1 Introduction

Plant growth-promoting rhizobacteria stimulate health and productivity of plants by the solubilisation of minerals, promoting root growth and suppressing root diseases. The predominant belong to Azospirillum, Bacillus, Pseudomonas, and Agrobacterium (Khan and Bano 2016a; Viveros et al. 2010). Plant roots exude a variety of nutrients, organic compounds, and signals that attract microbial populations (Bais et al. 2006; Drogue et al. 2012; Pothier et al. 2007; Shukla et al. 2011). The resultant bacterial community associated with the plant roots has been termed the rhizo-microbiome (Chaparro et al. 2013). Its composition is different from the microbes found in the adjacent soil (Bulgarelli et al. 2013; Chaparro et al. 2013; Raynaud et al. 2008). Since the root exudates vary in relation to the root development stage and plant genotypes, the rhizo-microbiome also fluctuates (Aira et al. 2010; Berg and Smalla 2009; Bouffaud et al. 2012; Bulgarelli et al. 2013; Chaparro et al. 2013). These rhizobacteria have been shown to increase root growth that leads to a system with a larger surface area and enhanced number of root hairs (Mantelin and Touraine 2004).

Nutrients and water are taken up by plants through the rhizo-sheaths; the soil stuck firmly to the crop roots (McCully and Canny 1988; Watt et al. 1994) that deliver a carbon supply to the microbial community involved in cycling minerals to the growing plants (Nannipieri et al. 2003). Rhizo-sheath formation involves exopolysaccharides (EPS) (Czarnes et al. 2000). These polymers are produced and released by soil micro-organism associated with roots of the plants (Gilck et al. 1999; Vanhaverbeke et al. 2003). They have roles such as biofilm formation (Bhaskar et al. 2005), protection of the bacteria from dehydration (Pal et al. 1999), and binding of toxic metals (Fusconi and Godinho 2002) which make them of value in bioremediation (Allison 1998). Bacteria like Pseudomonas aeruginosa, Bacillus subtilis and Streptococcus mutans are known for their EPS production (Vimala and Lalithakumari 2003).

The present study set out to isolate and characterize the plant growth promoting rhizobacteria from sandy soils in three areas of Pakistan: Karak, Cholistan and Bhakkar. The role of these bacteria was evaluated on the root growth of wheat under water stressed conditions that prevail in the areas from which the soils were collected.

2 Materials and methods

The soil samples used in this study came from three areas in Pakistan.

Karak is a district in the province of Khyber Pakhtunkhwa (KPK), Pakistan. It is 124 km from Peshawar on the main indus highway between Peshawar and Karachi and located at 33°7′12 N 71°5′41E. The climate is hot during the summers, with temperatures up to 40–45 °C. The main crops of the district include wheat (Triticum aestivum), bajra (Pennisetum glaucum), maize (Zea mays) and pulses.

The Cholistan desert is a part of the Great Indian Desert with an area of 26,332 Km2. It lies inside the southeast quadrant of Punjab between 27o 42′ and 29o 45′ North latitude and 69° 52′ and 73o 05′ East longitude. It has extreme summer temperatures (above 50 °C) along with extended droughts. The main crop of the desert are pulses.

Bhakkar is a district in the province of Punjab, Pakistan. It is located in the west of the Punjab province. Bhakkar has a desert climate with 18% Humidity. There is only 213 mm of rainfall during the year. It has extreme summer temperatures (above 45 °C). The main crops are wheat (Triticum aestivum L.), gram (Cicer arietinum), guwara (Cyamopsis tetragonoloba) and bajra (Pennisetum glaucum).

The experimental work was carried out in the field under natural condition in the sandy area at Grot chowk, 20 km away from Khushab, Punjab. It is the driest and hottest district with diverse topography, located at 32o 17 48 N to 72o 21 9 E having arid hills with bushy vegetation in its north (Soon Sakesar Valley). The central part is an irrigated lowland plain and southern part is a hot dry thar desert with sparce vegetation. The temperature ranges from 25 to 48 °C in summer and 19–29 °C in winter with average annual precipitation of 521 mm (Table 1).

Table 1 Experimental work plan
Full size table

Seeds of two wheat varieties (i.e., Drought sensitive (Galaxy-13) and tolerant (Pak-2013) were provided by the National Agricultural Research Centre, Islamabad.

