Introduction

Ovarian cancer is the seventh most common cancer and eighth most common cause of mortality from cancer in women (GLOBOCAN 2012) [1]. The most important cause responsible for high mortality is late diagnosis of the malignancy. Only about 25 % of patients are diagnosed when the disease is still confined to the ovary [2]. At advanced stages (stages III and IV), when the disease has spread beyond the ovary, treatment becomes increasingly ineffective [3].

Most patients presenting with advanced ovarian cancer are not curable by surgery alone, so chemotherapy represents an essential component of treatment. Initial treatment involves platinum-containing drugs i.e. cisplatin and carboplatin either alone or in combination with the taxane, paclitaxel. However, despite an initial response rate of 65–80 % to first-line chemotherapy, most ovarian carcinomas relapse. Acquired resistance to further chemotherapy is generally responsible for treatment failure, resulting in an overall 5-year survival rate of only 10–30 % for late-stage ovarian cancer [3].

The ability of a cancer cell to respond to a chemotherapeutic agent is believed to be due, in part, to its apoptotic capacity. The regulation of apoptosis is through a balance between the pro and anti-apoptotic genes. A number of these have been identified including p53, c-myc and Bcl-2 and members of the IAP family. A tilt of this balance towards anti-apoptotic genes is an important factor in the pathogenesis of most cancers. Most of the anti-apoptotic genes, like Bcl-2, Bcl-xl and survivin, have been shown to be over expressed in ovarian cancer [4].

Overexpression of survivin, an inhibitor of apoptosis protein, in tumors has been linked to loss of wild-type p53 [4, 5]. Studies have demonstrated that changes in survivin mRNA level were indeed related to chemotherapy-induced apoptosis and have suggested that survivin may be considered as a biological indicator of the chemoresistance of ovarian cancer [6, 7]. Li et al. [8] first demonstrated that transfection of wild-type survivin efficiently protected murine NIH3T3 fibroblasts from apoptosis induced by the microtubule-stabilizing agent taxol. It has been shown that inhibition of survivin by shRNA [9, 10] or chemical agents [11] increases sensitivity to not only taxol but also cisplatin. Overall, the results obtained in the different studies indicate survivin to be a cellular factor potentially involved in the chemo-resistant phenotypes of ovarian tumor cells and suggest that approaches designed to inhibit survivin expression may lead to human tumor sensitisation to chemical and physical agents.

Primary cultures of ascitic cells are better suited for experimental studies than established cell lines because of genetic alterations that creep in while establishing the cell lines [12] and also ascitic cells can reflect the molecular profile of the primary tumor [4]. Though several methods for establishing primary culture of ovarian cancer cells isolated from patient’s ascites have been described in the literature, the one described by Dunfield et al. [12] is the simplest and results in cultures of predominantly epithelial ovarian cancer cells. Primary cultures of ovarian cancer can be used to determine sensitivity to an array of chemotherapeutic agents so that patients are not exposed to drugs to which they are not likely to respond. The molecular profile of the cancer cells can also allow us to develop designer therapies and thus take a step towards patient tailored therapy.

Materials and methods

Sample collection and processing

This study was carried out in the Department of Biochemistry, AIIMS, New Delhi for a duration of 3 years. Ascitic fluid along with corresponding tumor tissue was obtained from twenty primary, untreated epithelial ovarian cancer patients from the Department of Obstetrics and Gynecology, AIIMS, New Delhi, India. The ascitic fluid (0.5–1 l) was collected in sterile containers and immediately used for establishing primary cultures. Cells were isolated from an aliquot of 50 ml of ascitic fluid by density gradient centrifugation and were smeared on gelatin-coated slides for cytopathological examination [4]. The cytopathological classification of the ascitic cells was done according to WHO criteria and the staging using FIGO (International Federation of Gynecology and Obstetrics) guidelines. The corresponding tumor tissues were processed as described previously [4]. Only untreated epithelial ovarian cancer patients were included in the study. Those patients who received chemotherapy before surgery were excluded from the study.

