Introduction

Citrus fruits are the most economically important fruit crop in the world with a unique anatomical fruit structure. They are consumed as fresh fruit or juice and are also used in salads and desserts. The by-products of fruit processing are widely used as dietary fiber, animal feed, and for the extraction of essential oils (Braddock 1995). As a type of berry (hesperidium), citrus fruits are composed of two major sections, peel and pulp. The peel itself includes flavedo and albedo, while the pulp consists of several segments filled with juice sacs (Reuther et al. 1968). In addition, citrus fruit is a non-climacteric fruit. Its fruit development involves diverse metabolisms including many physicochemical modifications of cell wall structures (Giovannoni 2001). The modifications of cell wall structure as a factor in the mastication properties of fruit pulp are important determinants of textural qualities, such as waxiness, crumbliness, stickiness, graininess, and hardness. The fruit mastication trait is one of the factors affecting consumers' perception of fruit quality (Waldron et al. 2003). Inferior mastication trait in citrus fruits is characterized by a coarse feeling in the mouth while eating with rough fiber residue after patiently chewing the fruit segments before swallowing. Inferior mastication quality of citrus fruit has been depicted as non-melting while the term “melting” has been used to indicate superior mastication trait (Deng 2008).

Fruit mastication quality is determined by the mechanical properties of the pulp, which is a function of the relative proportions of cellulose, hemicellulose, and pectin in the primary cell wall of parenchyma cells (Waldron et al. 2003). Pectins are also considered as an important component contributing to the texture and quality of fruits (Van Buggenhout et al. 2009). Modifications of the pectin polysaccharides of fleshy fruits are associated with partial or complete solubilization and depolymerization of the protopectin (Sakai et al. 1993). These changes in turn affect the final texture of the ripe fruit and determine its acceptability by the consumer (Goulao and Oliveira 2008).

Polygalacturonase (PG) is a cell-wall bound enzyme with a glycoside hydrolase 28 domain. It plays an important role in the catabolism of pectins by hydrolyzing the α-1,4-glycosidic bonds between the galacturonic acid residues in galacturonans (Markovic and Janecek 2001). It is clear that PGs are encoded by relatively large gene families in plants and exhibit divergent roles in plants (Markovic and Janecek 2001; Park et al. 2008). They have been found to play a role in numerous plant developmental processes such as fruit ripening or softening (Villarreal et al. 2008; Wang et al. 2000), organ abscission (Gonzalez-Carranza et al. 2002; Jiang et al. 2008), pod and anther dehiscence (Gorguet et al. 2009; Ogawa et al. 2009), and pollen grain maturation or pollen tube growth (Zhang et al. 2008). PGs have also been reported to be involved in cell expansion (Ham et al. 2006) and embryo and seedling growth (Sitrit et al. 1999). To date, beside their study in model plants (Arabidopsis, tomato, and rice), PG genes have been identified in many fruit crops, such as kiwifruit (Wang et al. 2000), avocado (Kutsunai et al. 1993), peach (Lester et al. 1994), apple (Atkinson et al. 1998), strawberry (Redondo-Nevado et al. 2001), grape (Nunan et al. 2001), pear (Hiwasa et al. 2003), banana (Asif and Nath 2005), and plum (Iglesias-Fernández et al. 2007). Unfortunately, knowledge of PG gene activity in citrus fruits is still scanty.

Using cDNA–amplified fragment length polymorphism, several transcript-derived fragments (TDFs) were isolated from ripe navel oranges (Citrus sinensis Osbeck) in which TDF fjfw23 (access no. EH117794) showed relatively high identity with other PG proteins (Liu et al. 2009b). Based on the TDF, a full-length citrus PG gene was cloned using rapid amplification of cDNA ends (RACE) technique. To gain insight into its probable role in citrus fruit ripening, gene expression profiles during fruit development in different cultivars and under calcium (Ca) and boron (B) treatment were investigated. Results indicate that its expression is associated with enhancement of fruit pulp melting qualities and fruit cell expansion. The response to treatment by Ca and B was also studied.