2.1 Collection of soil samples

Bacterial colonies were isolated from the rhizosphere soil samples collected from Karak,

Bhakkar and Cholistan. The soil samples were collected at 6 in. depth from top soil from Karak, Bhakar and Cholistan desert. The pH and electrical conductivity (EC) of soil samples were measured according to the method of McKeague (1978) and McLean (1982) separately.

2.2 Isolation and growth of bacteria from soil

Serial dilution method was followed for bacterial isolation from the three different soil samples. One gram of soil sample was suspended in distilled water (9 ml), stirred for 1 h with magnetic stirrer, the soil suspension thus obtained was centrifuged (3000 rpm) for 10 min. the supernatant was collected for which decimal dilutions were made. 20 ml aliquots from three dilutions i.e., 10−1, 10−5, and 10−7 were spread on Luria Bertini (LB) agar plates and nurtured for 2 days. After incubation different colonies were streaked on LB agar plates, 4–5 times until pure colony is obtained in each case.

2.3 Sterilization of seeds

Surface sterilization of seeds was done by shaking in 95% ethanol, followed by shaking in 10% Clorox. Subsequently, autoclaved distilled water (3–4x) was used for washing of seeds.

2.4 Method of inoculation

A fresh culture of bacteria was prepared by inoculating bacteria in LB broth (28 °C). The inoculated LB culture was then incubated in shaker for 2 days, thereafter, centrifuged at 10,000 rpm for 10 min, pellet was obtained after removal of supernatant and was suspended in distilled water. The optical density (at 660 nm) was adjusted to be 1. The inoculated broth was used for seed soaking for 3 h and then the seeds were sown in the field.

2.5 Characterization of isolates

2.5.1 Morphology and enzyme activity

For identification of bacterial strains, fresh cultures obtained after 24 h of their growth on agar plates (Miller 1972) and were studied under microscope. The catalase activity was assessed using the method of MacFaddin (1980) and the method of Steel (1961) was followed for the detection of oxidase in the bacterial cells.

2.5.2 DNA extraction

The TY broth was inoculated with single colony of fresh bacterial cultures which was grown in shaker (Excella E 24, New Brunswick Scientific USA) overnight. The culture was than centrifuged at 12,000 rpm at 4 °C for 10 min. The pellet of the cells were resusupended and lysed using lysis buffer. The protein and cell debris were discarded by centrifugation after adding 60 ml NaCl (5 M). The supernatant obtained was transferred to another test tube to which chloroform was added and the tube was inverted 50X for proper mixing with the chloroform. The process of centrifugation was repeated and the DNA was precipitated in the 100% ethanol which was air dried. The DNA was dissolved again in autoclaved distilled water, the purity of DNA and its concentration was determined by nanodrop spectrophotometer at 260 nm (Chen and Kuo 1993).

2.5.3 PCR-amplification and 16S rRNA sequence analysis

Amplification of genomic DNA of bacterial isolates was done by the method of Weisburg et al. (1991). The primer used for PCR-amplification has the nucleotide sequence as fd1 (AGAGTTTGATCCTGGCTCAG) and rd1 (AAGGAGGTGATCCAGCC). The reaction mixture contained genomic DNA (50ug), MgCl2 (1.5 mM), buffer (10X), Taq DNA polymerase (1u), dNTP mix (0.2 mM) and 10 moles of each primer. The volume was adjusted to 25ul using autoclaved pure water. The operating conditions were as follows:

The 30 cycles of the reactions were repeated through following reaction sequences: denaturation for 30 s at 94 °C, annealing at 55 °C for 30 s, extension for 2 min at 72 °C and one additional cycle for chain elongation for 10 min at 72 °C. The amplified PCR products were electrophoresed on 1.2% (w/v) agarose gel with DNA ladder (1 kb) as molecular marker. The gel was stained with 0.01gm/ml ethidium bromide and examined under UV trans-illuminator lamp.

