Introduction

Asiatic citrus canker caused by Xanthomonas axonopodis pv. citri (syn. X. citri subsp. citri) with a broad host range among members of the Rutaceae is one of the most serious problems in citrus production worldwide (Stall and Civerolo 1991). X. axonopodis pv. citri induces erumpent, callus-like lesions with water-soaked margin in citrus plants.

New groups of X. axonopodis pv. citri strains A* and Aw isolated from Mexican or key lime trees in southwest Asia, central Asia and Florida exhibit a narrow host range but shown to be genetically related to X. axonopodis pv. citri (Verniere et al. 1998; Sun et al. 2004; Bui Thi Ngoc et al. 2008, 2007). These strains elicited typical canker lesions on Mexican lime but induced flat water-soaked lesions or hypersensitive reaction on grapefruit (Rybak et al. 2009). Two groups of X. axonopodis pv. citri strains distinct in aggressiveness on pummelo cultivars have been found among Japanese strains of X. axonopodis pv. citri (Shiotani et al. 2000). There are three novel atypical symptom-producing variants of X. axonopodis pv. citri were discovered in Taiwan, and designated as Xac- Af, -Ar and -Ap type strains (Lin et al. 2005, 2008). These three type strains induced atypical symptom on citrus leaves. Xac-Af type strains induce flat necrotic lesion with water-soaked margin and light chlorotic halo on leaves of grapefruit and Liucheng (C. sinensis), while typical canker lesions on Mexican lime. Xac-Ar type strains induce restricted and raised corky lesions with no water-soaked margin and light chlorotic halo on these leaves of Citrus species. Xac-Ap type strains induce large flat necrotic lesion with water-soaked margin and light chlorotic halo on these leaves of Citrus species. The mechanisms for the Xac-Aw, -Af, and -Ar type strains inducing symptomatic variation in Citrus species, and the X. axonopodis pv. citri strains from Japanese distinct in aggressiveness on pummelo were well studied (Rybak et al. 2009; Lin et al. 2011, 2010; Shiotani et al. 2007). However, the molecular basis for avirulence of the Xac- A* type strains on grapefruit or Xac-Ap type strains inducing large flat necrotic lesion with water-soaked margin lesions on citrus leaves is still unclear.

The avrBs3/pthA (avirulence and pathogenicity) gene family, widely distributes in phytopathogenic Xanthomonas species, was involved in disease symptom expression and host defence response (Fujikawa et al. 2006; Swarup et al. 1991, 1992; Leach and White 1996). Many members of this gene family are essential for pathogenicity of Xanthomonas species. For example, pathogenicity gene pthA is necessary for X. axonopodis pv. citri to cause citrus canker disease (Swarup et al. 1991). This pthA gene shares unique structural features, composed of a central region of multiple, nearly identical repeats of 34 amino acids, a leucine zipper, three nuclear localization signals (NLSs), and an acid transcriptional activation domain (AAD) in the C terminus (Ponciano et al. 2003). The direct tandem 34-aa repeats confer host selectivity and are critical to the determination of pathogenicity (Swarup et al. 1992; AI-Saadi et al. 2007). Multiple pthA homologs are always present in all strains of X. axonopodis pv. citri also including A*, Aw and Af (Kanamori and Tsuyumu 1998; AI-Saadi et al. 2007; Lin et al. 2011). Only one pthA homolog carrying 17.5 nearly identical direct tandem repeats has the hallmark virulence function of canker formation, while functions of the other homologs were negligible or not measurable (AI-Saadi et al. 2007).

In this study, we utilized transposon mutagenesis for a strain of Xac-Ap type that induces large flat necrotic with water-soaked margin lesions in leaves of grapefruit and Mexican lime in order to characterize the gene involved in the symptomatic variation. The result of this experiment identified a new member of the Xanthomonas avrBs3/pthA gene family from Xac-Ap type strain XL38 that can enhance virulence without inducing canker symptom.

Materials and methods

Bacterial strains, plasmids, and culture media

The information of bacterial strains and plasmids for this study was listed as Table 1. Escherichia coli DH5α and its derivatives were grown in Luria-Bertani (LB) broth (Sambrook et al. 1989) or LB agar plate at 37 °C. The strains of X. axonopodis pv. citri were cultured on Yeast Extract Bactopeptone Dextrose (YPD) medium (Verniere et al. 1991) at 30 °C. Antibiotic selection was carried out using 50 μg ml-1 of kanamycin, 100 μg ml-1 of ampicillin, 20–50 μg ml-1 of gentamicin.

