Introduction

Abies pindrow Royle, a vital conifer of economic significance, thrives in shaded and moist north-facing mountain slopes, typically ranging between 2000 and 3400 m above sea level (Kunwar et al. 2020). With towering heights of 40 to 60 m and diameters spanning 2.0 to 2.5 m (Ali et al. 2014), it forms dense stands either independently or in association with other trees such as Pinus wallichiana, Picea smithiana, Aesculus indica, Quercus semecarpifolia, Taxus contorta, Prunus cornuta, and Acer ceasium (Joshi and Samant 2004; Uddin et al. 2019). As a keystone species, A. pindrow significantly contributes to the structural integrity of temperate forest ecosystems, while also enhancing biological productivity through vegetative growth, biomass yield, and habitat creation (Singh et al. 2018). Its wood serves various purposes including fuel, timber, agricultural tools, furniture, and pulp production (Gairola et al. 2014). However, over the past few decades, fir forests have undergone extensive deforestation and degradation, primarily due to over-harvesting for building and carpentry, paper and pulp, matchwood, packing cases, and other uses, despite limited natural regeneration (Dar and Dar 2006). The removal of trees has not been synchronized with natural regeneration and seedling establishment processes. Challenges such as high litter fall, thick layers of humus accumulation, lean seed years, poor seed production, dense weed growth, grazing and trampling by livestock, and slow decomposition rates of their needles contribute to the obstacles faced in natural regeneration (Sufi 1970). Bakshi et al. (1972) have suggested that poor mycorrhizal association may be one of the reasons for the inadequate regeneration of A. pindrow, among other factors. The production of healthy and robust seedlings within a shorter nursery time can be achieved by utilizing appropriate mycorrhizal fungi. This approach holds promise for enhancing the restoration efforts of A. pindrow forests and ensuring the ecological balance of the Himalayan region.

Plants within the Pinaceae family, including A. pindrow, rely obligatorily on ectomycorrhizal fungi for their growth and survival, under both normal and stressful conditions (Policelli et al. 2020). The successful establishment of these plants in the field is heavily reliant on the presence of suitable ectomycorrhizal fungi (Argüelles-Moyao et al. 2017). In natural forest ecosystems, the root systems of trees almost invariably establish ectomycorrhizal relationships with various species of ectomycorrhizal mushrooms (Dahlberg 2001; Guidot et al. 2004; Tapwal et al. 2021). Mycorrhizae within plant roots play a crucial role in forest restoration through two primary mechanisms: mitigating root stresses and enhancing nutrient absorption by expanding root surface area (Itoo and Reshi 2013; Lakhanpal et al. 2021; Tapwal et al. 2023). Rinaldi et al. (2008) and Roy-Bolduc et al. (2016), indicate the presence of approximately 20,000 to 25,000 fungi establishing ectomycorrhizal associations with 6000 species of higher trees. The recent advancements in next-generation sequencing (NGS) have significantly contributed to our understanding of ectomycorrhizal fungal diversity, ecology, and biogeography (Nilsson et al. 2011; Smith and Peay 2014; Tyub et al. 2018; Tedersoo et al. 2014, 2022). Ectomycorrhizal symbiosis plays a pivotal role in forest ecosystems by facilitating essential functions such as carbon cycling, nutrient mobilization from soil organic matter and minerals, and establishing connections among trees through common mycorrhizal networks (Futai et al. 2008; Agarwal and Sah, 2009; Policelli et al., 2020; Usman et al., 2021). It also mediates plant responses to stressors like drought, soil acidification, toxic metals, and plant pathogens, while contributing to the rehabilitation and regeneration of degraded forest ecosystems and interacting with other soil microorganisms (Courty et al. 2010; Itoo and Reshi 2013). The ectomycorrhizal symbiosis offer a natural, cost-effective, and eco-friendly alternative to synthetic chemical inputs, enhancing productivity without causing ecological harm (Policelli et al. 2020; Assad et al. 2021). Similarly, A. pindrow, like most temperate and boreal tree species, forms mutualistic relationships with ectomycorrhizal fungi, which significantly contribute to the survival and growth of these trees. Despite being relatively understudied in terms of mycorrhizal association, the ectomycorrhizal fungi associated with A. pindrow show promise for effectively restoring and regenerating degraded fir forests. Presently, alongside sporocarp sampling and morphoanatomical methods, next-generation sequencing and bioinformatics tools are employed to investigate the mycorrhizal symbiosis in roots.