2.5.4 Sequencing

The approximately 1400 bp purified PCR products were sequenced by using primers 27 F AgAgTTTgA TCM TGG CTC Ag, 1492R TAC ggY TAC CTT gTTACg ACT T, 518 F CCA gCAgCCgCggTA ATA Cg, and 800R TAC CAgggT ATC TAA TCC. Sequencing was accomplished by means of Big Dye terminator cycle sequencing kit v.3.1 (Applied BioSystems, USA). Sequencing products were resolute on an Applied Biosystems model 3730XL automated DNA sequencing system (Applied BioSystems, USA) at the Macrogen, Inc., Seoul, Korea.

2.5.5 Phosphorous solubilization index

Pikovskaya’s media was transferred into sterilized petri plates and pin point inoculation was made with 24 h old culture of the isolated plant growth promoting rhizobacteria. The inoculated plates were incubated for 7 days (28 °C). SI (solubilization index) was calculated by the formula of Pikovskaya (1948).

$$ \mathrm{S}\mathrm{I}=\mathrm{Colony}\ \mathrm{diameter}\left(\mathrm{cm}\right)+\mathrm{halozone}\ \mathrm{diameter}\left(\mathrm{cm}\right)/\mathrm{Colony}\ \mathrm{diameter}\left(\mathrm{cm}\right) $$

2.5.6 Antibacterial and antifungal activities of isolated plant growth promoting rhizobacteria

Antibacterial and antifungal activities were determined by Agar well Diffusion method (Navarro et al. 1996) and agar tube dilution method (Washington and Sutter 1980) respectively. Test tubes containing sterile sabouraud dextrose agar (SDA) were incubated with bacterial and fungal strains (Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Helminthosporium sativum, Fusarium solani) and the test organisms (plant growth promoting rhizobacteria) while being kept in a slanted position. Growth inhibition was observed after an incubation period of 7 days in comparison to uninoculated controls withoutplant growth promoting rhizobacteria.

2.5.7 Extraction, purification and characterization of exopolysaccharides

Mineral salt medium (optimized) was used for culturing EPS-producing bacteria (Bramchari and Dubey 2006). The plant growth promoting rhizobacteria cultures in this medium were than centrifuged at 15,000 rpm (10 min) after 10 day incubation period. The supernatant was mixed with 2 fold ice cold ethanol (95%) for EPS extraction and the complete precipitated solution was cooled at 4 °C and EPS was obtained from overhead solution (Kumar et al. 2011). The extracted EPS were lyophilized with Labonco lyophilizer at 3000 psi and stored at room temperature (Bramchari and Dubey 2006). Slight amounts of lyophilized EPS were deferred in 2 ml of benzene, water, chloroform, acetone, ethanol, and methanol for determination of its solubility. The mixture was vortexed and stabilized for some time until the pellet development was observed.

2.5.8 Relative water content (RWC)

Relative water content (LRWC) was estimated for fresh leaves according to Weatherly (1950).

$$ \mathrm{R}\mathrm{W}\mathrm{C}\left(\%\right)=\left[\left(\mathrm{F}\mathrm{W}-\mathrm{D}\mathrm{W}\right)/\left(\mathrm{T}\mathrm{W}-\mathrm{D}\mathrm{W}\right)\right]\times 100 $$

FW: represents sample fresh weight; TW: sample turgid weight; DW: sample dry weight.

2.5.9 Root fresh and dry weight

Fresh weight of roots of five plants was measured with the help of an electronic balance. The roots were than dried in oven at 70 °C till constant weight and their dry weight was measured.

2.5.10 Soil organic matter

Soil organic matter was calculated according to the method described by Mylavarapu (2009).

2.5.11 Data analysis

The data were examined statistically by factorial ANOVA using statistics software (STATISCA version. 8.1). All treatments were tested in an experiment using randomized complete block design (RCBD) with four replicates.

3 Results

3.1 Alignment of 16S rRNA sequence

For the plant growth promoting rhizobacteria isolate P1 from the rhizosphere of wheat (Triticum aevestivum L.) grown in the arid region of Karak (7% moisture content), a total length of sequence with 1480 nucleotide bases was obtained. The assessment of the nucleotide sequence with data nucleotide bank exhibited maximum sequence resemblance of 99% with 1478/1480 bases with that of Planomicrobium chinense strain (ACC No.: JP007457.1). For the isolate P2 obtained from the arid region of Bhakkar (6% moisture content), the total length of sequence with 1483 nucleotide was attained. The evaluation of the nucleotide sequence with data nucleotide bank indicated sequence similarity of 99% (1482/1483 bases) with Bacillus cereus strain (ACC No.: CP003187.1). For the isolate P3 attained from arid region of Cholistan desert (4% moisture content), the total length of sequence with 1474 nucleotide was obtained. The evaluation of the nucleotide sequence with data nucleotide bank showed maximum sequence similarity of 99% (1472/1474 bases) with Pseudomonas fluorescens (ACC No.: GU198110.1).

