washing and blocking processes were performed. Serial dilution of standard IFN-γ and cell lysate of double transformed clone was added into each anti-IFN-γ-coated well. Antigen–antibody detection was carried out by conjugation with horseradish peroxidase (HRP; Pharmacia, Sweden) which was added to each reaction well after the washing step. The substrate 3,3′,5,5′-tetramethylbenzidine dihydrochloride (TMB) (Sigma–Aldrich, USA) was added to each well followed by 20–30 min incubation and the reaction was stopped with 1 M H2SO4 solution. The standard rhIFN-γ; Imukin (Boehringer Ingelheim, Germany) was used as a positive control.

Results

Cloning of the IFN-γ cDNA

Human IFN-γ cDNA was synthesized by RT–PCR (as mentioned in Materials and Methods) and PCR was performed on the DNA extracted from cells using primers containing restriction sites for BamHI in both 5′ ends. A single 450 bp band was seen on agarose gel after electrophoresis (Fig. 1a). This band was extracted from the gel and ligated in pET-32a vector. The correct gene cloning was confirmed by restriction analysis (Fig. 1b) and DNA sequencing. BLAST assessment of the sequence obtained showed 100% similarity to human IFN-γ mRNA (GenBank: AF506749.1).

Fig. 1
figure 1

a Agarose gel electrophoresis of PCR amplification of hIFN-γ gene. Lane 1 1 kb size marker, lane 2 460 bp IFN-γ gene. b Restriction analysis of pET-32a-IFNγ vector. Lane 3 undigested vector, lane 4 digested vector using BamHI restriction enzyme, lane 5 1 kb size marker

Full size image

Construction of IFN-γ expression cassettes

In order to assess the relationship between integrated gene copies in the 18 s rRNA locus and protein expression rate, this gene was sub-cloned in pFX1.4hyg and pFX1.4sat expression vectors. IFN-γ gene was cut out of the pET-32a-IFNγ by BamHI restriction enzyme and eluted from the agarose gel. In addition, the pFX1.4hyg and pFX1.4sat vectors were also digested using the BglII enzyme and electrophoresed on agarose gel for confirmation of the proper digestion. This enzymatic digestion cut out the 0.7 kb fragment from the 8.2 kb plasmid (pFX1.4sat) and 8.7 kb plasmid (pFX1.4hyg). Figure 2 shows the schematic picture of the ligation of IFN-γ gene in 7.5 kb fragment of specific Leishmania pFX1.4sat vector. As the difference between two final expression vectors is only the antibiotic resistance gene, the pFX1.4hyg vector has not been shown.

Fig. 2
figure 2

Schematic diagram of pFX1.4-IFNγ vector used for expression of rhIFN-γ in L. tarentolae. Abbreviations: 5′ssu, 5′-portion of the small subunit of the L. tarentolae rRNA gene; NTR1 (0.4 k-IR cam BA), NTR2 (1.4 k-IR cam CB) and NTR3 (1.7 k-IR) are optimized gene flanking non-translated regions providing the splicing signals for post-transcriptional mRNA processing in L. tarentolae; IFN-γ, cDNA of the IFN-γ gene; sat, norseothricin resistance gene; 3′ ssu, 3′-portion of the small subunit of L. tarentolae rRNA gene

Full size image

Transfection of L. tarentolea cells

Two DNA fragments, sat-IFNγ and hyg-IFNγ, containing either a sat or a hyg gene and one copy of the IFN-γ gene which was between two non-translated regions (NTRs) obtained from digestion of pFX1.4sat-IFNγ and pFX1.4hyg-IFNγ by SwaI restriction enzyme used to transform the Leishmania cells by electroporation. After the first round of transfection with sat-IFNγ, the cells were grown in semisolid BHI media containing 60 μg/ml nourseothricin to select the resistant clones. Individual clones were selected and transferred sequentially into 24-well plates and then into 25-ml tissue culture flasks, containing 1 and 10 ml selective medium, respectively. Genomic DNA isolated from nourseothericin-resistant clones was analysed by PCR. After confirmation by PCR, a second round of transfection with the hyg-IFNγ fragment was done and transformed cells were cultured on semisolid media containing two antibiotics nourseothricin-hygromycin, 60 and 50 μg/ml, respectively. Double resistant clones were cultured in BHI broth medium containing both two antibiotics.

