Introduction

Telomeres are repetitive DNA sequences at the ends of eukaryotic chromosomes with a specialized structure that stabilizes the chromosomes and prevents their fusion during mitosis. Telomerase, a ribonucleoprotein complex, is capable of de novo synthesis of telomeric DNA. The most important component that is responsible for the catalytic activity of telomerase is telomerase reverse transcriptase (TERT) (Martin-Rivera et al. 1998; Nakamura et al. 1997). Numerous studies have shown that human TERT (hTERT) is expressed in most malignant tumors, but not in normal human tissues, and that expression of hTERT is closely correlated with telomerase activity (Kilian et al. 1997; Meyerson et al. 1997; Takakura et al. 1998). These findings indicate that hTERT is a rate-limiting determinant of the catalytic activity of telomerase. Recently, the promoter region of the hTERT gene was cloned, and initial analyses indicated that c-Myc is involved in the transcriptional activation of the hTERT gene in tumor cells (Wang et al. 1998; Xu et al. 2001). In addition, several researchers have demonstrated that Mad1 acts in an antagonistic manner in response to c-Myc-induced transactivation, thereby resulting in a potent repression of the hTERT gene via binding to the E-box elements located in the proximal core promoter (Gunes et al. 2000; Oh et al. 2000; Xu et al. 2001). As compared to the accumulated evidences regarding the regulatory mechanisms of hTERT transcription, knowledge on the regulatory mechanisms of mouse TERT (mTERT) transcription is limited. In the present study, we attempted to investigate the regulatory mechanisms of the mTERT promoter and clarify the differences in the regulatory mechanisms and competence of c-Myc between the hTERT and mTERT core promoters.

Materials and methods

Cell lines and culture conditions

A human lung adenocarcinoma cell line (A549) was cultured in eRDF medium (Invitrogen, Carlsbad, CA) supplemented with 5% fetal bovine serum (FBS; Invitrogen). TIG-1 cells (Institute of Development, Aging and Cancer (IDAC), Tohoku University, Miyagi, Japan) and mouse embryonic fibroblasts (MEFs) derived from embryonic day 13.5 mice were cultured in MEM medium (Nissui, Tokyo, Japan) supplemented with 10% FBS at 37 °C in 5% CO2. A mouse fibroblast cell line (NIH3T3) was obtained from IDAC and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nissui) supplemented with 10% FBS.

Quantitative real-time PCR

RNA was prepared using the FastPure RNA kit (TaKaRa, Shiga, Japan). cDNA was prepared using M-MLV RT RNase H− (Promega, Madison, WI) according to the manufacturer’s protocol. Quantitative PCR was performed using SYBR Premix Ex Taq (TaKaRa) and Thermal Cycler Dice Real Time System TP-800 instrument (TaKaRa). PCR amplification began with a 10-s denaturation step at 95 °C and then 40 cycles of denaturation at 95 °C for 5 s, annealing at 55 °C for 20 s, and extension at 72 °C for 20 s. The samples were analysed in triplicate, and the hTERT and mTERT levels were normalized to the corresponding β-actin levels. The PCR primer sequences used were as follows: hTERT top primer CGTACAGGTTTCACGCATGTG and bottom primer ATGACGCGCAGGAAAA ATG; human β-actin top primer TGGCACCCAGCACAATGAA and bottom primer CTAAGTCATAGTCCGCCTAGAAGCA; mTERT top primer CAGCCATACATGGGCCAGTTC and bottom primer ACAGGCTGCTGCTGCTCTCA; mouse β-actin top primer GGCCAGGTCATCACTATTG and bottom primer GAGGTCTTTACGGATGTCAAC.

hTERT and mTERT promoter-reporter constructs

We amplified the 5′-flanking region of the hTERT and mTERT genes by using genomic DNA prepared from A549 cells and NIH3T3 cells, respectively. Templates and primers were designed based on the deposited sequences (hTERT, AB016767; mTERT, AF121949). DNA fragments of various lengths that were located upstream of the initiation ATG codon were amplified using PCR and were inserted into the firefly luciferase reporter plasmid pGL3-Basic (Promega). E-box elements in the isolated hTERT and mTERT promoter regions (hTERT, −242 to −237 and −34 to −29; mTERT, −230 to −225 and −32 to −27) were changed from CACG/CTG to TTTGTG using the GeneEditor in vitro Site-Directed Mutagenesis System (Promega).

Transfection and luciferase assay

All transfections were carried out in triplicate in 24-well plates (Becton–Dickinson Labware, Franklin Lakes, NJ). The cells were seeded at subconfluence and were cultured overnight. In order to standardize transcription efficiency, the luciferase reporter plasmid and effector plasmids were cotransfected along with the Renilla luciferase plasmid pRL-TK (Promega) into the cells by using the LipofectAMINE PLUS reagent (Invitrogen) in accordance with the manufacturer’s instructions. The cells were exposed to the transfection mix for 3 h and harvested for analysis after 48–72 h. Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega). Relative luciferase activity was calculated by dividing the firefly luciferase activity by the Renilla luciferase activity. The experiments were repeated at least three times; standard deviations are shown in the figures.