Plant Materials and Methods

Plant Materials and Ca or B Treatment

Fruits of “Fengjie 72-1” (FJ72-1, C. sinensis cv. Fengjie 72-1) and “Fengjiewancheng” (FJWC, C. sinensis cv. Fengjiewancheng) from Fengjie County (Chongqing, China), “Nanfengmiju” (NM, Citrus reticulate cv. Kinokuni) and Miguang (MG, C. reticulate cv. Miguang) from Nanfeng County (Jiangxi Province, China), “Cara Cara” (C. sinensis cv. Cara Cara) from Zigui County (Hubei Province, China), were used in the present study. “FJWC” is a bud mutant derived from “FJ72-1” (Liu et al. 2009b). “MG” and “NM” are two local distinct cultivars. Based on the evaluation of a panel of expert dealers and consumers sponsored by the local citrus industry bureau, the mastication qualities of “FJWC” were judged to be inferior to “FJ72-1” and “NM” inferior to “MG”. For sampling convenience, “Cara Cara” was selected here for further investigations of gene expression. All the cultivars were grafted on trifoliate orange (Poncirus trifoliata Raf.) under standard management. Three trees of each cultivar exhibiting similar growth vigor were selected for fruit sampling. Sampling times were 170, 205, and 240 days after anthesis (DAA) for “FJ72-1” and “FJWC”, 135, 170, and 195 DAA for “NM” and “MG”, and 85, 115, 135, 170, 210, and 235 DAA for “Cara Cara”. For each sampling, 12 navel oranges or 20 tangerines were randomly harvested from the outside crown. Peel and pulp of “Cara Cara” were separated immediately after harvest. Half of them were ground into fine powder in liquid nitrogen and stored at −80°C until use. Others were cut into pieces for peel or were pressed for pulp and dried in an oven at 80°C to a stable weight. For the other four cultivars, only pulps were retained for pulverization in liquid nitrogen.

For Ca or B treatment, three trees of “Cara Cara” with similar growth vigor were selected. A solution of Ca (3 g/kg) or B (3 g/kg) and water (control) was sprayed evenly on each fruit at 1800 h on 5, 85, 115, 135, 170, and 210 DAA. Each solution was sprayed on one tree. At 235 DAA, ten fruits of similar size were harvested for each treatment, then washed, and peeled. Part of the pulp was frozen in liquid nitrogen, ground to fine powder, and stored at −80°C until use. The rest was pressed and the mash dried in an oven at 80°C to a stable weight.

Isolation of Full-Length CitPG cDNA

Total RNAs of fruit peel and pulp of “FJ72-1” which had been isolated at different time points in our previous study (Liu et al. 2009b) were used. An RNA pool was created from an equal mixture of peel and pulp. RNA (20 μg for each) underwent mRNA purification using PolyATtract® mRNA Isolation Systems III Kit (Promega, USA). RACE templates and PCR amplification were performed, respectively, according to the RLM-RACE manual (FirstChoice® RLMRACE, Ambion, USA). The cloning course of full-length CitPG was performed as described previously (Liu et al. 2009a), with gene-specific primers (L1: GACATGCTCCAACGGCTATT, L2: CTAATTGTCTACGGGTTGTG, and R1: TGCAGTCATCTCCTGTTCCA, R2: AGGACTTTCAGCAGGTGCAA) and confirming primers (PGL: GAACATGAAGCAACTTAAGT, PGR: CTCAGAGCAATTTACTTTTG). RACE products, subsequent full-length clones were cloned into a pMD18-T vector (TaKaRa, Dalian, China) and sequenced at least two replicates.

Sequence Analysis and Phylogeny

A homology search of CitPG-deduced protein was conducted by using BLASTP program (Altschul et al. 2005). The deduced protein sequences were aligned with three deduced PG proteins isolated from apple (P48978), kiwifruit (P35336), and strawberry (ABE77145) using the Clustal W version 1.8 software (Thompson et al. 1994). The phylogenetic tree was constructed with MEGA4 program (Tamura et al. 2007) using the neighbor-joining (NJ) method with 1,000 bootstrap repetitions. Nineteen sequences from fruit crops were used for phylogenetic analysis. Accession numbers are P48978 for pGDPG from Malus × domestica, P35336 for kiwi from Actinidia deliciosa, ABE77145 for FaPG1 from Fragaria × ananassa, AAC26511 for MPG2 from Cucumis melo, AAC26510 for MPG1 from C. melo, P48979 for PRF5 from Prunus persica, Q43063 for Peach-gen from from P. persica, Q40135 for TAPG1 from Solanum lycopersicum, Q96487 for TAPG2 from S. lycopersicum, O22310 for TAPG3 from S. lycopersicum, Q96488 for TAPG4 from S. lycopersicum, O22313 for TAPG5 from S. lycopersicum, Q02096 for Avocado2 from Persea americana, AAA32914 for pAVOpg from P. americana, AAK81876 for VvPG1 from Vitis vinifera, ABW76153 for VvPG2 from V. vinifera, BAC22688 for PCPG1 from Pyrus communis, ABD33834 for Pd-PG1 from Prunus domestica, and AAT74603 for MAPG3 from Musa acuminata.