Table 1 List of bacterial strains and plasmids used in this study
Full size table

Transposon mutagenesis and pathogenicity screening

Plasmid pSUP2021 containing Tn5 was introduced into strain XL38 of Xac-Ap type (Table 1) by electroporation as described previously (Shiotani et al. 2007). Kanamycin-resistant mutants were picked from YPD agar plate with 26-gauge needle. Screening for pathogenicity and virulence was performed by inoculating mature attached leaves of grapefruit (C. paradisi) and Mexican lime (C. aurantifolia) with needle pricks. The inoculated plants were grown in a growth chamber with 65–90 % humidity and 12-h light at 30 °C and 12-h dark at 25 °C. The pathogenicity and virulence of each mutant were determined visually or with a dissecting microscope 30 days after inoculation. Putative clones that altered the symptom on citrus leaves were doubly confirmed by performing for the second test on the leaves of grapefruit and Mexican lime, and each mutant was evaluated by measuring the diameter of the lesions. To prepare inoculums, X. axonopodis strains were grown overnight in YPD broth, harvested by centrifugation 6,000 × g for 5 min at 4 °C (SCR20BA, Hitachi, Japan) and re-suspended in sterile distilled water to a concentration of approximately 108 colony-forming units (CFU)/ml. For needle-prick inoculation, six wounds within a 1 cm2 area were made on citrus leaves with a standard 26-gauge needle. An aliquot (20 μl) of the bacterial suspension was dropped onto each wound, and the drops were wiped off with sterile cotton 2 min after inoculation.

Analysis of Tn5 insertion site by inverse-PCR

To identify the insertion site in mutant T38 (Table 1), 2 μg of genomic DNA of T38 was digested with restriction enzyme SalI overnight at 37 °C. The digested DNA was separated using agarose gel and purified by Viogene Gel-MTM Gel Extraction system (Viogene Corporation, Taiwan) and allowed to self-ligate in the presence of T4 DNA ligase in a 10 μl mixture for 4 h at 16 °C. The ligation mixture was electroporated into E.coli DH5α cells. The ligated DNA sequence was used as template for an inverse-PCR reaction using three outward-facing primers, Tn5IS (5′ GCAGTACGGCGAGGATCACC 3′), Tn5-L (5′ CTCATGCTGGAGTTCTTC 3′) and Tn5-R (5′ GCCGAAGTCGAGCACGTT 3′), which were designed based on the transposon sequence.

PCR analysis was performed in a 50 μl mixtures containing 10 ng template DNA, 1× Taq buffer, each primer at a concentration of 5 μM, each deoxynucleoside triphosphate at a concentration of 2.5 mM, 1U of Taq Plus DNA polymerase (BioBasic Inc., Canada) with proof-reading function, MgCl2 25 mM and DMSO 3 μl. The amplification condition consisted of 94 °C for 1 min, 62 °C for 1 min, and 72 °C for 5 min for 35 cycles with an initial step of 94 °C for 10 min and a final step of 72 °C for 10 min. The PCR products were separated by electrophoresis in 1.5 % agarose gel, stained with ethidium bromide and visualized under a UV light. The PCR products were purified by Viogene Gel-MTM Gel Extraction system and cloned into a pCR-XL-TOPO cloning vector (Invitrogen Corporation, Netherlands). Clones were selected on LB medium supplemented with kanamycin (50 μg ml-1) after transformation into E.coli DH5α cells. DNAs of the recombinant clones containing specific DNA fragements were sequenced by an automatic DNA sequencing system (ABI-377-19; Perkin-Elmer Applied Biosystems, Foster City, CA), and further mapped to the X. axonopodis pv. citri genome.