Plasmids

Full length human c-myc cDNA was prepared from pSPT-myc (JCRB GeneBank, Japan) and was inserted into pcDNA3 (pcDNA3-c-Myc). The mad expression plasmid (pcDNA3-Mad) was a generous gift from R. Robert (Fred Hutchinson Cancer Research Center), and MadMyc and MadMyc∆C expression plasmids were generous gifts from R. Bernards (The Netherlands Cancer Institute).

Results and discussion

Identification of cis-elements in hTERT and mTERT promoter region

Previous studies have shown that the hTERT gene is expressed in most tumors cells, but not in normal cells, where the c-Myc oncogene plays a critical role in regulating the expression of this gene (Ramakrishnan et al. 1998). In this study, we attempted to clarify differences in the transcriptional regulatory mechanisms of the TERT gene between human and mice. We analyzed the expression of TERT gene between normal and tumor/immortalized cells by quantitative real time PCR (Fig. 1). As shown in Fig. 1, TERT gene expression was not detected in human normal cells, but in mouse normal cells. To analyze the transcriptional regulatory mechanisms of the hTERT and mTERT gene, we isolated their promoter regions. The promoter fragment for hTERT (from −286 to −25), mTERT (from −281 to −25), and their 5(-truncations were amplified by PCR and cloned into pGL3-basic (Fig. 2a, b). The region from −286 to −25 of the hTERT gene was reported to be the core promoter region (Horikawa et al. 1999; Takakura et al. 1999). TERT core promoter activity is known to be related to TERT mRNA expression in human cells (Takakura et al. 2005) and in mouse cells (Nozawa et al. 2001). As expected, we detected a strong promoter activity in the fragment region from −286 to −25 of the hTERT promoter. Next, we tested for the promoter activity of the fragment derived from the mTERT promoter. As shown in Fig. 2b, a fragment of the mTERT promoter (−281 to −25) with almost the same length as that of the hTERT core promoter demonstrated a similar strong promoter activity. These results indicate that an almost similar length of fragments located upstream of the ATG codon constitutes the core promoter in both the species. Sequence alignment of the core promoter regions of the hTERT and mTERT promoters indicates several conserved cis elements, including an E-box and GC box (Fig. 2c). E-boxes of the c-Myc/Max-binding type (CACGTG) in particular, are highly conserved between the hTERT and mTERT promoters and are located at −34 in the hTERT promoter and at −32 in the mTERT promoter. The second E-box identified at −242 of the hTERT promoter is also of the c-Myc/Max-binding type, while that identified at −230 of the mTERT promoter is of the canonical and not the c-Myc/Max-binding type. These single nucleotide differences in the second E-box might induce differential dependency of hTERT and mTERT promoters on c-Myc. Further, GC boxes are also conserved in both the core promoter regions; five GC boxes in the hTERT promoter and three GC boxes in the mTERT promoter. Sp1 was reported to play an important role in the activation of hTERT transcription through its binding to the GC box (Kyo et al. 2000), thereby suggesting that although Sp1 is also involved in the transcriptional regulation of the mTERT promoter, the difference in the number of GC boxes might elicit a distinct regulatory mechanism between hTERT and mTERT. Thus, sequence alignment demonstrated that the core promoter regions for the hTERT and mTERT promoters have approximately the same length and similar number and kinds of cis elements at almost the same position. This suggests common regulatory mechanisms between the hTERT and mTERT promoters. However, some differences in the cis elements and in the surrounding regions of both the promoters might elicit differential transcriptional regulation of these promoters.

Fig. 1
figure 1

Expression of the hTERT and mTERT genes in immortal and mortal cells. A549 cells and NIH3T3 cells (immortal cells) and TIG-1 cells and MEF (mortal cells) were investigated, and the expression of hTERT and mTERT was assessed by quantitative real-time PCR. The samples were analysed in triplicate, and the hTERT and mTERT levels were normalized to the corresponding beta-actin levels

Full size image
Fig. 2
figure 2

Core promoter regions for the hTERT and mTERT genes. a and b, A549 cells and NIH3T3 cells were transfected with luciferase reporter constructs containing the 5′-flanking region of the hTERT and mTERT genes. Experiments were performed in triplicate, and the representatives are indicated. c Sequence alignment of the hTERT and mTERT core promoters and the putative cis elements. The translation start site is indicated as +1. Consensus motifs for the E-box and GC box are underlined