Real-Time PCR Quantification of CitPG

Total RNA was isolated from fruit pulp and/or fruit peel according to the protocol described by Liu et al. (2009b). After DNase (Promega) treatment, the RNA was used to synthesize first strand cDNA by RevertAidTM First Strand cDNA Synthesis Kit (Fermentas). Primer pairs for the CitPG (Pl: CACTAATCCGAATCAGAAACTTTGC and Pr: TGATTTCCCCAAGCTTCCAA) were designed with a product size of 67 bp based on the CitPG sequence with Primer Express software (Applied Biosystems, Foster City, CA, USA). Before quantitative analysis, the amplification products with the two primers from fruits of cultivars mentioned above were sequenced, and no nucleotide difference was found between regions of the two primers among all cultivars studied. Real-time PCR was performed using the ABI7500 Real Time System (PE Applied Biosystems, Foster City, CA, USA). Actin (Al: CCAAGCAGCATGAAGATCAA and Ar: ATCTGCTGGAAGGTGCTGAG) was amplified along with the target gene as an internal control to normalize the expression level of the target gene. The Livak method was employed to calculate the CitPG expression ratio. Four replicates from each sample were analyzed. Samples were incubated initially at 50°C for 2 min and at 95°C for 10 min, and then subjected to 40 cycles of 15 s at 95°C and 1 min at 60°C.

Cellulose, Hemicellulose, Protopectin, Calcium, and Boron Determination

Cellulose and hemicellulose were determined by the method developed by Wang and Xu (1987). Dried samples were steamed with 3% SDS at 100°C for 1 h and filtered. The residue was boiled at 100°C for 50 min with 2 M HCl after washing with acetone and distilled water. The residues were washed with distilled water until the pH value stabilized at 6.5 to 7.0. The diluted filtrate can later be used for hemicellulose measurement. The remaining residue was washed twice with acetone and hydrolysis was performed with 72% H2SO4 at 35°C for 1 h. Four volumes of water were added and the solution was boiled at 100°C for 1 h. The diluted filtrate was used for cellulose analysis. Water-soluble pectin (WSP) and protopectin were determined by colorimetry of Carbazole–Vitriol (Marin-Rodriguez et al. 2002). Dried samples were fixed with 95% ethanol, boiled at 70°C for 1 h, and filtered. The alcohol-insoluble residue was washed with 95% ethanol and air dried. The residue was hydrolyzed in distilled water for 1 h at 50°C and filtered, and the filtrate was analyzed for WSP. The precipitate was hydrolyzed in 0.5 mol/L H2SO4 at 100°C for 1 h for protopectin analysis. Total pectin content (TP) is the sum of WSP and protopectin. Ca concentration was determined by flame atomic absorption spectrometry as described by Chaiprasart et al. (2006). B concentration was measured with the curcumin spectrophotometric method (Lieten 2002).

Statistical Analysis

All data include results of at least three replicates and were analyzed by ANOVA using SPSS 13.0. The means were compared by the Duncan's test or Tukey test at a significance level of 0.05 or 0.01.

Results

Isolation and Molecular Characteristic of CitPG

In this study, CitPG, a citrus PG, was isolated from the fruit of C. sinensis cv. Fengjie72-1 using RACE technique based on the sequence of EH117794. Two rounds of PCR with specific primer sets resulted in a band of 702 bp for 5′ RACE and 1,062 bp for 3′ RACE. The full-length cDNA of CitPG was obtained by aligning and assembling the 3′ and 5′ RACE sequences. To confirm its authenticity, we designed primer PGL at the 5′ end of 5′ RACE sequence (including the start codon ATG) and primer PGR at the 3′ end of 3′ RACE sequence (after the stop codon TGA). A specific band using this primer pair was amplified. Sequencing results showed that the amplified fragment (cPG) was highly similar to the assembled sequence in the range between PGL and PGR. This confirmed that we succeeded in cloning a full-length cDNA of CitPG with a length of 1,686 bp after deletion of the RACE adaptor primer sequence. Using the open reading frame (ORF) finder, we determined that CitPG has a maximal ORF of 1,338 bp (including stop codon TGA) encoding a 445-amino acid protein. Its estimated molecular mass is 48.09 kDa, and the calculated isoelectric point is 8.41. The GenBank accession no. of CitPG is EF185420.