PCR amplification, cloning and sequence analysis of pthA homologs

Genomic DNA from X. axonopodis pv. citri strain XL38 was isolated by standard methods (Sambrook et al. 1989). Two pthA homologs of XL38 were amplified by PCR using primer pair pthAP7/pthAR2 or pthAXhoI/pthAXbaI described previously (Lin et al. 2005, 2011). PCR analysis with minor modification from previous report (Lin et al. 2011) was performed in a 50 μl mixtures containing 150 ng template DNA, 1× Taq buffer, each primer at a concentration of 1 μM, each deoxynucleoside triphosphate at a concentration of 300 μM, 1U of Taq Plus DNA polymerase (Bio Basic Inc., Canada) with proof-reading function, and DMSO 5 μl. The amplification condition consisted of 94 °C for 1 min, 63 °C or 58 °C for 1 min, and 72 °C for 5 min for 35 cycles with an initial step of 94 °C for 10 min and a final step of 72 °C for 10 min. The PCR products were separated by electrophoresis in 1 % agarose gel, stained with ethidium bromide and visualized under a UV light. Purfication of the PCR products and DNAs sequencing were performed as described previously.

DNA sequence data for Xanthomonas strains causing citrus bacterial canker were analyzed by Blast program at the National Center for Biotechnology Information (NCBI) network service (http://www.ncbi.nlm.nih.gov). The encoded amino acid sequences were analyzed with the Translate program of the SeqWeb sequence analysis system of the GCG software (Accelrys Inc., San Diego, CA). Alignments of deduced sequences of PthA proteins were performed with the Clustalw version 3.2 (Biology Workbench of San Diego Supercomputing Center). The varied amino acid residues were analyzed with Vector NTITM version 8.0 (Invitrogen, Madison, WI).

Transformation into a mutant strain

Transformation into virulence-deficient mutant T38 was performed by electroporation as previously described (Keen 1990). The pthA homologs from XL38 were further subcloned individually into the broad host range vector pBBR1MCS-5 (Kovach et al. 1995) before being transformed into mutant T38. Selections of transformants were accomplished on YPD plates supplemented with antibiotics.

The plasmids from other clones listed in Table 1 were also transformed into mutant T38 and evaluated for pathogenicity individually.

Southern blotting analysis

Genomic DNA from XL38 and mutant T38 were digested with BamHI or EcoRI restriction enzymes, and electrophoresed on an agarose gel (1 %). The gel was then transferred onto a nylon membrane (Zeta-Probe® Blotting Membranes, Bio-Rad Laboratories, CA) followed by hybridizing with a biotin-labeled pthA homolog that was amplified from a total DNA of the XW19 strain by PCR using primer pair pthAP7/pthAR2 (Lin et al. 2005).

Construction of amino acid substitution in the pthA homolog

The amino acid substitution was performed in clone pMCS3836 containing a 3.6 kb pthA homolog fragment from strain XL38 by site-directed mutagenesis introduced by a QuikChange XL site-directed mutagenesis kit (Stratagene). The primers, SP-1 and ASP-1 (Lin et al. 2011) were used for inducing single point mutation to create a mutated residue at a critical position of clone pMCS3836 (Ser286→Pro286). The identity of the insert in resulting plasmid described above was confirmed by DNA sequencing.

Bacterial population in grapefruit leaves

Based on previous study (Lin et al. 2011), for preparation of bacterial suspensions, bacterial cells grown overnight in YPD broth with or without antibiotics were harvested by centrifugation. Cultures were re-suspended in sterile distilled water to a concentration of approximately 105 CFU/ml. Young fully expanded citrus leaves with similar size and thickness were injection-infiltrated with the bacterial suspension into leaf tissues by pressing the opening of a syringe (without a needle) against the leaf surface. The conditions for inoculated plants were the same as previous described.

The leaves were inoculated with the injection-infiltration method. Leaf disks (9 mm in diameter) were sampled with a cork-borer randomly by punching within the inoculated area at various time intervals after inoculation. Twelve leaf disks were sampled for each time interval and three replicates for each strain. Leaf disks were soaked in 1 % sodium hypochlorite for 1 min, and then rinsed in sterile distilled water before being ground in phosphate buffered saline (PBS) (Verniere et al. 1998). The appropriate dilutions of the ground suspension were plated with a Whitley Automatic Spiral Plater (Don Whitley Scientific Limited, England) on YPDAC plates (Verniere et al. 1998) or YPDAC plates containing gentamicin (20 μg ml−1) and the inoculated plates were incubated at 30 °C. The number of colonies was counted 3 days after incubation. The results of bacterial populations were presented as log CFU/cm2.