3.2 Phosphorus solubilization index

The three plant growth promoting rhizobacteria were phosphate solubilizer, Bacillus cereus was the most effective phosphorus solubilizer with phosphorus solubilisation index of 2.986. The phosphorus solubilization indices for Planomicrobium chinense and Pseudomonas fluorescens were 2.142 and 1.444, respectively.

3.3 Antibacterial and antifungal activities of plant growth promoting rhizobacteria isolates

Planomicrobium chinense and Bacillus cereus inhibited the growth of bacterial strains i.e., Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Klebsiella pneumonia and Escherichia coli. The cultures of Pseudomonas fluorescens showed no response against Pseudomonas aeruginosa (Table 2).

Table 2 Antibacterial and Antifungal activities of selected PGPR
Full size table

Maximum inhibition (58%) in mycelial growth of Helminthosporium sativum was detected due to B. cereus Whereas, P. chinense and P. fluorescens were ineffective against Helminthosporium sativum. B. cereus dramatically repressed the growth of Fusarium solani (92%) followed by P. fluorescens (73%) (Table 2).

3.4 Solubility and chemical composition of exopolysaccharides (EPS)

The lyophilized EPS was solvable in water and unsolvable in benzene, acetone and chloroform (Table 3). The chemical composition of plant growth promoting rhizobacteria induced EPS shown that the sugar and protein contents of EPS were 95% and 98% in P. chinense, 93% and 96% in B. cereus and 92% and 98% in P. fluorescens, respectively. However, highest (92%) uronic acid was found in B. cereus.

Table 3 Chemical characterization of EPS
Full size table

3.5 Soil moisture content

The moisture content of the rhizosphere soil was increased in all the treatments over un-inoculated control (Fig. 1). The maximum increase (88%) were recorded in T5 > T6 > T7 > T8 for the tolerant variety which was even greater (41%) than the irrigated control and ranked as T6 > T7 > T8 > T5 for the sensitive variety. In T1 (P1 inoculation) and T4 (coinoculation with P2 + P3 along with salicylic acid and putrescine) the soil moisture content of sensitive variety was higher than that of the tolerant variety. T2 and T4 had equal % increase in soil moisture content of tolerant variety. T6, T7 and T8 significantly enhanced the soil moisture content over uninoculated control and irrigated control in the sensitive variety. Thus, demonstrating that addition of salicylic acid and Putrescine had significant effect on the soil moisture content.

Fig. 1
figure 1

Moistute content of rhizosphere soil of droght sensitive and tolerant wheat variety

Full size image

3.6 Relative water content

All the inoculated treatments enhanced the relative water content of leaves over uninoculated control (Fig. 2). The relative water content of the tolerant variety was higher than that of the sensitive variety. Whereas, effect of T3 (coinoculation of P1 and P2) was at par for both tolerant and sensitive variety. Both the sensitive and tolerant varieties were more responsive to salicylic acid. Plants of sensitive variety, receiving the foliar spray of salicylic acid enhanced (89%) the relative water content. The effect of T4 (P1 and P2 is association with salicylic acid and putrescine) was higher than the effect of T3 (coinoculation of P1 and P2). Highly significant increase (86%) in tolerant variety was due to T4 followed by T7 = T2. Thus demonstrating that the addition of salicylic acid and putrescine had significant stimulatory effect on relative water content. The salicylic acid itself was also stimulatory to enhance water holding capacity of soil and relative water content of plants but to increase the root biomass they perform better working synergistically with the plant growth promoting rhizobacteria alone or more so in the consortium (e.g., T7 versus T8).