Homology search by BLASTP showed that the predicted amino acid sequence of CitPG was highly homologous to other plant PG proteins (data not shown). The predicted amino acid sequence of CitPG contains the conserved domain of the Glyco_hydro_28 superfamily which is shared by glycoside hydrolases (Markovic and Janecek 2001) and a conserved polygalacturonase domain (PGU1: COG5434). Four conserved domains (I to IV) proposed to be involved in PG activity in all eukaryotic and prokaryotic PG proteins (Park et al. 2008; Redondo-Nevado et al. 2001; Tebbutt et al. 1994) were present in the deduced sequence of CitPG (Fig. 1). Phylogenetic analysis indicated that 20 deduced PG proteins were distributed among three characteristic clades (A, B, and C) of PGs (Hadfield and Bennett 1998) and the candidate-deduced isolate (CitPG) belonged to clade B (Fig. 2). Clade B also includes PGs from apple (pGDPG), pear (PCPG1), peach (Peach-gen), kiwifruit (kiwi), grape (VvPG1 and VvPG2), avocado (Avocado2 and pAVOpg), and banana (MAPG3). The peach fruit-specific PG (PFR5), plum flower-specific PG (Pd-PG1), tomato abscission zone-specific PGs (TAPG1 to 5), and two melon PG (MPG1 and MPG2) belonged to clade A. Only FaPG1 belonged to clade C.

Fig. 1
figure 1

Amino acid sequence comparison of the predicted CitPG (ABM67700) and three other fruit PG-deduced proteins. The accession numbers are P48978 for apple, P35336 for kiwifruit, and ABE77145 for strawberry. Consensus amino acid sequences were shown in black background. Conserved domains named as I to IV were underlined

Full size image
Fig. 2
figure 2

Phylogenetic tree for CitPG (ABM67700) and other PGs isolated from fruit crops. The consensus tree was obtained by the NJ method in MEGA4. A bootstrap analysis of 1,000 replicates was performed, and only percentage of bootstrap values over 50% was indicated in the tree. Accession numbers are P48978 for pGDPG, P35336 for kiwi, ABE77145 for FaPG1, AAC26511 for MPG2, AAC26510 for MPG1, P48979 for PRF5, Q40135 for TAPG1, Q96487 for TAPG2, O22310 for TAPG3, Q96488 for TAPG4, O22313 for TAPG5, Q43063 for Peach-gen, Q02096 for Avocado2, AAA32914 for pAVOpg, AAK81876 for VvPG1, ABW76153 for VvPG2, BAC22688 for PCPG1, ABD33834 for Pd-PG1, and AAT74603 for MAPG3. The candidate protein (CitPG) was underlined and belongs to clade B

Full size image

CitPG Expression Profiles of Cultivars with Different Pulp Mastication Characteristics

Isolation of CitPG was carried out after the discovery that TDF fjfw23 (access no. EH117794) showed a different expression between “FJ72-1” and “FJWC”. Because “FJWC” is much coarser than “FJ72-1” when masticated, levels of cellulose, hemicelluloses, and pectins were determined in fruit pulp at harvest time. Results showed that the WSP content in “FJWC” was significantly lower than in “FJ72-1”, while its cellulose content and protopectin contents were remarkably higher (Table 1). To investigate the correlation between CitPG and the citrus mastication trait, the CitPG expression profile in the pulp tissue of the two cultivars was determined during fruit ripening (from 170 to 240 DAA), and two tangerine varieties, “NM” and “MG” which differ in their mastication traits, were compared in the CitPG expression level either. Results indicated that the mRNA level of CitPG in the pulp of “FJ72-1” was significantly increased during fruit ripening, while in “FJWC”, it increased during the first three ripening stages and then decreased after 205 DAA. At 240 DAA, CitPG transcript level was significantly lower than in that of “FJ72-1” (Fig. 3). On the other hand, the levels of TP and protopectin in “NM”, which is characterized by an inferior mastication trait, were found to be remarkably higher than those in “MG” when compared at harvest time (Table 1). CitPG expression showed a similar profile in the pulp of both tangerine varieties during fruit ripening, continuously rising as fruit ripening progressed. However, the expression level of CitPG in “NM” was significantly lower than that in “MG” at each sampling point (Fig. 3).