The stability of plasmids of the derivative strains in leaves was determined by plating the previously mentioned leaf extracts on YPDAC plates with or without adding of gentamicin. Colonies developed from each time interval were screened for antibiotic resistance markers on the plasmid. The loss of plasmid over time was presented as a percentage of Xanthomonas cells displaying the plasmid encoding antibiotic resistance.

Nucleotide sequence accession numbers

The nucleotide and amino acid sequence data for the pthAp, pthA, pthA4, apl1, pthA-KC21, pthA*, pthA w, pthAf, pthA-XW19, pthB, pthC, pthA1, pthA2, pthA3, pthA*2, apl2, apl3, and hssB3.0 regions are available at the GenBank database under accession no. JX310119.1, U28802.1, NC_003922.1, AB021363.1, AB206338.1, EF473086.1, EF473085.1, GU181332.1, GU181333.1, AY228335.1, EF473088.1, NC_003921.1, NC_003921.1, NC_003922.1, EF473087.1, AB021364.1, AB021365.1, and AB175482.1, respectively.

Results

Mutant T38 alters disease symptom on leaves of Mexican lime and grapefruit

To determine whether transposon insertion affected the ability of X. axonopodis pv. citri strain XL38 to cause disease, 680 kanamycin-resistant transformants were individually inoculated in leaves of Mexican lime and grapefruit. The confirmed mutants with altered pathogenicity or virulence in the first round were inoculated and re-inoculated, resulting in a final eight mutants showing symptomatic variations. The single mutant X. axonopodis pv. citri T38 was obtained from mutants derived from strain XL38, which had shown smaller flat necrotic with water-soaked margin lesions on citrus leaves (Fig. 1c and d). Hybridization of EcoRI-digested DNA from T38 with the Tn5 probe revealed a single insertion site (data not shown). A clone containing Tn5 inserted region was isolated from genome of T38, and was sequenced from the end of Tn5. Approximately 460 bp of T38 sequence at the 5′ end of the transposon demonstrated high homology with the nuclear localization signals (NLSs) region and leucine zipper of pthA (Fig. 2).

Fig. 1
figure 1

Symptoms on leaves of grapefruit (a, c, e, g) and Mexican lime (b, d, f, h) induced by strains of Xanthomonas axonopodis pv. citri 30 days after inoculation. a and b: Large flat necrotic with water-soaked margin lesions induced by type Xac-AP strain XL38; c and d: Small flat necrotic with water-soaked margin lesions induced by pthAp-deficient mutant strain T38; e and f: Large flat necrotic with water-soaked margin lesions induced by derivative strainT3836; g and h: Typical erumpent canker lesions with water-soaked margin induced by derivative strain T3835. (Bars = 1 mm)

Full size image
Fig. 2
figure 2

Schematic presentation of Tn5 insertion into pthAp from mutant T38. Solid boxes represent the leucine zipper-like region (LZ), nuclear location signals (NLSs), and acidic transcriptional activation domain (AD). Restriction enzyme cleavage sites are show with a B for BamHI

Full size image

Southern blot analysis of XL38 showed that two BamHI fragments (3.5 kb and 2.8 kb) hybridized with the probe corresponding to the pthA from XW19, which indicated that XL38 harbours two pthA homologs (Fig. 3a). The 3.5 kb BamHI fragment was absent in T38; however, 6.2 kb fragment containing the Tn5 fragment was detected (Fig. 3a). This result suggested that this 3.5 kb fragment is involved in the large flat necrotic with water-soaked margin lesion inducing on leaves of Mexican lime and grapefruit.

Fig. 3
figure 3

a Southern hybridization showing Tn5 mutagenesis of pthA in Xanthomonas axonopodis pv. citri. The blot was probed with a biotin-labelled 3.5 kb DNA fragement containing an entire length of pthA from X. axonopodis pv. citri strain XW19. Lane 1: BamHI-digested total DNA from X. axonopodis pv. citri strain T38; Lane 2: EcoRI-digested total DNA from X. axonopodis pv. citri strain XL38; Lane 3: BamHI-digested total DNA from X. axonopodis pv. citri strain XL38. M represents the molecular weight marker. b Analysis of recombinant pMCS3836 and pMCS3829 by electrophoresis in agarose gel after digesting with restriction enzymes XhoI and XbaI. Lane1: pMCS3836, the 4.8 kb pBBR1MCS-5 vector with a 3.6 kb pthA homolog insertion fragment; Lane2: pMCS3829, the 4.8 kb pBBR1MCS-5 vector with a 2.9 kb insertion fragment. M represents the molecular weight marker. The 3 kb DNA fragment is marked with an arrow in the margin