Fig. 2
figure 2

Relative water content of leaves of sensitive and tolerant wheat variety. T1-Seeds inoculated with P1; T2- Seeds inoculated with P1 + Sprayed with SA and Putrescine; T3- Seeds inoculated with P2 and P3; T4- Seeds inoculated with P2 and P3+ Sprayed with SA and Putrescine; T5- Seeds inoculated with P1, P2 and P3; T6- Seeds inoculated with P1, P2 and P3+ Sprayed with SA and Putrescine; T7- Plants sprayed with Salicylic acid; T8- Plants sprayed with Putrescine;T9-Untreated uninoculated control; T10-irrigated control. (P1: Planomicrobium chinense , P2: Bacillus cereus , P3: Pseudomonas fluorescence)

Full size image

3.7 Nutrient analysis of rhizospheric soil

The total NO3-N content was increased in all the treatments over uninoculated stressed control (Fig. 3). In T2 (P1 in association with salicylic acid and putrescine), T3 (coinoculation of P2 and P3) and T8 (plants sprayed with putrescine), the total NO3-N of rhizosphere soil were higher in sensitive variety than that of the tolerant variety. Maximum increase (60% and 27%) in NO3-N content was due to T3 (coinoculation of P2 and P3) and T3 = T6 as compared to uninoculated stressed control (T9) and irrigated control (T10) respectively. Plants sprayed with salicylic acid (T7) and putrescine (T8) enhanced (54%) the NO3-N content as compared to untreated control. While in tolerant variety maximum increase (58% and 25%) was due to T6 (coinoculation of P1, P2 and P3 in association with salicylic acid and putrescine) as compared to uninoculated stressed control and irrigated control respectively. Whereas, total P-content was higher in T1, T2, T4, T5 and T6 but maximum increase (70 and 60%) was in plants sprayed with salicylic acid (T7). The % increase of nutrients was always higher in the tolerant variety.

Fig. 3
figure 3

Total Nitrate-nitrogen and available P-content of wheat rhizospheric soil

Full size image

Plant growth promoting rhizobacteria increased the K, Mg, Ca and decreased Na content in soil (Table 4). The K content was higher than Na Ca and Mg contents (T10). Both salicylic acid and putrescine either used alone or in combination with plant growth promoting rhizobacteria increased (41 and 51%) the Ca and K content over untreated (T9) and irrigated control (T10) in both the sensitive and tolerant varieties. The P1 and P2 inoculations increased the Ca and K contents of plants significantly over control. Significant increase (67%) in Mg and Na content of soil sample was observed due to P1 inoculation (T1) in sensitive variety and combined treatment of P1 and salicylic acid (T2) in tolerant variety as compared to stressed (T9) and irrigated control (T10). The K contents were higher in tolerant variety over that of stressed and irrigated control except T1, T3 and T4 treatments.

Table 4 Ca, Mg, Na, K contents and Na/K and Na/Ca ratio of rhizosphere soil of the wheat plants un-inoculated and inoculated with EPS-producing bacteria
Full size table

3.8 EC and pH

The EC was higher in rhizosphere soil in sensitive variety than that of tolerant variety in T3 (coinoculation of P2 and P3) and T5 (coinoculation of P1, P2 and P3) (Table 4). Electrical conductivity was 30% higher in soil samples treated with T3 in sensitive variety as compared to uninoculated control (T9) Whereas, in tolerant variety maximum increase (25%) was recorded in T1 and T1 = T4 = T6 = T10. Overall, the treatments had shown no significant differences in the pH of soil samples.

3.9 Root fresh and dry weight

The root fresh weight was significantly increased (70%) in all the treatments over un-inoculated stressed control (Fig. 4) but T6 (in both the varieties) and T2 (tolerant variety only) showed significant increases (27% and 37%) over irrigated control. T6 (P1, P2 and P3 in association with salicylic acid and putrescine) had 28% and 22% increases over T5 (coinoculation of P1, P2 and P3) and T4 (P2 + P3 in association with salicylic acid and putrescine). The root dry weight was increased in all the treatments over un-inoculated stressed control though the values were lower than that of irrigated control. In T5 and T6 the dry weights of sensitive variety were (31% and 17%) higher than that of tolerant variety. Higher increases were recorded in treatments which ranked as T4 > T2 > T6 > T8.

