INTRODUCTION

The complete mitochondrial DNA (mtDNA) sequence of vertebrates is a circular molecule with a length of about 16–19 kb (Anderson et al., 1981; Boore, 1999). The mitochondrial genome is frequently used for phylogenetic studies and population genetic analyses because of its compressed gene organization, fast evolutionary rate, maternal inheritance and lack of genetic recombination compared with the nuclear genome (Avise, 1994; Miya et al., 2001).

In recent years, complete mitochondrial DNA sequences have been extensively used to reconstruct the phylogeny of higher-level taxa (e.g. Kim et al., 2004; Jondeung and Karinthanyakit, 2015; Quezada-Romegialli et al., 2015).

The genus Aphanius has already been placed in the family Cyprinodontidae. However, based on the outcomes of recent molecular studies (e.g., Pohl et al., 2015; Helmstetter et al., 2016; Reznick et al., 2017), Aphanius is more closely related to Valencia, the livebearers of the families Anablepidae and Poeciliidae, and the African lampeyes (Aplocheilichthys and related genera), than to other genera in Cyprinodontidae. Therefore, Freyhof et al. (2017) concluded that the family Cyprinodontidae, as proposed by Parenti (1981), is polyphyletic, and proposed Aphaniidae as a valid family name for genus Aphanius (the Western Palaearctic killifishes).

The members of genus Aphanius are widely distributed throughout the Old World (Western Palaearctic and Near East) (Nelson et al., 2016; Freyhof et al., 2017). These fishes are commonly known as killifish or tooth-carps (Wildekamp, 1993). Among vertebrates, the family Aphaniidae represents a group that is particularly useful to study the micro-evolutionary processes shaping patterns of genetic structure and of geographic variation in natural populations, or of speciation processes associated to unstable ecological conditions (Villwock, 1976; Ferrito et al., 2007).

The different Aphanius species inhabit wide range of coastal and landlocked habitats in the drainages of Mediterranean, Red Sea and the Persian Gulf basins (Widemakp, 1993). In its native distribution ranges, 34 species have been recorded for the genus Aphanius so far (Wildekamp, 1993; Teimori et al., 2016; Van der Laan and Fricke, 2018).

By considering its diversity and biogeographic distribution, central Anatolia and Iran are known to show the highest diversity of Aphanius members (Hrbek and Meyer, 2003; Teimori, 2013; Freyhof et al., 2017; Teimori et al., 2018). Currently, 15 extant and one fossil Aphanius species have been discovered and reported from Iran (e.g. Coad, 2000, 2009; Hrbek et al., 2006; Gholami et al., 2014; Esmaeili et al., 2014; Teimori et al., 2012, 2014, 2018) in which 12 species are endemic to this country (Teimori et al., 2016). Therefore, the notable feature of Iranian killifish diversity is its high endemicity. Most of the endemic Aphanius species in this country are distributed in the closed endorheic basins associated with the mountainous regions of Zagros, and characterized by small population size (Gholami et al., 2014; Teimori et al., 2016).

Aphanius farsicus (Fig. 1) is an endemic killifish in the endorheic Lake Maharlu Basin, Southern Iran (Teimori et al., 2011; Esmaeili et al., 2016). It is found in freshwater streams and springs and in the springs of varying saline content or saline influence from hypersaline chloride Lake Maharlu (Esmaeili et al., 2016).

Fig. 1.
figure 1

Female (a) and male (b) of Aphanius farsicus captured from a live fish kept in aquarium. Photo provided by Mehregan Ebrahimi.

Full size image

Several studies have used mtDNA to study genetic diversity and phylogeny and evolution of Aphanius species so far. Yaripour et al. (2017) by applying five microsatellite markers studied genetic structure of Aphanius farsicus from the Maharlu Lake basin in Southern Iran. Another study by Salimi et al (2018) investigated genetic diversity in two Aphanius species (A. ginaonis and A. stoliczkanus) in southern Iran by using PCR-RFLP technique. Angeletti et al. (2010) studied genetic diversity of Aphanius fasciatus and found that the genetic variability of this species strongly reduced through time. Also, several previous studies (e.g. Hrbek and Meyer, 2003; Teimori et al., 2012, 2013, 2014, 2018; Esmaeili et al., 2014) investigated phylogenetic relationships, and evolutionary history of different Aphanius species and populations. Therefore, these studies show the value of mtDNA markers for population genetic structure, stock identification, phylogeny, evolution and conservation genetics.