Methodology

Study area

The current study was conducted in Hatu Forest, Narkanda, Shimla, Himachal Pradesh, India (2800–2900, Above Mean Sea Level (AMSL), 38° 03′ 23.8″ N, 128° 38′ 38.7″ E). The major canopy vegetation at the site comprised of Abies pindrow and Picea smithiana interspersed with Quercus semecarpifolia, Taxus contorta, Pinus wallichiana, and Prunus cornuta; the understory included the species of Viburnum, Berberis, and Rosa. The soil was acidic and moisture rich.

Sampling

Five individual trees, spaced at least 50 m apart, were randomly selected for root sample collection. Soil cores (10x10x10cm) were extracted using a spade, starting from the organic layer after clearing the litter. Mycorrhizal root samples were carefully collected from two points on opposite sides of each tree, sealed in sterilized polybags, and kept at 4°C until processing. Sporocarps of ectomycorrhizal fungi growing in the rhizosphere of A. pindrow were collected between July and October in during 2021 and 2022. Each sporocarp was carefully placed in a paper bag, transported to the laboratory, and identified.

Morphoanatomical characterization

Prior to analysis, the soil cores were immersed in water and soaked carefully. The roots were then placed in a 1-mm sieve and gently rinsed with tap water to remove any attached soil and debris. Fine root tips were meticulously sorted from the main roots, mycorrhizal roots identified by the absence of root hairs and the presence of somewhat enlarged tips (Menkis et al. 2005). Mycorrhizal root tips were further categorized into morphotypes based on morphological characteristics outlined by Agerer (1991, 2001, 2006) and DEEMY (http://www.deemy.de/). These morphotypes were differentiated by attributes such as color, shape, texture, ramification type, and the occurrence and abundance of emanating hyphae or rhizomorphs. Subsequently, different morphotypes were separated into two distinct vials: one for anatomical studies fixed in FAA, then stored in 50% ethanol for subsequent microscopic examination, and another for metagenomics analysis, preserved at −20°C.

To examine the surface features of ectomycorrhizal roots, tertiary roots with mantle sheaths were carefully excised and prepared for microscopic analysis. Macroscopic attributes such as ramification, color, and the presence of rhizomorphs were observed under a stereo-zoom microscope (Nikon SMZ 1500). For detailed examination of internal structural features, roots were cut into 1 cm segments. These segments were then subjected to a series of treatments: they were first cleared using 10% KOH at 90°C for 3–4 h, followed by bleaching with a solution of 0.5% H2O2 and 0.5% NH4OH for 30 min, and acidification with 5N HCl for 5 min. Subsequently, the roots were stained overnight with Trypan blue (0.1%), and any excess stain was removed with lactoglycerol. Thin sections of the root tips were cut, stained again with a 0.1% Trypan blue solution, and observed at different magnifications (×4, ×10, ×40, ×100) using a compound microscope (Nikon ECLIPSE E400) to examine the internal structures in detail.

Molecular characterization

Molecular characterization of A. pindrow root-associated ectomycorrhizal (EcM) symbiont was performed by extracting genomic DNA from the mycorrhizal root tips of the A. pindrow, followed by the amplification of the ITS region using universal primers (ITS1: 5′ TCCGTAGGTGAACCTGCGG3′ and ITS2: 5′ GCTGCGTTCTTCATCGATGC3′).

Fungal DNA was isolated from the mycorrhizal root tips using the Xploregen gDNA extraction kit following the manufacturer’s protocol. The integrity of the DNA was assessed using 0.8% agarose gel. Subsequently, the quality and quantity of the DNA were determined by measuring the optical density (OD) at 260/280 nm on a spectrophotometer. Samples with OD values ranging from 1.8 to 2.0 were selected for downstream PCR amplification. For the PCR amplification, 40 ng of extracted DNA was utilized along with 10 pM of each primer. The amplifications were conducted in a thermal cycler (MiniAmp™ Plus, Applied Biosystems, Thermo Fisher Scientific) with an initial denaturation step of 95°C for 10 min, followed by 25 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 2 min, with a final extension step of 72°C for 10 min. The amplicons from each sample were purified using AMPure XP Beads to remove unused primers, and an additional 8 cycles of PCR were performed using Illumina barcoded adapters to prepare the sequencing libraries. Further purification was carried out using AMPure XP Beads, and the concentrations of the libraries were quantified using the Qubit dsDNA High Sensitivity assay. Subsequently, sequencing was conducted on the Illumina MiSeq platform using the 2x300PE ITS sequencing kit, which generated paired-end reads for each DNA fragment.