Integration confirmation

Integration of hIFN-γ (460 bp), sat (500 bp) and hyg (1,000 bp) in the genomic DNA of the recombinant cells was confirmed by PCR analysis (data not shown). Furthermore, to verify the right orientation of the integrated sat-IFNγ cassette, a PCR reaction using the sat forward and ssu reverse primers was performed on both wild type cells and the cells transformed with pFX1.4sat-IFNγ cassette. The expected 2.3 kb band was only observed from transformed cells, indicating the right orientation of the sat-IFNγ cassette. The same procedure was performed on genomic DNA of the cells with sat-IFNγ, after second transformation with hyg-IFNγ cassette using hyg forward and ssu reverse primers. The desired bands, 2.8 kb, were observed on the agarose gel (Fig. 3).

Fig. 3
figure 3

Agarose gel electrophoresis of PCR amplification in a doubly transformed L. tarentolae clone to confirm the integration of the expression cassettes into the parasite genome. Lane 1 1 kb size marker, lane 2 PCR on non-transformed cells with hyg forward and ssu reverse primers (control negative), lane 3 2.8 kb band related to the integration of hyg-IFNγ cassette into the ssu locus, lane 4 2.3 kb band related to the integration of sat-IFNγ cassette into the ssu locus resulted from sat forward/ssu reverse primers, lane 5 PCR on non-transformed cells with sat forward and ssu reverse primers (control negative), lane 6 1 kb size marker

Full size image

SDS–PAGE and Western blotting

Expression of rhIFN-γ in L. tarentolae was also investigated by western blot analysis. IFN-γ was detected in the cell lysate of transformed cells. The commercial IFN-γ reacted with rabbit polyclonal anti-IFN-γ antibody produced a 17 kD band representing the intact structure of the protein (Fig. 4, lane 1). Existence of the similar band confirmed the presence of rhIFN-γ in the cell lysate obtained from the double transformed clone (Fig. 4, lane 2) whereas in wild type cells IFN-γ was not detected with polyclonal antibody (Fig. 4, lane 3).

Fig. 4
figure 4

Western blot analysis of double transformed Leishmania cell lysate. Lane 1 1 μg commercial IFN-γ, lane 2 20 μg of total protein from cell lysate of double transformed cells, lane 3 20 μg of total protein from cell lysate of wild cells

Full size image

Estimation of the rhIFN-γ expression level

The rhIFN-γ was detected in the cell lysates by ELISA. The amount of the heterologous protein in each preparation was determined by sandwich ELISA using standard IFN-γ for comparison. From 100 ml of the culture of double transformed colony in the shake flask (OD: 2 at 600 nm), the production yield was 0.945 μg of rhIFN-γ (app. 0.8% of total protein).

Discussion

Leishmania tarentolae is a parasite of the gecko Tarentolae annularis and a feasible eukaryotic expression system for high level production of active recombinant biopharmaceuticals (Soleimani et al. 2007; Breitling et al. 2002) because of its several unique features, including higher specific growth rate compared to mammalian cells, cultivation in low cost media, safety for humans, possibility to introduce several copies of a foreign gene into the parasite genome and production of recombinant proteins with an animal-like N-glycosylation pattern. These advantages, in addition to feasibility for constitutive or regulative protein production, make L. tarentolae an attractive host for high level production of heterologous proteins (Kushnir et al. 2005; Fritsche et al. 2007; Breitling et al. 2002; Hemayatkar et al. 2010). Moreover, Leishmania do not have some of limitations including safety considerations, requirements for serum-supplemented culture media and low growth rate. A couple of recombinant pharmaceutical and non-pharmaceutical glycoproteins such as human erythropoietin, tissue plasminogen activator and laminin-332 have already been produced in this expression system and in all cases, the expressed proteins were biologically active (Hemayatkar et al. 2010; Phan et al. 2009; Breitling et al. 2002).