Full size image

Cloning and DNA sequencing of the pthA homolog

PCR-amplified a 3.6 kb fragment containing a pthA homolog (designated as pthAp hereafter) and a 2.9 kb fragment were cloned from XL38 strain (Fig. 3b). The nucleotide sequences of the pthAp gene showed over 93 % homology to pthA genes from X. axonopodis pv. citri XW19 (GenBank accession no. GU 181333.1), X. axonopodis pv. citri XW47 (GenBank accession no. 181332.1), X. axonopodis pv. citri 3213 pthA gene (GenBank accession no.U28802.1), X. axonopodis pv. citri NA-1 apl1 (GenBank accession no.AB021363.1), X. axonopodis pv. citri 306 pthA4 (GenBank accession no.NC003922.1) and X. axonopodis pv. citri K21 pthA (GenBank accession no.AB206338.1). The nucleotide sequence analysis revealed that pthAp has an intact promoter, a SD (Shine-Dalgano) region, and a full-length open reading frame (ORF) (GenBank accession no.JX310119.1). Sequence of this ORF contained 18.5 of 102 bp tandem repeats with each encoding 34 amino acids in the central region, a leucine zipper, three nuclear localization signals and an acid transcriptional activation domain (AAD) in the C-terminus (Fig. 2). Multiple sequence alignment revealed the identity of amino acid sequences among PthA proteins from these X. axonopodis pv. citri strains was over 93 %. Upon this region in XL38, an amino acid residue, serine, located at position 286 immediately at N terminal domain of leucine-rich repeat of PthA was the same as that of PthAf protein from XW47, but different from others PthA proteins previously published on GenBank. The result of aligned direct repeat region of this PthAp protein against other PthA proteins indicated that among 18.5 repeats in repeat region of PthAp protein, the third position of amino acid is serine in the first, second, and third repeats which is always proline in other previous published PthA proteins. Moreover, the 13th position of amino acid is alanine for the 11th, 12th, and 13th, and theronine for 14th repeats, while other amino acids were present as glycine, serine, aspartic acid, isoleucine for the rest of previous published ones (Table 2).

Table 2 Aligment of the amino acid sequences encoded in the variable positions of the repeat region of 18 PthA homologs
Full size table
Table 3 Symptoms and lesion expansion observed on leaves of grapefruit and Mexican lime induced by Xanthomonas axonopodis wild-type strains and transformants
Full size table

Complementation of mutant T38

Clone pMCS 3836 containing pthAp was obtained from XL38 and being used to complement isolate T38 in the inoculation of leaves of grapefruit and Mexican lime. The large flat necrotic symptoms with water-soaked margin lesions were restored by transformant T3836 after 30 days of inoculation (Fig. 1e and f). Moreover, clone pMCS 3836 was transformed into competent cells of weakly aggressive X. axonopodis pv. citrumelo strain F2. The transformant F3836 induced large flat necrotic lesions instead of small flat necrotic lesions on citrus leaves (Table 3). This result indicated that pthAp gene confers an activity of enhancing virulence with X. axonopodis pathovars to induce large flat necrotic with water-soaked margin lesions.

Clones pMCS1935, pMCS4735, pMCS38SP and pMCS47SP (Table 1) were also employed to complement T38 in the inoculation experiments of leaves. The inoculation results revealed the canker lesions induced by the transformants T3835, T3835f, T3847SP on Mexican lime leaves except for T38SP while induced canker lesions on grapefruit leaves by T3835 and T3847SP except for T3835f and T38SP (Table 2).

Lesion expansion and bacterial growth

Based on the symptoms induced on leaves of grapefruit and Mexican lime, there was significant difference observed in lesion expansion on citrus leaves among the tested strains XW19, XL38, T38, T38MCS, T3836, T3835, F2, F2MCS and F3836 (Table 2). The lesions produced by T3836 after 30 days of inoculation were significantly larger than those caused by T38 or T38MCS. Moreover, the lesions produced by F3836 were significant larger than those caused by F2 or F2MCS.

