Introduction

Bacillus thuringiensis, a Gram-positive soil bacterium characterized by the production of parasporal inclusions, has been applied as a biopesticide for control of agricultural, forest, and medical insect pests [2, 6, 9]. The larvacidal activity of B. thuringiensis is attributed largely to the crystal protein encoded by the crystal (cry) genes.

The crystal proteins currently are classified into two families: Cry and Cyt proteins [6]. Proteins of the Cry3, Cry6, Cry7, Cry8, Cry18 [3–5, 13], and Cry43 classes [11], as well as the binary toxins Cry34A-Cry35A [1], are active against Coleoptera (beetles, including weevils). Among these classes, Cry3-type, Cry8-type, Cry18-type, and Cry43-type are toxic to larvae of the Scarabaeidae family.

Chafers are important insect pests, affecting more than 300 plant species in both Europe and Asia. The larvae destroy the underground parts of the plants, resulting in damage that may kill the plant or cause a significant reduction in productivity and substantial economic loss [12]. Until recently, no Cry chemical has been identified that is toxic to the melolonthine beetle (black Asian chafer), Holotrichia parallela (Scarabaeidae).

We previously reported a new B. thuringiensis isolate, Bt185, obtained from soil samples, that contains two novel cry8-type genes toxic to the larvae of H. parallela [12]. In the current study, we characterized the cry8-type genes and investigated the toxicity of the two proteins. Characterization included sequence analyses of the cry genes, observations using scanning electron microscopy, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and insect bioassays.

Materials and Methods

Bacterial Strains, Plasmids, and Growth Conditions

Escherichia coli JM110 (Dam, dcm, supE44, hsdR17, thi, leu, rpsL1, lacY, galK, galT, ara, tonA, thr, tsx, Δ[lac-proAB] [F′, traD36, proAB, lacI qZΔM15]) was used for common transformations, whereas E. coli SCS110 (RpsL[strr], thr, leu, endA, thi-1, lacY, galK, galT, ara, tonA, tsx, dam, dcm, supE44, Δ[lac-proAB] [F′ traD36 proAB lacI q ZΔM15]) was used to produce nonmethylated plasmid DNA for B. thuringiensis transformations.

In the transformation experiments, HD73−, a crystal-negative mutant strain of B. thuringiensis subsp. kurstaki, was used as a recipient strain. The B. thuringiensis isolate Bt185, screened from soil in China, produces spheric crystals and is toxic to H. parallela larvae [12]. Plasmid pSTK containing the cry3Aa promoter, the STAB-SD sequence, and multiple cloning sites from pET-21b, was derived from plasmid pHT315 by Wang et al. [10] and used to express the novel cry genes in the strain HD73−. Escherichia coli was incubated at 37°C in Luria-Bertani medium (1% NaCl, 1% tryptone, 0.5% yeast extract). Bacillus thuringiensis strains were grown at 30°C in peptone-beef medium (0.5% peptone and 0.3% beef extract). Ampicillin (100 μg/ml) or kanamycin (50 μg/ml) was added to the media, when appropriate, for selection of antibiotic-resistant strains of E. coli and B. thuringiensis. The initial media pH of all cultures was 7.2.

DNA Manipulations

Plasmid DNA from B. thuringiensis was prepared using methods described by Song et al. [8]. Transformation of B. thuringiensis HD73− with the recombinant plasmids was performed using the method described by Wang et al. [10].