Bioinformatics analysis

The bcl data received from the sequencer was de-multiplexed into .fastq raw data. The de-multiplexed data quality was checked using Fastqc (Version 0.11.9) and Multiqc (Version 1.10.1) tools. Biokart Pipeline was used for metagenomics analysis. The workflow of the pipeline progresses through stages: ensuring data quality, detecting chimeric sequences, clustering operational taxonomic units (OTUs), selecting representative sequences, assigning taxonomic identities, and generating a concise OTU table. For visualization of data, Microsoft Excel (2010) was used. The dendrogram was constructed using MicrobiomeAnalyst (online tool: https://www.microbiomeanalyst.ca/) and MEGA 11. Taxonomic assignments to the representative sequence from each OTU were performed with the UNITE reference database. For functional detail analysis, the FunGUILD tool was used. Alpha diversity of the fungal community was determined by Shannon-Weiner and Simpson’s index using PAST.

Results

Sporocarp Richness, diversity and community structure

The study identified a total of 22 species belonging to 10 genera in association with the roots of Abies pindrow. These genera include Amanita, Boletus, Cortinarius, Helvella, Inocybe, Lactarius, Ramaria, Russula, Suillus, and Tuber. The Russula genus was the most dominant, comprising 57 sporocarps and 6 species. To assess the diversity of the fungal community, various indices were calculated. The Shannon-Weiner index, which measures the richness and evenness of species in a community, was found to be 2.799. The Simpson’s index, which quantifies the probability that two individuals randomly selected from a sample will belong to the same species, was calculated to be 0.927. These indices suggest a relatively diverse and evenly distributed fungal community associated with Abies pindrow roots. Additionally, the estimated richness of the fungal community, as predicted by the Chao1 index, was 22.25. Figure 1a illustrates the relative abundance of ectomycorrhizal (EcM) fungal sporocarps associated with A. pindrow roots. This figure provides insights into the distribution and abundance of different fungal species within the studied ecosystem, highlighting the dominance of certain genera and species in the fungal community. This information could be crucial for understanding the ecological dynamics and functioning of the fungal component within the forest ecosystem and can inform conservation and management strategies aimed at preserving the diversity and health of these ecosystems.

Fig. 1
figure 1

EcM fungi associated with Abies pindrow as depicted by. a Sporocarp sampling. b Metagenomics analysis of EcM root tips (abundance represented as relative proportion of sequences for each OTU belonging to EcM guild)

Full size image

Morphoanatomical analysis

The root tips of A. pindrow underwent meticulous examination to investigate various morphological and anatomical features, revealing an average colonization rate of 74%. Through detailed observation of morphological characteristics, 10 distinct EcM morphotypes were discerned from A. pindrow roots. These morphotypes delineate a spectrum of structural features characterizing the mycorrhizal associations formed between A. pindrow and its fungal symbionts. The EcM morphotypes exhibited varying lengths, ranging from 0.3 to 1.9 cm, with the main axis diameter spanning from 0.4 to 1.6 mm. Extra-radicle hyphae and rhizomorphs were commonly observed in the majority of the morphotypes. Anatomical examination revealed a mantle thickness ranging from 14 to 63 μm, primarily organized in a plectenchymatous manner. Certain morphotypes also exhibited cystidia. Hartig net formation extended to a depth of up to 4 cortical layers. Further detailed insights from each morphotype is presented in Table 1.

Table 1 Morphoanatomical details of the ectomycorrhizal morphotypes of the Abies pindrow
Full size table

Metagenomics analysis

A total of 285,148 raw sequences were obtained, representing 326 operational taxonomic units (OTUs) distributed across 193 genera, 114 families, 45 orders, 22 classes, and 6 divisions. The dataset encompassed OTUs from six taxonomic divisions: Ascomycota, Basidiomycota, Mucoromycota, Zoopagomycota, Chytridiomycota, and Alpidiomycota. Ascomycota emerged as the most prevalent division, with 211 identified OTUs (Fig. 2). Among the fungal classes, Pezizomycetes and Agaricomycetes were the most dominant. Dominant orders included Pezizales and Russulales, while Tuberaceae and Russulaceae stood out as the most dominant families. Notably, the genera Tuber and Russula exhibited high dominance, collectively constituting 53.5% of the fungal population.