Table 1 Contents of cellulose, hemicellulose, total pectins, protopectin, and water-soluble pectin in the fruit pulp of two cultivar pairs (I and II) at harvest time
Full size table
Fig. 3
figure 3

Transcript analysis of CitPG in the pulp of “FJ72-1” and “FJWC”, “NM”, and “MG” during fruit ripening. Values represent the mean of at least three replicates ±SD. Different letters among bars within a histogram indicate significant difference at P < 0.05 by Duncan's test

Full size image

Effect of Calcium and Boron on Protopectin Content and CitPG Expression in the Pulp of “Cara Cara”

Foliar applications of Ca or B on “Cara Cara” were carried out during fruit development. CitPG transcript level and protopectin content in the pulp of “Cara Cara” were analyzed and accompanied by the determination of Ca and B contents at the harvest time (235 DAA). It was found that Ca or B content in the fruit pulp tissue increased in their respective treatment groups (Fig. 4a, b). Interestingly, both treatments reduced CitPG transcript level and increased protopectin content in fruit pulp at harvest time (Fig. 4c, d).

Fig. 4
figure 4

Effects of boron and calcium treatment during fruit development on their contents (A and B), CitPG relative mRNA level (C), and protopectin content (D) in the pulp of “Cara Cara” at harvest time. Different letters among bars within a histogram indicate significant difference at P < 0.05 by Duncan's test. Values are means of at least three replicates ±SD

Full size image

Expression Profiles of CitPG in “Cara Cara” During Fruit Development

CitPG expression profiles and protopectin content were further investigated in the fruit of “Cara Cara” during fruit development. In the fruit pulp, CitPG mRNA level increased from 85 to 135 DAA, then decreased and remained at a relatively stable level during the fruit ripening stage (Fig. 5a). In the fruit peel, CitPG transcript level increased and peaked at 115 DAA then decreased to its lowest level at 135 DAA. As fruit ripening continued, CitPG level in the fruit peel increased again and reached a sub-peak level at 210 DAA (Fig. 5b). Though CitPG gene expression profiles differed in the pulp and peel of the Cara Cara, changes in the level of propectin were similar in the two tissues examined, i.e., there was a steady decrease as fruit development progressed (Fig. 5c, d).

Fig. 5
figure 5

Changes of CitPG relative mRNA level (A and B) and protopectin content (C and D) in the fruit pulp and peel of “Cara Cara” during fruit development. Values are means of at least three replicates ±SD. Different letters among bars within a histogram indicate significant difference at P < 0.05 by Duncan's test

Full size image

Discussion

Plant PGs are encoded by relatively large gene families in plants (Markovic and Janecek 2001; Torki et al. 2000) and play important roles in numerous developmental processes (Hadfield and Bennett 1998). To date, although many PG genes have been identified in popular fruit crops cultivated around the world, such as apple (Atkinson et al. 1998) and pear (Hiwasa et al. 2003), there is little knowledge concerning the PG genes of citrus fruits. It is commonly accepted that many physicochemical modifications of cell wall structures involved in fruit development are associated with extensive solubilization and degradation of cell wall pectins, which is regulated at least partially by the expression of PG genes (Payasi et al. 2009). Thus, study of the PG genes of citrus fruits will help gain insight into diverse metabolic pathways involved in plant development. In this study, citrus PGs (CitPG) was isolated from the fruit of C. sinensis cv Fengjie72-1 using RACE technique. Sequence analysis indicated that CitPG had four conserved domains typical of the PG gene family (Fig. 1), indicating that our isolate indeed belonged to the citrus PG family.