For that reason, in this study, for the first time we sequenced, and characterized the complete mtDNA genome of the endangered killifish A. farsicus. Additionally, we conducted phylogenetic analyses based on the complete mitochondrial genome with the purpose of investigating the phylogenetic position of A. farsicus within the order Cyprinodontiformes.

MATERIALS AND METHODS

Sample Collection and DNA Extraction

The sample of Aphanius farsicus was collected by hand net from a small spring around the Lake Maharlu in Southern Iran. The species were identified at the field by observing morphological characters. A piece of muscle tissue was removed from the individual and preserved in 95% ethanol for DNA extraction. Total genomic DNA from muscle tissue was extracted using standard protocol of FavorPrep Tissue Genomic DNA ExtractionMini Kit (FAVORGEN).

Primers Design and Sequencing

The complete mitogenome of A. farsicus was amplified using a long polymerase chain reaction amplification (long PCR-technique) (Miya and Nishida, 1999; Miya and Nishida, 2000). Six sets of primers (Table 1) were designed based on multiple alignments of the conserved region of the complete mitochondrial DNA sequences of other Cyprinodontiformes extracted from NCBI; including Orestias ascotanensis (NC_027582) (Quezada-Romegialli et al., 2016), Cyprinodon variegatus (KR061357) (Barcelon and Lema, 2016) and Jordanella floridae (AP006778) (Setiamarga et al., 2008) as well as the partial sequence of 12S ribosomal RNA gene, the complete sequence of tRNA-Val gene, and the partial sequence of 16S ribosomal RNA gene which were previously determined for Aphanius persicus (AY593493) (Hrbek et al., 2006) (now A. farsicus, Teimori et al., 2011).

Table 1. Primer pairs used to amplify mtDNA of Aphanius farsicus with long-PCR (all of the primers are designed in the present study)
Full size table

Thereafter, 25 normal PCR primer sets were designed to obtain contiguous, overlapping segments of the entire mitogenome (Table 2).

Table 2.   Primer pairs used for normal PCR amplification (all of the primers are designed in the present study)
Full size table

The NCBI Primer designing tool (https://www. ncbi.nlm.nih.gov/tools/primer-blast/) used to design primers. Primers used in this study were synthesized by DenaZist and Pishgam companies (Tehran-Iran). It was necessary that every two contiguous segments overlapped by at least 50 bp to ascertain the accuracy of sequencing.

Mitochondrial DNA Amplification

Super PCR MasterMix 2X (Yekta Tajhiz Azma-Tehran-Iran) was used to amplify mitochondrial DNA segments using primers listed in Table 1. This reactions were carried out in 25 μl reaction mixture containing 12.5 μL of super PCR MasterMix 2X, 1 μL of DNA template (1 μg), 1 μL of each primer (10 μM), and 9.5 μl sterile distilled H2O. These reactions consisted of an initial denaturing step at 94°C for 4 min, followed by 35 cycles of denaturing at 94°C for 30 s, annealing at 55–58°C (the details of temperature indicated in Table 1) for 45 s and extension at 72°C for 3 min, following with final extension at 72°C for 7 min.

Six mitochondrial DNA segments with ranges from 1.3 to 4 kbp amplified and used as a template in normal PCR using primers listed in Table 2. The Taq DNA Polymerase MasterMix (Ampliqon) used for normal PCR using primer listed in Table 2.

The normal PCR was performed following the standard procedure; containing 12.5 μL of Taq DNA Polymerase MasterMix, 1 μL of amplified mitochondrial segment (achieved by the above mentioned process), 0.5 μL of each primer (10 μM), and add sterile distilled H2O to bring volume to 25 μL. Normal PCR reactions consisted of an initial denaturing step at 94°C for 3 min, following 30 cycles of denaturing at 94°C for 30 s, annealing at 54–58°C (exact temperature indicated in Table 2) for 45 s and extension at 72°C for 1 min, following with final extension at 72°C for 5 min.

Negative controls were included in all PCR amplifications to confirm the absence of contaminants. PCR products were purified sequencing was accomplished by primer walking method (Bioneer-south Korea).

Sequence Editing and Analysis

Sequence trace files were corrected and aligned with the SeaView v. 3.2 (Gouy et al., 2010) and Geneious v. 11.1.5 (Kearse et al., 2012). The locations of 13 protein-coding genes and two rRNA genes were determined by their similarity to published mitogenomes of other killifish species as shown in Table 3, whereas the tRNA genes were identified using the program tRNAscan-SE 2.0 (Lowe and Chan, 2016). Some tRNA genes that could not be found by the tRNAscan-SE, were identified by their secondary structure and their position in the mitogenome (Zhang et al., 2009).

