Correction: Genome Biol 19, 205 (2018)
https://doi.org/10.1186/s13059-018-1581-3
Following the publication of the original paper [1], the authors reported a typographical error in the sequence of SAMlibrary-HiSeq_50bp-F1 used for NGS library preparation (as listed in Table S1).
The sequence for Primer 1: SAMlibrary-HiSeq_50bp-F1 has two extra bases inserted (in bold) ACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTTGTGGAAAGGACGAAACA
The correct sequence should be:
ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACA
Reference
Chong ZS, Ohnishi S, Yusa K, et al. Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Genome Biol. 2018;19:205. https://doi.org/10.1186/s13059-018-1581-3.
Author information
Authors and Affiliations
Corresponding author
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Chong, ZS., Ohnishi, S., Yusa, K. et al. Author Correction: Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Genome Biol 23, 224 (2022). https://doi.org/10.1186/s13059-022-02797-6
Published:
DOI: https://doi.org/10.1186/s13059-022-02797-6