3.10 Na/K and Na/Ca ratio

The Na/K and Na/Ca ratios were lower in the irrigated control of the tolerant variety as compared to sensitive variety (T4). Although, salicylic acid and putrescine treatments exhibited higher Na/K and Na/Ca ratio and also increased the plant growth promoting rhizobacteria modulated Na/K and Na/Ca ratio but the tendency of plant growth promoting rhizobacteria were to decrease these ratio over stressed control, response was higher in the tolerant variety. Combined treatment of P2 and P3 was more effective as compared to P2 and P3 in presence of salicylic acid and putrescine. T6 (consortium) had low Na/K ratio than all other treatments. Whereas, the highest Na/Ca ratio was also recorded in T1 (P1 inoculum) of sensitive variety. The combined treatment of P1, P2 and P3 (T5) had higher Na/Ca ratio than that of consortium along with salicylic acid and putrescine (T6) (Table 4).

Fig. 4
figure 4

Root fresh and dry weight/5-Plants of sensitive and tolerant wheat variety

Full size image

4 Discussion

Plant growth promoting rhizobacteria inhabit plant roots and have substantial effects on plant growth particularly under stress conditions (Khan and Bano 2016b; Glick et al. 2007). These plant growth promoting rhizobacteria stimulate plant growth by a range of mechanisms including production of phytohormones, suppression of pathogenss, phosphate solubilisation, and enhanced nutrient uptake (Ashrafuzzaman et al. 2009; Martinez-Viveros et al. 2010; Zahir et al. 2003).

Phosphorus comprises the major macronutrient after nitrogen; typically present in insoluble form and cannot be used by the plants (Peccia et al. 2013; Pradhan and Sukla 2006). The present investigation revealed that the plant growth promoting rhizobacteria Bacillus Cereus and Planomicrobium chinense had greater phosphorus solubilisation, antifungal and antibacterial activity and exhibited greater exopolysaccharides production. These factors are thought to enable plants to withstand under water deficit conditions in sandy soils. The production of greater amounts of sugar, protein and uronic acid in their exopolysaccharides may account for the enhancement of the fresh and dry matter production by the roots of wheat seedlings. Similar results were reported previously (Naseem and Bano 2014; Vimala and Lalithakumari 2003). An augmented mass of soil aggregate around roots of the inoculated wheat plants and a highly significant positive correlation (r = 0.866, p < 0.01) of water unsolvable soil saccharides with rhizo-sheath/root ratio showed the influence of the bacterial exopolysaccharides in combining soil around roots over other soil microbial secretions or plant mucilages (Bezzate et al. 2000; Watt et al. 1993). Robertson and Firestone (1992) recommended that the rise in exopolysaccharides production by Pseudomonas during dehydration is required to ensure defence of this strain in sandy soil. An exopolysaccharides matrix adjacent a bacterial colony may slow down the drying process, thereby increasing the time available for metabolic adjustment.

It is noteworthy that salicylic acid augmented the effects of plant growth promoting rhizobacteria particularly in the case of the drought sensitive variety. The relative water content was greater than in the irrigated control in T2 (P1 in association with salicylic acid and putrescine), =T4 (P2 + P3 in association with salicylic acid and putrescine) = T7 (only salicylic acid). Possibly the drought sensitive variety faces the problem of secondary stresses such as osmotic and oxidative stress and plants treated with salicylic acid are better able to resist these.

In the drought sensitive variety salicylic acid alone and in association with the plant growth promoting rhizobacteria (T6) were more effective, demonstrating the positive role of salicylic acid in maintenance of water budget and turgidity of plants and augmenting the plant growth promoting rhizobacteria. This was evident only in T7 (salicylic acid alone) in case of sensitive variety though T4, T2 = T6 were effective and were at par to irrigated control. The relative water content (RWC) and lower electrolyte ion leakage (EL) in plants exposed to drought is indicative of relative tolerance to water stress (Fisher 2000; Pereyra et al. 2006). The evidence suggests that bacterial inoculation of plants increases their relative water content and decreases their % electrolyte leakage as compared with uninoculated plants (Naveed et al. 2014; Sandhya et al. 2010). In addition, a mycorrhizal association along with plant growth promoting rhizobacteria can also benefit plants growing under drought conditions particularly in drought sensitive cultivars (Subramanian et al. 1997).