Table 3.   Overview on the fish species used in this study
Full size table

The structure of control region and its conserves motifs were identified by making a comparison with homologous sequences of reported teleost (Quezada-Romegialli et al., 2015; Keepers et al., 2016; Xu et al., 2018).

Phylogenetic Analyses

To clarify the phylogenetic position of A. farsicus within the order Cyprinodontiform, the complete mitochondrial genomes of other 15 killifish species were downloaded from GenBank database (Table 3). In this data set, possible close outgroups in Beloniformes were also choose to root phylogenetic trees (Table 3). We did not include gene ND6 in our data set for phylogenetic analysis owing to its high heterogeneity and poor phylogenetic performance (Miya and Nishida, 2000).

A final data set of 16530 bp including various Cyprinodontiform sequences accompany with two out groups was aligned using Muscle 3.6 (Edgar, 2004) as incorporated in SeaView, under default settings. Finally, phylogenetic position of A. farsicus based on 16 representative killifish complete mitogenome was validated by constructing a maximum likelihood tree with RAxML 7.2.8 (Stamatakis et al., 2008) under a GTR + G + I model, and 1000 rapid bootstrap replicates. The best-fit nucleotide substitution model (GTR + G + I) was selected by AIC (Akaike Information Criterion) using JModelTest (Posada, 2008).

RESULTS AND DISCUSSION

This is the first study that reports complete mitogenome of the genus Aphanius. The complete mitochondrial genome of Aphanius farsicus was 16.530 bp in size, including 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a putative control region. The gene order of A. farsicus mitochondrial genome was shown in Fig. 2, and the details of organization of the A. farsicus mitogenome are shown in Table 4. There was a non-coding region spanning 884 bp between genes tRNAPhe and tRNAPro with a high A + T content that was identified as a putative control region (Table 4). The complete genome sequence was deposited in GenBank database under the accession number MN578038.

Fig. 2.
figure 2

Gene organization of Aphanius farsicus mitochondrial DNA. ND1-6 refers to NADH dehydrogenase subunits 1-6. COI-III refers to cytochrome c oxidase subunits 1-3, ATP6 and ATP8 refers to ATPase subunits 6 and 8, and Cyt b refers to cytochrome b.

Full size image
Table 4.   Organization of the Aphanius farsicus mitogenome
Full size table

The gene order of mitochondrial DNA of A. farsicus was similar to other killifishes such Orestias ascotanensis (NC_027582), Cyprinodon nevadensisamargosae (KU883631) and Jordanella floridae (AP006778) (Setiamarga et al., 2008; Quezada-Romegialli et al., 2016).

The overall nucleotide composition of mitochondrial genome in A. farsicus was 27.09 for A; 27.87 for T; 16.89 for G; and 28.14% for C (GC content of 45%, and A + T content of 55%). The overall GC and AT content in A. farsicus was almost close to the fishes of family Cyprinodontidae such as Orestias ascotanensis, Jordanella floridae and Cyprinodon diabolis rather than the members of other families of the order Cyprinodontiformes (Table 5). These species are phylogenetically close to A. farsicus (Aphaniidae) rather than other examined fishes of the order Cyprinodontiformes (see phylogenetic tree).

Table 5.   Overview on nucleotide composition of the mitogenome in Aphanius farsicus and other killifish species used in this study
Full size table

Protein-coding Gene (PCG) Features

Aphanius farsicus mitochondrial genome encoded 13 protein-coding genes with 11462 bp in length, which accounted for 69.34% of the complete mitogenome (Table 5).

The boundaries between protein-coding genes of the mitochondrial genome were determined by aligning their sequences and identifying translation initiation and termination codons with comparison to other killifishes. The nucleotide composition in 13 protein coding genes was 25.40 for A, 30.27 for C, 15.43 for G and 28.88% for T. The A+T content of protein-coding gene were 61.20%. The lengths of protein-coding genes ranged in size from 169 (ATP8) to 1863 bp (ND5).

Transfer and Ribosomal RNA Gene Features

The complete mitochondrial genome in Aphanius farsicus contained 22 tRNA genes, which were totally 1552 bp in length and interspersed between the rRNA and the protein-coding genes with the ranges from 65 bp (tRNATry) to 77 bp (tRNASer and tRNAPro). The overall A + T content of 22 tRNAs was 57.20% with the composition of A = 30.21, G = 20.61, T = 26.99, C = 22.16%. The 16S and 12S ribosomal RNA genes were 1687 and 945 bp in length respectively, and located between genes tRNALeu and tRNAPhe and separated by gene tRNAVal. The A + T content was 55.80% for 16S rRNA gene (A = 32.36, G = 21.57, T = 23.41, C = 22.64%), and 52.20% for 12S rRNA gene A = 31.21, G = 21.26, T = 20.95, C = 26.56%), respectively.