Establishment of primary culture

Ascitic fluid was collected under sterile conditions during surgery. Establishment of culture was attempted only when grape-like clusters of cells, characteristic of ovarian cancer cells in peritoneal fluid, were seen under the microscope. MCDB 105 medium and Medium 199 taken in the ratio of 1:1 containing 10 % FCS and antibiotics (ciprofloxacin and amphotericin B) was used to culture the ovarian cancer cells. 15 ml of ascitic fluid was mixed with 15 ml of the above media and incubated in 75 mm2 flasks in a humidified atmosphere of 5 % CO2 at 37 °C.

After 4 days the media were removed and the cells washed with PBS. The clusters of ovarian cancer cells attached to the flask surface. The cells were maintained in the above-mentioned media till they grew to 80 % confluency. The cells were then trypsinized and cultured in 25 mm2 flasks. Logarithmically growing cells between passages 4 and 6 were used for all the experiments.

Treatment with survivin siRNA

Two oligonucleotides (38 mer), sense and antisense to target gene (survivin), encompassing complementary sequence to T7 promoter at the 3′ end, and a T7 promoter oligonucleotide were ordered from Microsynth. 1 nmol of each oligonucleotides (either sense or antisense) was annealed with T7 promoter oligonucleotide in 50 μl of TE Buffer (in different tubes) by heating at 95 °C; after 2 min, the heating block was switched off and allowed to cool down slowly to obtain dsDNA. Transcription was performed in 50 μl reaction mix: 1X T7 transcription buffer, 1 mM rNTPS, 0.1 U yeast pyrophosphatase (Sigma), 40U RnaseOUT (Life Technologies) and 100U T7 RNA Polymerase (Fermentas) containing 200 pmol of dsDNA as template. After incubation at 37 °C for 2 h, 1U RNase-free DNase was added at 37 °C for 15 min. Sense and antisense 21 nt RNAs generated in separate reactions were annealed by mixing both crude transcription reactions, heating at 95 °C for 5 min followed by 1 h at 37 °C to obtain T7 RNA polymerase synthesized small interfering dsRNA (T7 siRNA). The mixture (100 μl) was then adjusted to pH 5.2 by 0.2 M sodium acetate and precipitated with 70 % ethanol. After centrifugation, the pellet was washed once with 70 % ethanol, dried and resuspended in 50 μl water.

Transfection with siRNA was carried out with oligofectamine as per the manufacturer’s protocol for adherent cell lines.

RT-PCR for survivin

Total RNA was isolated using Tri-reagent from Sigma Chemicals, USA following manufacturer’s protocol. First-strand cDNA synthesis was carried out using 50 U Stratascript reverse transcriptase from Stratagene, USA, 50 μM random hexamer, 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 10 mm DTT, 3 mM MgCl2, 0.5 mM dNTPs, 20 U RNase inhibitor (Promega Corp, Madison, USA) and 2 μg of RNA, and the final volume made to 20 μl with DEPC treated water. The reaction was allowed to proceed at 42 °C for 1 h following which the reverse transcriptase was inactivated at 95 °C for 5 min. Relative expression of the genes was analyzed by PCR using specific primers for survivin.

For polymerase chain reaction (PCR), 2 μl of cDNA, 1XPCR buffer; 2.5 mM dNTP mix, 1.5 mM MgCl2 and 20 pmol each of forward and reverse primer and 1U Taq DNA polymerase (Roche Biochemicals, Germany) were taken in a final reaction volume of 25 μl and subjected to the following cycling conditions in a PTC100 (MJ Research) thermal cycler: initial denaturation at 95 °C for 5 min followed by (95 °C for 1 min, 60 °C for 1 min, 72 °C for 1.5 min) for 36 cycles; and final elongation was done at 72 °C for 10 min. G3PDH was used as the internal reference gene. The PCR products were then run in 1.5 % agarose gel and analyzed in a Gel documentation system.

The primers used in the PCR reaction were:

Survivin

  • Forward: 5′CAGATTTGAATCGCGGGACCC3′

  • Reverse: 5′CCAAGTCTGGCTCGTTCTCAG 3′

GAPDH

  • Forward 5′ CCAAGGTCATCCATGACAACTTTGGT 3′

  • Reverse 5′ TGTTGAAGTCAGAGGAGACCACCTG 3′

Treatment with paclitaxel

Cells were counted and plated at 4000 cells/well concentration in 96-well plates. After 24 h, cells were transfected with 15 nM survivin siRNA, using oligofectamine, following manufacturers’ protocol. After transfection, cells were incubated for 24 h and then the cells were treated with increasing dosage of paclitaxel dissolved in DMSO. The doses used were 0.1, 1, 5, and 25 μg/ml. Wells treated with control siRNA, mock transfection with oligofectamine alone and DMSO were evaluated as controls. After 24 h of treatment wells were evaluated by MTT assay for cell survival.