Leishmania possess unusual mechanisms for gene expression. The recent sequencing of the Leishmania spp. genomes indicates that protein-coding genes are organized as polycistronic units (Ivens et al. 2005; Clayton and Shapira 2007; Haile and Papadopoulou 2007; Orlando et al. 2007). Transcription in this organism initiates at strand the switch regions on each chromosome, without defined RNA polymerase II promoters or other typical transcription factors (Martinez-Calvillo et al. 2003).

Collectively, the studies demonstrate that the basic features of the Trypanosomatidae secretory-endocytic pathways are very similar to those found in higher eukaryotic expression systems such as mammalian cell lines (Ralton et al. 2002; Clayton and Shapira 2007; Basile and Peticca 2009). Hence, in this study an attempt was made to express the recombinant human IFN-γ in L. tarentolae. Since the intergenic NTRs have an important role in the post-transcriptional modifications in Trypanosomidae (Teixeira and daRocha 2003), IFN-γ cDNA was cloned between two NTRs in commercial expression vectors. In order to increase the expression rate, two expression cassettes each one containing one copy of IFN-γ cDNA were constructed and transformed into the Leishmania cells, sequentially. In addition, constructs were integrated in chromosomal 18 s ribosomal RNA locus (ssu) that is a repetitive locus of the L. tarentolae genome with high rates of transcription by the host RNA polymerase I (Soleimani et al. 2007) which could enhance the expression level.

Results showed that rIFN-γ can be expressed in L. tarentolae cells to a level that allows detection by Western blotting. Moreover, increasing of the gene copy number by transforming the transgenic clones with the second expression cassette affects the expression level which investigated based on the intensity of the acquired bands (data not shown). Similar observations have been reported previously by several authors (Hemayatkar et al. 2010; Soleimani et al. 2007; Breitling et al. 2002).

IFN-γ is a pharmaceutical protein with a broad range of biological activities including activation of B and T-cell differentiation and increasing the expression of the major histocompatibility complex (MHC I, II) molecules, therefore, it has application in the treatment of a number of immunological, viral, and neoplastic diseases.

For these reasons it has attracted extensive attention, and scientists have tried to produce this valuable protein in different expression systems. Proper glycosylation of IFN-γ increases the survival time of biologically active IFN-γ in the circulation as the native protein shows resistance to crude protease preparations obtained from human granulocytes (Sareneva et al. 1995). Although it has been shown that E. coli might be considered as a suitable host with a relative high level of expression (Khalilzadeh et al. 2003; Zhang et al. 1992), lack of posttranslational modifications and the need for refolding stages are still big challenges. In contrast, L. tarentolae is eukaryotic gene expression machinery, which includes full glycosylation and disulfide bond formation, and thus represents a potential advantage over other expression systems (Fernandez-Robledo and Vasta 2010), Therefore, expressed rhIFN-γ in this host could be properly folded, highly active and protease resistant. Our productivity was 1.6 ± 0.05 mg g−1 of dried cell (9.5 mg/l) that is seen acceptable for heterologous protein expression in this host in comparison with the other studies (Kushnir et al. 2005; Breitling et al. 2002). It was more than what was reported by Zamani et al. in CHO cells (100 ng/ml) (Zamani et al. 2006).

The above-mentioned facts confirm that the gene-expression system using Leishmania parasites combines many of the advantages of both prokaryotic and eukaryotic expression systems. We could successfully express the rhIFN-γ in L. tarentolae and plan to produce higher amount for assay of glycosylation pattern by performing the future experiment and optimizations.