Non-Coding Control Region (CR)

The nucleotide composition in D-loop (non-coding control region) was 28.95 for A, 23.19 for C, 15.61 for G and 26.58% for T. The A + T content of the control region were 61.20%, which was higher than the average value of the whole mitochondrial genome (i.e., 55.00%) (Table 4).

The mitochondrial DNA control region is a variable sequence that have a regulatory functional in transcription and replication of mtDNA. It is characterized by conserved sequence blocks, including the typical tripartition with a terminal associated sequence (TAS), a central and conserved sequence block (CSB) domains containing the conserved sequence blocks CSB-F, CSB-E and CSB-D (Sbisà et al., 1997). It additionally has a variable domain consists of three conserved sequence blocks (CSB-1, CSB-2, CSB-3). These blocks can be determined by multiple homologous sequence alignment with other related taxa.

The TAS domain is located between the 5' end of the control region and the beginning of the CSB-F. Generally, the length of TAS domain varied from 243 bp to 357 bp (Wang et al., 2011). Our results indicate that the TAS domain in A. farsicus was 301 bp length, and started with TACAT (Fig. 3). In addition, two central conserved sequence blocks CSB-F (TGAGACAAAAATCGTGGGGG) and CSB-D (TATTACTGGCATTTGGTTCCT) were detected in the control region of A. farsicus mitogenome (Fig. 3), while the typical central conserved CSB-E could not be found. Moreover, conserved sequence blocks; CSB-1, CSB-2 and CSB-3 were identified at the 3' end of the control region. These sequences might be associated in positioning RNA polymerase (Clayton, 1991; Shadel and Clayton, 1997).

Fig. 3.
figure 3

Partial sequence of mitochondrial control region of Aphanius farsicus. In the control region, the termination associated sequence (TAS), central conserved sequence blocks (CSB-F, CSB-D), and conserved sequence blocks (CSB-1, CSB-2 and CSB-3) are boxed and marked.

Full size image

Phylogenetic Analysis

Maximum likelihood tree was estimated based on whole mitochondrial genome of 16 examined killifish including Aphanius farsicus (Fig. 4). The ML tree presented seven major clades corresponding to the families of the order Cyprinodontiformes i.e., Rivulidae, Aplocheilidae, Poeciliidae, Fundulidae, Goodeidae, Cyprinodontidae, and Aphaniidae. Phylogenetic relationships based on the whole mitogenome of the examined killifishes are congruent with previous work (Quezada-Romegialli et al., 2015).

Fig. 4.
figure 4

Phylogenetic hypothesis of Aphanius farsicus and related taxa in the order of Cyprinodontiformes based on their complete mitogenome. On each branch is denoted maximum likelihood bootstrap support. Numbers behind the species refer to the accession numbers.

Full size image

All the studied families are monophyletic. However, phylogenetic position of the clade VI (family Cyprinodontidae) and VII (family Aphaniidae) are questionable. In their previous study, Quezada-Romegialli et al. (2015) have documented high intra-family variability in the family Cyprinodontidae with regard to the whole mitogenome. They showed that within the family Cyprinodontidae, the genus Orestias is monophyly with high bootstrap value, and is sister to a clade containing Jordanella and Cyprinodon. The monophyly of genus Orestias and its phylogenetic relation to the genera Jordanella and Cyprinodon are now supported by our phylogenetic analysis (Fig. 4). However, they did not analyze genus Aphanius in their study.

Here for the first time we provided the complete mitogenome in one of the Aphanius species i.e., A. farsicus. In our phylogenetic hypothesis, we included the complete mitogenome of A. farsicus into the data set, and found that the genus Cyprinodon is sister to the genus Aphanius and both together form sister group to the genus Jordanella.

It should be noted that the genus Aphanius has already been in the family Cyprinodontidae. However, in their recent study, Freyhof et al. (2017) proposed the name Aphaniidae as valid family for the members of the genus Aphanius (the Western Palaearctic killifishes), while restricting the family Cyprinodontidae to the New World genera such as Cyprinodon, Floridichthys and Jordanella.

As mentioned above, in our phylogenetic analysis, a close phylgenetic relation was found between the genera Aphanius (now in the family Aphaniidae) and Cyprinodon (now in the family Cyprinodontidae) considering their complete mitogenome. Therefore, we assumed that the validation of family Aphaniidae still needs more phylogenetic supports, and this can be investigated by adding more sequences of the Aphanius members.