MTT (cell viability) assay

The growth inhibitory effect of drugs was assessed by the MTT assay. 104 cells were seeded in each well of the 96-well microtiter plates and treated as described. After 24 h of incubation, 100 μl of 5 mg/ml of MTT was added followed by incubation for 4 h at 37 °C. The formazan crystals thus formed were dissolved in DMSO and the absorbance measured at 570 nm using a micro titer plate reader.

Statistical analysis

The RT-PCR data were analyzed by unpaired t test. For MTT assay data two factors repeated measure ANOVA was used and for multiple comparison p values were adjusted as per Bonferroni correction.

Results

Primary cultures of ovarian cancer cells were established from ascitic fluid

Out of the 20 ascitic fluid samples, we were able to establish 10 primary cultures of ovarian cancer cells. Primary cultures could be established only from those ascitic fluid samples in which grape-like clusters of ovarian cancer cells were visualized under the inverted microscope. Hematoxylin and eosin stained smears also confirmed the presence of ovarian cancer cells in these ten samples. On histopathological examination, all the ten samples were diagnosed as serous papillary adenocarcinoma. On fourth day grape-like clusters were seen to attach to culture surface. The cells became confluent on 7th to 10th day (Fig. 1).

Fig. 1
figure 1

Establishment of primary cultures: (a) grape like clusters attaching to culture flask (b) culture becoming confluent on 7th to 10th day

Full size image

Down regulation of survivin using siRNA

Figure 2 shows a representative gel picture of RT-PCR analysis of survivin expression in control and siRNA treated cells. This was done to test the effectiveness of the siRNA transfection. Densitometry analysis showed a decreased band intensity in siRNA treated sample as compared to control cells. GAPDH was used as internal control. The ratio of band intensity of survivin and GAPDH was used to compare survivin expression between control and siRNA treated cells. On comparing the mean values of the ten samples (Fig. 2) we conclude that transfection of primary cultures with survivin siRNA resulted in fivefold decrease in expression of survivin gene which was statistically significant (p < 0.05).

Fig. 2
figure 2

Survivin expression by RT-PCR after siRNA transfection in ovarian cancer primary culture. G3PDH was used as an internal control (*p < 0.05)

Full size image

Down regulation of survivin increased apoptosis in ovarian cancer cells

MTT assay showed that cell survival was decreased by 24 % in primary cultures treated with siRNA alone even without paclitaxel (Fig. 3).

Fig. 3
figure 3

a Mean percentage survival at increasing doses of paclitaxel after pre-treatment with oligofectamine (mock), control siRNA and survivin siRNA. b Comparison between untreated cells, mock transfected, control siRNA transfected and cells pre-treated with survivin siRNA after exposure to increasing doses of paclitaxel. There was a negatively linear trend seen in all the groups and the percentage survival was significantly lower in the survivin siRNA group as compared to other groups

Full size image

Down regulating survivin expression increased sensitivity of cancer cells to paclitaxel

Ovarian cancer cells when treated with a gradient dose of paclitaxel showed only 20 % decrease in cell survival even when the dose was increased 250 fold (0.1–25 μg). However when cells were transfected with survivin siRNA and then treated with increasing dosage of paclitaxel there was significant decrease in cell survival. Mean survival was 24–30 % lesser in siRNA treated cells as compared to untreated cells at similar doses of paclitaxel (0.1–25 µg/ml) (Figs. 3, 4). Taking into consideration that survivin siRNA alone caused 24 % decrease in cell survival, the decrease in cell survival when treated with a combination of survivin and paclitaxel was more than the sum of decrease in cell survival caused by survivin and paclitaxel when considered individually at each increasing dose of paclitaxel.