Seven tested strains were inoculated and grew in grapefruit leaves. The bacterial populations of XL38 strain increased gradually from 103 CFU/cm2 to 107-108 CFU/cm2 20 days after inoculation. Similar increases were observed for strain T3836 for the first 4 days after inoculation. Thereafter, the rates of growth were different. It was approximately 10–100 folds lower than that of XL38 20 days after inoculation. The bacterial populations of strains T38 and T38MCS increased gradually from 103 CFU/cm2 to 104-105 CFU/cm2 for the first 8 days after inoculation. Thereafter, the rates of growth declined. The bacterial populations of strains T38 and T38MCS were approximately 102 folds lower than those of T3836 20 days after inoculation (Fig. 4a). The bacterial population of strain F3836 increased gradually from 103 CFU/cm2 to 106 CFU/cm2 16 days after inoculation. Thereafter, the rate of growth declined. The bacterial populations of strains F2 and F2MCS increased gradually from 103 CFU/cm2 to 104 -105 CFU/cm2 for the first 16 days after inoculation and declined after that. The bacterial populations of strain F2 and F2MCS were approximately 10-folds lower than those of F3836 20 days after inoculation (Fig. 4b). These results indicated that pthAp gene confers the ability in enhancing bacterial multiplication.

Fig. 4
figure 4

Bacterial populations in grapefruit leaves. a The bacterial populations of strains XL38, T38MCS, T3836 and T38; b The bacterial populations of strains T38, F2, F2MCS and F3836. Each bacterial strain was inoculated into leaves by injection-infiltration at a concentration of 1 × 105 CFU/ml. Each value represents the mean of three replicates with standard error

Full size image

Discussion

The pthA gene is the pathogenicity determinant for X. axonopodis pv. citri in the symptom development of citrus canker including hypertrophy, hyperplasia and cell death of host cells (Duan et al. 1999). AI-Saadi et al. (2007) reported that the pathogenicity of X. axonopodis pv. citri on citrus is determined by the specific sequence of the 17.5 direct repeats in the central region of the protein. In this project, the isolation and characterization of a new member of the Xanthomonas avrBs3/pthA gene family, pthAp, from a Xac-Ap type strain confers the abilities of enhancing lesion expansion and bacterial multiplication were performed. Moreover, we confirmed that the pthAp exhibited different ability for inducing flat necrotic symptom. These results suggested that the pthAp is an important virulence factor to perform a variety of tasks in enhancing bacterial virulence and proliferation.

In this study, the pthAp gene was cloned and a pthAp mutant of strain XL 38 was constructed. This mutant T38 was able to induce small flat necrotic lesion on citrus leaves. Furthermore, pthAp from XL38 was subcloned into vector pBBR1MCS-5 and then mobilized into weakly aggressive strain X. axonopodis pv. citrumelo F2 that induced small flat necrotic lesion on citrus leaves. The new transformant F3836 harbouring pthAp gene was able to elicit large flat necrotic lesion on citrus leaves, and bacterial population of F3836 was 10-folds higher than those of F2 20 days after inoculation. These results indicated that pthAp fail to induce the normal canker, however, the ability of bacterial virulence was enhanced.

The amino acid sequence analysis showed that the 3.5-kb BamHI fragment of pthAp containing 18.5 direct repeats that has not been reported in other pathogenic X. axonopodis pv. citri strains. The structure of pthAp belongs to typical Xanthomonas avrBs3/pthA gene family members. It has a central domain containing a series of 102-bp direct repeats (Gabriel 1999), three nuclear localization signals (Yang and Gabriel 1995b), and an eukaryotic transcriptional activation domain (Zhu et al. 1998). After aligned repeat regions of all PthA proteins, the results revealed that the individual repeat units are highly conserved apart from position 4, position 12 and 13 (hypervariable residues), and positions 31 and 32. This result is similar with previous study (AI-Saadi et al. 2007). However, PthAp protein is special at the third position of amino acid residue in the first, second, and third repeats. Moreover, the 13th position of amino acid residue in the 11th, 12th, 13th and 14th repeats of direct repeats are different from those of other AvrBs3/PthA family members. Based on the fact that Xanthomonas translocates avrBs3/pthA gene family members into plant cells as transcriptional activators. They can be localized to the plant cell nucleus and modulate expression of plant gene (Kay and Bonas 2009). Therefore, the alteration of the amino acid residues in these specific sites in 17.5 direct repeats would affect the pathogenicity of PthAp protein. The specificity of avrBs3/pthA gene family members is encoded in the direct repeat region and each repeat corresponds to on DNA base pair. Two hypervariable amino acids [(known as repeat variable diresidues (RVDs)] at repeat position 12 and 13 determine the DNA base-pair recognition specificity of each repeat (Boch and Bonas 2010). Since most members of the AvrBs3/PthA protein family share high-sequence identity, it is postulated that, besides the variation in the number of direct repeats, the variable amino acid residues at the third position (P→S) in the 1st, 2nd, and 3rd repeats, and at the 13th position (G, I, D, S→A, T) in the 11th, 12th, 13th, and 14th repeats would alter a critical recognition in conferring the specificity required for the interaction with particular protein or DNA targets. Based on these observations that PthAp protein failed to induce erumpent canker symptom on citrus leaves. This finding suggested that a new number of direct repeats and alternation of amino acid residues at special positions in these repeats can result in a new gene sequence with altered function.