Full size image

E-box dependency of regulation of the hTERT and mTERT core promoters

c-Myc is reported to be a dominant transcriptional activator for hTERT expression (Greenberg et al. 1999; Horikawa et al. 1999; Kyo et al. 1999, 2000; Wang et al. 1998; Wick et al. 1999). Further, previous reports have demonstrated that Mad acts in an antagonistic manner in response to c-Myc-induced hTERT transactivation via binding to the E-box elements located in the core promoter (Xu et al. 2001). On the other hand, the functionality of c-Myc is complicated in mouse cells, and this is evident in the report by Ramakrishnan et al. (1998), which states that c-Myc activates mTERT expression in primary mouse cells, but not in some immortal mouse cell lines. The ability of c-Myc to regulate mTERT expression was suggested to be superceded by other events associated with immortalization, adaptation to ex vivo culture, and/or cell context.

In the present study, we attempted to clarify the differences in c-Myc dependency between the hTERT and mTERT core promoters and then performed luciferase assays. As expected, the activity of the hTERT core promoter was activated by c-Myc and attenuated by Mad (Fig. 3a). Further, a mutant hTERT core promoter with mutated E-box elements did not respond to both c-Myc and Mad. These results indicate that the regulation of the hTERT core promoter is dependent on the E-box and the E-box binding factors. On the other hand, the mTERT core promoter activity did not respond to both c-Myc and Mad (Fig. 3b). Unexpectedly, the introduction of mutations in E-box elements augmented the mTERT core promoter activity. These results indicate that the mTERT core promoter is regulated independent of the E-box and c-Myc. Because we could not find any transcription factors that bind to the mutated E-box site, unidentified factors other than c-Myc would bind to the E-box and repress its promoter activity.

Fig. 3
figure 3

Regulation of hTERT, but not mTERT, core promoter is dependent on the E-box and c-Myc a the hTERT core promoter is regulated in a c-Myc-dependent manner. A549 cells were transfected with a vector expressing c-Myc or Mad along with pGL3b-h286 or its E-box mutant, and these transfected cells were than used for the luciferase assay. The relative luciferase activity is shown. b the mTERT core promoter is not regulated in a c-Myc-dependent manner. Transfection into NIH3T3 cells and luciferase assay using pGL3b-m281 containing the mTERT core promoter were performed as described in a. c MadMyc represses hTERT core promoter activity. A549 cells were transfected with a plasmid expressing MadMyc or MadMycΔC along with pGL3b-h286 or its E-box mutant, and the transfected cells were then used for the luciferase assay. d MadMyc does not affect the mTERT core promoter activity. Transfection into the NIH3T3 cells and the luciferase assay using pGL3b-m281 were performed as described in b. All results were expressed as the bars indicating mean ± SD of three independent experiments

Full size image

To further clarify the E-box-dependency of hTERT and mTERT core promoters, a luciferase assay was performed using a dominant negative c-Myc, named MadMyc, which represses the c-Myc target genes. MadMycΔC with a mutation in the DNA binding and heterodimerization domain was used as the control. As shown in Fig. 3c, MadMyc, but not MadMycΔC, suppressed the hTERT core promoter activity. Further, both MadMyc and MadMycΔC slightly repressed the mutant hTERT promoter. These results also indicate that the regulation of the hTERT core promoter is dependent on the E-box and c-Myc; they also suggest that MadMyc might attenuate the hTERT core promoter activity in an E-box independent manner, possibly by capturing transcriptional activators. On the other hand, both MadMyc and MadMyc∆C did not affect the mTERT core promoter activity (Fig. 3d) and also demonstrated that the mTERT core promoter activity is regulated independent of the E-box and c-Myc.

Next, we investigated the c-Myc dependency of hTERT and mTERT gene transcription. After transfecting A549 cells and NIH3T3 cells with a vector expressing MadMyc or MadMyc∆C, TERT expression was assessed. As shown in Fig. 4, MadMyc, but not MadMyc∆C, repressed the transcription of the hTERT gene. On the other hand, neither MadMyc nor MadMyc∆C affected the transcription of the mTERT gene. These results also indicate that the regulation of the hTERT, but not the mTERT, core promoter is dependent on E-box and c-Myc. All these results demonstrate that the dominant transcriptional activator of c-Myc for the hTERT core promoter is not involved in the regulation of mTERT gene transcription. These results also suggest that immortalization and tumorigenesis are regulated by distinct regulatory mechanisms and molecules in human and mice.

Fig. 4
figure 4

Effect of MadMyc on the transcription of the hTERT and mTERT genes. A549 cells and NIH3T3 cells were transfected with a plasmid expressing MadMyc or MadMyc∆C. After culturing for 72 h, the transfected cells were applied to RT-PCR analysis in order to detect the transcription of the hTERT and mTERT genes

Full size image