Depending on its action on pectin, that is, whether the enzyme attacks one of the termini of pectin or somewhere within the polymer chain, plant PGs have been classified into endo-polygalacturonases (EC 3.2.1.15) and exo-polygalacturonases (EC 3.2.1.67). Endo-polygalacturonase catalyzes random hydrolytic cleavage of α-1, 4-glycosidic bonds in pectate while exo-polygalacturonase catalyzes the hydrolytic cleavage of one galacturonic acid residue from the non-reducing end of galacturonan. On the other hand, though plant PGs are relatively variable, they could be clustered into three major clades (clades A, B, and C) according to amino acid sequence similarity and the absence of pro-sequence (Hadfield and Bennett 1998). In our study, a phylogenetic tree of 20 deduced PG proteins was constructed. We found that the phylogenetic relationships of the remaining 19 deduced PG proteins was in agreement with previous studies (Asif and Nath 2005; Hiwasa et al. 2003; Iglesias-Fernández et al. 2007; Villarreal et al. 2008). It was determined that CitPG belonged to clade B (Fig. 2). There is general agreement that most PGs of clade B are endo-polygalacturonases and are expressed in fruits or dehiscence zones (Hadfield and Bennett 1998). This suggests that CitPG encodes an endo-polygalacturonase.

The fruit mastication trait is a sensory perception and it is difficult to define a suitable parameter by which to describe such a characteristic. This is particularly true in citrus fruits. However, this difficulty must be addressed because this trait has a direct influence on consumer behavior (Sun and Collins 2004). Until now, few studies have focused on the role of PG genes in the fruit mastication trait. For example in peaches, the melting flesh mutation was found to be linked with PG (Lester et al. 1994). Callahan et al. (2004) found that the mRNA level of endo-PG PRF5-related PG in eight non-melting flesh cultivars was greatly reduced or undetectable during fruit softening, compared with the melting cultivars. To clarify the relationship of CitPG with the citrus mastication trait, two pairs of cultivars (“FJ72-1” and “FJWC”, “MG” and “NM”) with different mastication traits were selected. Analysis of some physiological parameters showed that cultivars (“NM” and “FJWC”) which exhibit an inferior mastication trait have a high level of protopectin at harvest time (Table 1). CitPG expression profiles during fruit ripening showed that the CitPG transcript level in the pulp of “FJWC” was reduced at the late ripening stage and was significantly lower in “NM” during fruit ripening (Fig. 4), implying CitPG plays a role in the formation of the citrus pulp mastication trait. In addition, it is commonly accepted that Ca or B interact with pectin and form cross-linked polymers which make cell wall constituents firmer, thus preventing physiological disorders after harvest (Blevins and Lukaszewski 1998; Maurice et al. 1984). In our study, CitPG mRNA level was found to be reduced significantly along with a significant increase of protopectin content at harvest time after foliar applications of Ca or B during fruit development (Fig. 4). Though we cannot provide an explanation for the reduction in the CitPG transcription level resulting from Ca and B treatment, the treated fruit exhibited a decline in its mastication trait. This provides a further clue that CitPG has a role in the formation of the pulp mastication trait.

In addition, CitPG may play a role in cell enlargement of citrus fruit. Citrus fruit is formed during the late development of the ovary and passes through three phases: cell division (phase I), rapid cell enlargement (phase II), and fruit maturation (phase III) (Reuther et al. 1968). Pectins are the common components of the primary cell wall and middle lamella and contribute to the fruit texture, while protopectin is an insoluble high-molecular-weight pectin complex, and together with cellulose and hemicelluloses, plays a role in forming the backbone of the cell wall (Ovodov 2009; Prasanna et al. 2007). During the phase of rapid growth, the fruit experiences a huge increase in size through a process of cell enlargement in which the rapid growth of the fruit peel is somewhat earlier than that of the pulp (Reuther et al. 1968). This enlargement requires continual loosening of the cell wall structure, through degradation and solubilization of the protopectin. As for the “Cara Cara” navel orange in Zigui County, its phase I lasts about 1.5 months or so; phase II is about 4.5 months, and the last phase is 2 months or so. Because it is difficult to separate fruit peel and pulp tissues during phase I, we investigated CitPG expression profiles in the fruit of “Cara Cara” only in phases II and III of development, accompanied by the determination of the respective protopectin content. CitPG spatial and temporal analysis indicated that its mRNA levels during rapid cell enlargement were reversely correlated with protopectin concentrations in the pulp from 85 to 135 DAA and in the peel from 85 to 115 DAA, respectively (Fig. 5). This implies that CitPG is involved in dissolving protopectin during the process of cell enlargement in the development of citrus fruits.