Complementation of mutant T38 with clones pMCS1935, pMCS4735 and pMCS47SP with 17.5 direct repeat sequences (Table 1) from strains XW19 and XW47 of pthA gene respectively (Lin et al. 2011) successfully restored the ability of the T38 to elicit hyperplastic canker symptom on the leaves of Mexican lime. In the case of grapefruit, pMCS1935 and pMCS47SP also restored typical hyperplastic canker symptom expect clone pMCS4735 only elicited large flat necrotic lesion on leaves. These results suggested that the 17.5 direct repeat in pthA gene is required and critical for full pathogenicity of the bacterium. The amino acid residue, serine, located at critical position 286 in N terminus motif of leucin-rich repeat of PthAp was the same as that of PthAf protein (containing 17.5 direct repeats) from XW47 (Lin et al. 2011) can alter canker formation on grapefruit leaves. To investigate the effect of amino acid residue at position 286 of PthAp on symptom development induced by Xac-Ap type strain, mutated PthAp with a single amino acid substitution was constructed. The amino acid substitution S286P of PthAp (containing 18.5 direct repeats) from XL 38 resulted in no alternation of symptom for transformant T38SP to induce an erumpent canker symptom, whereas the amino acid substitution S286P of PthAf (containing 17.5 direct repeats) from XW47 could complement the canker-inducing ability of T38 on citrus leaves (Table 2). This result confirmed that the critical role of the specific sequence of 17.5 direct repeats that is responsible for inducing canker symptom by X. axonopodis pv. citri.

Many X. axonopodis pv. citri strains contain multiple variants of AvrBs/PthA proteins. The existence of multiple copies of avrBs3/pthA genes in a single strain is thought to facilitate recombination and rapid adaptation to new hosts (Yang and Gabriel 1995a), and variants of pthA from a single bacterial strain localize to nucleus of plant cells and form homo- and heterodimers to modulate host transcription (Domingues et al. 2010). In our study, Southern hybridization analysis revealed strain XL38 possessed two BamHI fragments (3.5-kb and 2.8-kb) hybridized with pthA, this result was the same as the strains of A*, Aw, B, C groups, had only two BamHI fragments except for the size differences (AI-Saadi et al. 2007). Based on high level of sequence conservation among members of pthA homologs, the size differences of these bands may due to variable numbers of 102-bp direct repeats within the BamHI fragment. The number of repeats to induce target gene expression, a minimum number of 6.5 repeats is necessary (Boch et al. 2009). We also cloned a 2.8-kb BamHI fragment with PCR-amplified method from genomic DNA of XL38 strain generated a 2.9-kb fragment (Fig. 3b) and sequenced. This 2.9-kb fragment is a pthA homolog with 11.5 direct repeats and appears to have an intact promoter, a SD region, and a full-length open reading frame (data not shown). Knockout mutation of this pthA homolog and its complementation are being investigated to provide further evidence for the relationship in symptom development. Due to pthA homologs from Xac-Ap type strain XL38 didn’t possess normal 17.5 direct repeats that is essential for inducing canker symptom of X. axonopodis pv. citri. Taking altogether, our results demonstrated that features of these repeats contribute to the atypical symptom caused by strain XL38 that failed to induce canker lesions on leaves of grapefruit and Mexican lime.