Fig. 2
figure 2

Taxonomic representation of fungal OTUs linked to the Abies pindrow (abundance represented as relative proportion of sequences for each OTU based on NGS)

Full size image

Out of the 326 OTUs identified, 244 were successfully assigned a guild using FUNGuild. The prominent guilds observed included ectomycorrhizal, ectomycorrhizal-saprotrophic, endophytic, saprotrophic, pathogenic, and parasitic. Among these, 36 OTUs belonging to 20 genera and 15 families were categorized as ectomycorrhizal, representing 63.1% of the fungal community associated with A. pindrow roots. Of the ectomycorrhizal taxa, Tuber exhibited the highest absolute abundance, representing 37.42% of the fungal population, followed by Russula at 21.06% (Fig. 2b). Notably, the top four most abundant taxa belonged to the ectomycorrhizal guild, constituting 54.2% of the fungal community associated with A. pindrow roots. Among the 36 ectomycorrhizal taxa, 7 belonged to the Ascomycota group, representing approximately 59.7% of the EcM fungal population, while 29 belonged to the Basidiomycota group, representing about 40.3% of the population. Additionally, out of these 36 taxa, 19 were identified to the species level, 15 to the genus level, and 2 were classified only to the family level (Fig. 3 and 4). These taxa are included in the EcM guild, as all species within these genera and families are strictly mycorrhizal. Apart from the 36 ectomycorrhizal taxa, an additional 6 taxa could only be identified to the level of genus, family, or order (Entoloma, Pyrenomycetaceae, Pezizaceae, Thelephoraceae, Sebacinales, Agaricales, Heliotales), suggesting their likely association with the EcM guild. Detailed information regarding the taxonomy, abundance, and EcM status of all identified fungal OTUs can be seen in Supplementary Table 1 and Table 2.

Fig. 3
figure 3

EcM species richness as depicted by sporocarp sampling and metabarcoding of mycorrhizal roots

Full size image
Fig. 4
figure 4

Phylogenetic tree with the maximum likelihood analysis of the ITS region of EcM fungi associated with Abies pindrow

Full size image
Table 2 Taxonomic position and relative abundance of EcM fungi associated with Abies pindrow
Full size table

In addition to EcM fungi, the fungal community included endophytes, saprophytic fungi, pathogenic fungi, and fungal parasites (Hypomyces spp.). The alpha diversity of the fungal community, as measured by the Shannon-Weiner (H) and Simpson’s (D) indices, was 2.81 and 0.85, respectively. The estimated richness of the fungal community was 507.6 species according to the CHAO1 index. For the ectomycorrhizal community specifically, the Shannon-Weiner (H) and Simpson’s (D) indices were 2.659 and 0.897, respectively.

Discussion

The current study offers a thorough examination of both the morpho-anatomical and molecular aspects, shedding light on the functional roles and diversity of the fungal community associated with A. pindrow roots. Our findings reveal a rich diversity of fungi inhabiting the roots, with a significant portion belonging to the EcM guild. Given the limited correlation between the diversity of EcM fungi, as determined by visible above-ground sporocarps (Richard et al. 2005), and their actual presence in host roots, we conducted a detailed investigation involving the collection and analysis of A. pindrow roots to identify associated EcM fungi. Morphotyping of EcM alone proves insufficient, as characteristics such as color, ramification, and mycorrhizal system size can vary depending on growth conditions and host plant species (Agerer 1991; Horton and Bruns 2001; Burke et al. 2005). Therefore, our study combines comprehensive morphoanatomical and molecular analyses of A. pindrow roots to gain deeper insights into the genetic basis of A. pindrow mycorrhizae. Moreover, this approach enables the identification of EcM fungi that produce inconspicuous or hypogeous sporocarps.

The morphoanatomical characterization followed the DEEMY guidelines. However, within this database, comprising 554 entries, only 13 descriptions were associated with the genus Abies, and none specifically pertained to A. pindrow ectomycorrhizae. Due to the limited literature on A. pindrow mycorrhizae, precise classification of morphotypes into distinct ectomycorrhizal types was challenging. Consequently, mycorrhizae of A. pindrow were categorized into various groups based on their morphological traits. In total, ten different morphotypes (labeled as A to J) were identified within A. pindrow roots; however, metagenomics analysis revealed the presence of 36 EcM fungi associated with A. pindrow. This underscore previous observations suggesting that similar morphotypes could potentially arise from different fungal species (Menkis et al. 2005; Pestana-Nieto and Santolamazza-Carbone 2009).