Fig. 4
figure 4

Morphological changes in the primary ovarian cancer cell culture after survivin siRNA transfection and treatment with paclitaxel (1 µg/ml) from a representative experiment (a, b, c, d). e Apoptotic cells (1), apoptotic bodies (2) and increased vacoulation (3) in cells seen on treatment with siRNA and paclitaxel

Full size image

Statistical analysis revealed that there was no interaction between drug dosage groups and the untreated, mock transfected, control siRNA transfected and survivin siRNA transfected groups (p = 0.216). There was a statistically significant difference between survivin siRNA transfected group and the other three treatment groups (untreated, mock transfected and control siRNA transfected) (p < 0.001 after Bonferroni correction). There was no significant difference between untreated, mock transfected and control siRNA transfected group. There was a significant difference in mean cell survival with increasing dose of paclitaxel and in all the groups a negatively linear trend was found (p < 0.001).

Morphological changes observed on treatment of primary culture cells

Rounded and detached apoptotic cells were seen on treatment with survivin siRNA, paclitaxel and combination of both. Apoptotic bodies and increased vacoulation in some cells were observed at higher magnification (Fig. 4e).

Discussion

As ovarian cancer is diagnosed late, treatment with chemotherapeutic agents is an equally important modality alongside surgery. However, treating all patients empirically with carboplatin and paclitaxel will result in relapse or no remission in more than half of ovarian cancer cases [13]. Finally, these patients will need treatment with second line drugs. This increases the morbidity of patients as they are made to receive two regimens of chemotherapeutic agents. Therefore, there is an unmet need to develop patient tailored therapy in ovarian cancer patients. This study was carried out to establish primary culture of ovarian cancer patients which can be used to study sensitivity to chemotherapeutic agents.

Establishment of primary culture of ovarian cancer cells from ascites was done by the protocol described by Dunfield et al. [12]. We had success in establishing primary cultures from 50 % of the samples received. The density of grape-like clusters of ovarian cancer cells present in ascites was an important determinant in the success of establishing primary cultures. Incubating the ascitic fluid directly with media was better than isolating cells by density gradient and then adding media to the enriched cells.

No suitable marker is available to distinguish between mesothelial cells and ovarian cancer (OC) cells as they both are of mesenchymal origin [14]. The pathologic criteria used to distinguish mesothelial from OC cells included a combination of the following criteria, high nuclear to cytoplasmic ratio, presence of macro nucleoli, and cell size [12]. The primary cultures are often contaminated with fibroblasts. However, they can be removed by differential trypsinization. As the cancer cells are more strongly attached to the culture surface than fibroblasts, a brief exposure of the cells to trypsin will preferentially remove fibroblasts.

The molecular profile of the ovarian cancer cells present in the ascites reflects the molecular profile of the primary tumor [4]. Establishing primary cultures from ascites will provide an in vitro system to test the sensitivity of the cells to an array of chemotherapeutic agents and select the best regime for the patient. Molecular markers for chemoresistance can also be identified and their expression levels in cancer cells of individual patients can be measured. These data along with chemosensitivity results will help us to design patient tailored therapy for each patient.

Survivin, an inhibitor of apoptosis protein, has been shown to antagonize taxols as they have opposing actions on the cell cycle and Smac/Diablo group of proteins [15, 16]. Several studies have shown that down regulation of survivin increases sensitivity of cancer cells to taxols [9, 10, 17]. In our study, the cancer cells over expressed survivin and down regulating survivin expression using siRNA increased sensitivity of cancer cells to taxols in all the primary cultures established. As evident from Fig. 3b, in untreated cells even on increasing the dose of paclitaxel to 250 times, there was only moderate decrease in cell survival. This shows that the primary cultures were resistant to taxol. However, on pretreatment with survivin siRNA the response to increasing dose of paclitaxel improved considerably. Our findings are consistent with previous studies which showed that most ovarian cancers over express survivin [4, 18]. As it is well established that survivin antagonizes taxol activity, the rationale of using taxols empirically in all ovarian cancer patients can be questioned. However, transient transfection using oligofectamine shows varying efficiency which is a limitation of this study. It was also not possible to identify cells which were transfected with survivin siRNA and still not affected by paclitaxel treatment.

This study highlights the fact that establishing primary cultures from ascitic cells may help us to select the best chemotherapeutic agent for ovarian cancer patients. Our study also indicates that supplementing taxols with survivin inhibitors may prove beneficial in the treatment of ovarian cancer patients.