Cloning of the Novel cry8-Type Gene

In addition to the cry8Ea gene in the Bt185 isolate, a 2-kb KpnI fragment (2.340 kb) was cloned and confirmed to be a partial-length novel cry8-type gene [12]. In the current research, to clone of this full-length novel gene, total plasmid DNA of Bt185 was digested by endonuclease ClaI and ligated into the pBlueScript II SK (+) cloning vector to construct a DNA library. The recombinant plasmids were transformed into E. coli JM110 cells, and the transformed cells were grown on Luria-Bertani plates containing ampicillin (100 μg/ml). Specific primers SC8X5 (CTGGAAAGTATTACGAAGAACT) and SC8X3 (TCCTGGACCTGCAATAACA), designed from the cry8-type partial gene in the 2-kb KpnI fragment, were used to screen the DNA library. A 2.6-kb ClaI fragment subsequently was cloned into the pBlueScript II SK (+) vector to produce a recombinant plasmid pS26, which was sequenced using an automated DNA sequencer (ABI-3730XL, USA). The sequences were analyzed using a Vector NTI Suite 9 (Invitrogen, Carlsbad, CA, USA).

Expression of the Two cry8-Type Genes

A Pyrococcus furiosus (pfu) DNA polymerase (Tiangen, Beijing, China) and the PTC-100 Peltier Thermal Cycler (MJ Research, Waltham, MA, USA) were used for polymerase chain reaction (PCR) consisting of 30 cycles (1 min at 94ºC, 1 min at 54°C, 4 min at 72ºC) followed by incubation at 72°C for 10 min. The primer pair Pcry8EF5 (CGCGGATCCGATGAGTCCAAATAATCAAAATG)/Pcry8Ea3 (GGCGTCGACCTCTACGTCAACAATCAATTC) was designed to amplify the cry8Ea1 gene, whereas the primer pair Pcry8EF5 (CGCGGATCCGATGAGTCCAAATAATCAAAATG)/Pcry8Fa3 (GGCCTCGAGCTCTACGTCAACAATCAATTC) was used to amplify the cry8Fa1 gene. A BamHI site in the cry8Fa1 gene was wiped using the primer pair M8FAF (GTGGGCAGAGTTAATGG)/M8FAR (GGTTCCTCTGGTGCAAAGA) and a TaKaRa MutanBEST Kit (TaKaRa, Dalian, China). No change occurred in the amino acid sequence.

The full-length PCR product of cry8Ea1 was inserted into the BamHI-SalI sites of pSTK, whereas cry8Fa1 was inserted into the BamHI-XhoI sites. The nonmethylated recombinant plasmid, produced in E. coli SCS110, was introduced into the B. thuringiensis acrystalliferous mutant HD73– by electroporation. The individual colony of transformants was selected from the Luria-Bertani kanamycin plates and incubated at 30°C until sporulation. The spore–crystal mixtures were washed and resuspended in sterile distilled water for examination by electron microscopy and SDS-PAGE analysis. The experiments were conducted according to Shu et al. [7].

Insect Bioassay

Toxicity activities of the B. thuringiensis strains were tested with 5-day-old larvae of H. parallela. Larval mortality was scored after a 14-day incubation period, and the 50% median lethal concentration (LC50) was determined by probit analysis. Each assay was repeated three times. The bioassay diet for the H. parallela larvae was prepared as described by Yu et al. [12].

Nucleotide Acid Sequence Accession Number

The nucleotide acid sequence data of the cry8 gene presented in this report have been registered in GenBank. The assigned accession numbers are AY329081 for the cry8Ea1 gene and AY551093 for cry8Fa1.

Results and Discussion

The cry8Ea full-length gene and a 2-kb KpnI fragment encoding a C-terminus of a Cry8-like protein with 780 amino acids were cloned in earlier research. In the current investigation, a 2.9-kb ClaI fragment (2.903 kb) from recombinant plasmid pS29 was sequenced and found to overlap with the 2-kb KpnI fragment. The 2-kb KpnI and the 2.9-kb ClaI fragments were reconstructed to be a 4-kb DNA fragment (4.003 kb).