Metabarcoding analysis revealed a dominance of fungal operational taxonomic units (OTUs) belonging to Ascomycota (65.7%) and Basidiomycota (33.5%). Notably, a significant portion of the Ascomycota was attributed to Tuber sp., constituting 37.4% of this group. The higher relative abundance of ascomycetes in roots might indicate their better adaptation compared to basidiomycetes (Durand et al. 2017; Dao et al. 2023). Additionally, various fungal types such as endophytes, saprophytes, and pathogens were documented, suggesting the coexistence of functionally diverse fungal taxa within mycorrhizal root tips (Menkis et al. 2005). The fungal community was predominantly composed of ectomycorrhizal fungi, consistent with previous research findings (Argüelles-Moyao and Garibay-Orijel 2018). Several OTUs were detected that could not be classified at the species level, hinting at the possibility of representing previously undescribed taxa.

Sporocarp sampling revealed 22 EcM species, a count comparable to 21 species reported by Sharma and Lakhanpal (1988), 21 species by Thakur (1990), and 18 species by Beig et al. (2011). However, this count is lower than the 36 species identified through metagenomics analysis. In this study, only 33.3% of the genera described by metagenomics analysis of mycorrhizal root tips were found as sporocarps. The variation in species count between sporocarp sampling and metagenomics analysis stems from the fact that some fungi, like Tuber, Melanogaster, and Hydnobolites, are hypogeous, while others form inconspicuous fruiting bodies, such as Cenococcum, Tomentella, and Pseudotomentella. These inconspicuous species constitute a sizable portion of the EcM community associated with A. pindrow, as revealed by metagenomics analysis. This supports previous findings indicating that species not producing obvious fruiting bodies might be highly prevalent in mycorrhizal root tips (Tedersoo et al. 2003; Pestana-Nieto and Santolamazza-Carbone 2009). However, despite being the most abundant sporocarps, Amanita and Lactarius are nearly non-existent in mycorrhizal roots. This may be due to succession of EcM fungi in the mycorrhizal roots.

The presence of ectomycorrhizal truffles in the genus Tuber is notable, constituting a significant portion of the ectomycorrhizal community associated with A. pindrow. Within the genus Tuber, three taxa were identified, with one only classified up to the genus level, while the other two were identified as Tuber pseudoexcavatum and Tuber bomiense. Reports of Tuber species from India are limited, highlighting the need for further studies focusing on these important mycorrhizal and culinary mushrooms.

In a parallel investigation conducted by Assad et al. (2021) in the Kashmir Himalaya, 14 morphotypes were identified, with the monopodial pyramidal type being the most common. Molecular analysis revealed 251,158 reads, 136 OTUs, and 62 confirmed EcM fungi. Abundant EcM genera included Inocybe, Russula, Otidea, Chalara, Sebacina, Tomentella, Cenococcum, and Wilcoxina. In our study, Russula was the second dominant and most diverse genus. In comparison, our study yielded a higher number of OTUs, but a smaller proportion of them were classified within the ectomycorrhizal guild. This variation might stem from differences in the sampling approach.

In nursery and field experiments, prioritizing the use of native microbiomes is essential for improving plant establishment and consistently achieving superior outcomes (Koziol et al. 2018; Policelli et al. 2020; Singh et al. 2020; Tapwal et al. 2022). Ectomycorrhization of seedlings plays a pivotal role in the restoration of conifer forests (Assad et al. 2022). The current research has unveiled that Tuber, Russula, and Entoloma are the most prevalent genera of ectomycorrhizal symbionts of A. pindrow roots. Consequently, it is worthwhile to consider these Ectomycorrhizal fungi for their potential utility in promoting ectomycorrhization, and restoring fir forests.

Conclusion

In forest ecosystems, EcM fungi play an essential role in supporting plant and soil health. Next-generation sequencing tools offer a comprehensive examination of diverse belowground microbiota, making them invaluable for assessing the structure of EcM communities within forest ecosystems. Scanty information is available on the mycorrhizal morphotypes and metagenomics of EcM communities associated with A. pindrow. The current study comprising combined morphoanatomical and molecular characterization of A. pindrow roots deepens our understanding of the diversity and community structure of its ectomycorrhizal symbionts, as well as provides insights into the structural aspects of the ectomycorrhizae. Our findings revealed a total of 326 OTUs belonging to 193 genera, with 36 OTUs across 20 genera being ectomycorrhizal fungi, representing a substantial portion (63.1%) of the fungal community. The findings from this research hold significant relevance for assessments of biodiversity and ecosystem conservation, the potential use of mycorrhizal fungi for the inoculation of tree seedlings in nursery settings and field out planting, and therefore play an important role in the success of reforestation programs. By understanding the EcM associates of A. pindrow, we can better design and implement strategies to enhance the success of reforestation initiatives, ultimately contributing to the conservation and preservation of this valuable Himalayan conifer species and its associated ecosystem.