The relative water content (RWC) is correlated with root fresh weight in our study. Data revealed that the salicylic acid and putrescine alone (T7 and T8) or in combination with plant growth promoting rhizobacteria performed better in maintaining relative water content than that of stressed uninoculated control but were not as effective as in treatments T2 > T6 > T4 = T5 which were greater than or at par to irrigated control for both the varieties; indicating that the effects of plant growth promoting rhizobacteria was significantly augmented by salicylic acid and putrescine and that Planomicrobium chinense, (T1) appeared an effective plant growth promoting rhizobacteria bioinoculant in the tolerant variety, but not in the drought sensitive variety. The treatment with T1 (P1) alone was not as stimulatory as P1, P2 and P3 in association with salicylic acid and putrescine. Our findings concur with those of Sandhya et al. (2010). They demonstrated that bacterial inoculation of maize seeds with Pseudomonas spp. strains improved plant biomass, relative water content, leaf water potential, root adhering soil/root tissue ratio, aggregate stability and mean weight diameter and decreased leaf water loss.

With respect to moisture in the rhizosphere, T6 (P1, P2 and P3 in association with salicylic acid and putrescine) was the best treatment as it helped to retain maximum moisture in the rhizosphere soil and also resulted in the maximum root fresh weight that was even greater than that of irrigated control. The T5 > T6 > T7 > T8 treatments also have soil moisture higher than that of the irrigated control but the root fresh weight was higher than irrigated C (T10) only in T6 (P1, P2 and P3 in association with salicylic acid and putrescine) and T2 (P1 in association with salicylic acid and putrescine) for both the sensitive and tolerant varieties. Grover et al. (2011) reported that plant growth promoting rhizobacteria enhanced retention of soil moisture, and adaptation in agriculture crops exposed to abiotic stresses. Our results are also in line with the findings of Dobbelaere et al. (2001) who assessed the effect of inoculation by Azospirillum brasilenseon on the growth of spring wheat. They observed that inoculated plants had increased dry weight in both the root system and the upper plant parts.

Plant growth promoting rhizobacteria have been reported to secrete phytohormones in soil that modulate the endogenous levels of phytohormones like IAA and GA (Achard et al. 2009; Patten and Glick 2002). These stimulate cell division and cell elongation and hence increase root biomass, also stimulate nutrient and water uptake as observed in the present investigation (Farwell et al. 2006). An increase in phytohormone (Gibberellic acid, Indole-3-acetic acid and Abscisic acid) production in wheat plants inoculated by Bacillus cereus was also reported by Hassan and Bano (2015). Bacillus cereus was less effective than P. chinense and the consortium was more effective for sensitive variety. This may be attributed to their higher P-solubilizing potential and exopolysaccharides production by P. chinense (P1) and P. fluorescens (P3).

The results demonstrate that total NO3-N content and phosphorus contents was enhanced in plant growth promoting rhizobacteria inoculated plants. Salicylic acid in particular augmented this particularly with respect to phosphorus content. Salicylic acid occurs in plants in very minute quantities. It has been recognised as a vital signalling factor in plants (Alvarez 2000). Khan et al. (2010) found that foliar sprays of salicylic acid (100 ppm) resulted in higher uptake of nutrients from soil while putrescine sprays had inhibitory effect on phosphorus accumulation but enhanced the total NO3-N content. Furthermore the Na/K and Na/Ca ratio were increased. The observed increase in the ratio of Na/K or Na/Ca in plants inoculated with the plant growth promoting rhizobacteria consortium particularly in the sensitive variety is worth mentioning. Meloni et al. (2001) reported that osmotic adjustment of roots and leaves was predominantly controlled by Na/K and Na/Ca accumulation. Drought sensitivity had been reported in plants as being due to a lower Na/K ratio (Sairam et al. 2002). Increased K concentrations under stress conditions may help to reduce sodium uptake required for maintaining the necessary osmotic balance (Mahajan 2005).

In conclusion, it is inferred from the data obtained that salicylic acid in combination with plant growth promoting rhizobacteria in presence of putrescine promote root growth and improves the relative water content in comparison with control plants grown in the sandy soils. The exopolysaccharides produced by plant growth promoting rhizobacteria were found to enhance root growth and biomass. The integrated use of plant growth promoting rhizobacteria along with salicylic acid appears to be a promising and eco-friendly approach for increasing drought tolerance in wheat plants and also for the rehabilitation of unproductive desert lands.