After sequence analysis of the 4-kb DNA fragment, an open reading frame was identified that corresponded to a polypeptide of 1174 amino acids with a deduced molecular mass of 133.1 kDa. This protein was named Cry8Fa1 by the B. thuringiensis Delta-Endotoxin Nomenclature Committee. At comparison of the deduced amino acid sequences with known Cry proteins, Cry8Ea1 and Cry8Fa1 showed high similarity (70% and 63%, respectively) with Cry8Ba. Both Cry8Ea1 and Cry8Fa1 also contained the eight conserved blocks (blocks 1–8) (Fig. 1) present in other typical Cry proteins [6].

Fig. 1
figure 1

Comparison of the deduced amino acid sequences Cry1Aa, Cry8Ba, Cry8Ea, and Cry8Fa. The characters in the gray boxes are identical amino acids between these toxins. The bold lines above the amino acid sequence correspond to the eight conserved blocks found in Cry proteins

Full size image

Plasmid pSTK-8E, carrying the cry8Ea1 gene, and plasmid pSTK-8F, carrying the cry8Fa1 gene, were introduced into strain HD73− by electroporation. The transformants harboring pSTK-8E and pSTK-8F were named HD8E and HD8F, respectively. Spores of HD73− and spore–crystal mixtures of HD8E, HD8F, and Bt185 were examined under a scanning electron microscope. The Cry8Ea1 and Cry8Fa1 toxins accumulated in HD8E and HD8F, respectively, and could form spheric crystals (Fig. 2). As indicated by SDS-PAGE analysis, both Cry8Ea1 and Cry8Fa1 toxins had a molecular mass of approximately 133 kDa, similar to the toxins accumulated in wild-type BT185 (Fig. 2e, lanes 2 and 3).

Fig. 2
figure 2

Scanning electron micrographs and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of spores and crystal mixtures. a Bacillus thuringiensis strain BT185. b Recombinant strain HD8E. c Recombinant strain HD8F. d B. thuringiensis strain HD73−. e SDS-PAGE: lane M (marker [212, 119, 97, 66, 40 kDa]), lane 1 (protein components of B. thuringiensis strain BT185), lane 2 (protein components of recombinant strain HD8E), lane 3 (protein components of recombinant strain HD8F), lane 4 (protein components of B. thuringiensis strain HD73−)

Full size image

Spores of HD73− and spore–crystal mixtures of HD8E, HD8F, and Bt185 were tested for insecticidal activity on H. parallela larvae to investigate the toxicity of Cry8Ea1 and Cry8Fa1. The insecticidal activity of B. thuringiensis is dependent on the quantity and types of δ-endotoxins produced [6].

The results in this study showed that HD73− and HD8F were not toxic to H. parallela larvae. As shown in Table 1, HD8E showed greater activity against H. parallela larvae than Bt185. It is possible that the quantity of Cry8Ea1 accumulated in Bt185 was lower than in HD8E because Bt185 may express both Cry8Ea1 and Cry8Fa1 polypeptides. Significant differences in the amino acid sequences of the proteins may be responsible for the variability in the toxicity of the Cry molecules. In the current study, the amino acid sequences of the two toxins were found to be identical in the C-terminal region, but the three-domain region, believed to be responsible for the toxicity of the Cry proteins, was significantly different (similarity of only 39%). Our tests did not find HD8F toxic to any Scarabaeidae larvae (H. parallela, Anomala corpulenta, or H. oblita). The Cry8Fa1 protein may possibly be toxic to insect pests that have not yet been evaluated.

Table 1 Larvicidal activity of spores and crystal mixtures of BT185 and HD8E
Full size table

In conclusion, we determined that the novel Cry toxin, Cry8Ea1, demonstrated strong activity against larvae of the Asian chafer, H. parallela. To our knowledge, this is the only Cry toxin found to be toxic to this pest. Another cry gene, cry8Fa1, was cloned from the strain Bt185, but its toxicity to H. parallela has not yet been confirmed. Future research will investigate the use of the novel cry8Ea1 gene in transgenic plants to control H. parallela and will include studies to detect of the toxicity of Cry8Fa1.