Introduction

Chilling stress is a crucial factor that limits the geographical distribution and yield of chilling-sensitive plant species. Imbalances in metabolic processes under chilling stress conditions may stimulate the accumulation of reactive oxygen species (ROS), such as superoxide, hydrogen peroxide, singlet oxygen, and hydroxyl radical (Ishikawa and Shigeoka 2008). Excess ROS cause further damage to proteins, lipids, carbohydrates, and DNA, and ultimately result in cell death (Foyer and Noctor 2005; Mittler et al. 2004). Plants have developed antioxidant mechanisms to eliminate superfluous ROS under low-temperature stress. These mechanisms employ enzymatic and non-enzymatic antioxidants, such as reduced glutathione, phenolic compounds, and ascorbate (AsA) (Asada 1999).

AsA protects plants by scavenging ROS generated during photosynthesis, oxidative metabolism, and abiotic or biotic stresses (Padh 1990; Conklin 2001; Gao and Zhang 2008; Müller-Moulé et al. 2004). AsA not only exhibits an antioxidant activity in plants, but also reduces photoinhibition by promoting the conversion of violaxanthin to zeaxanthin in the xanthophyll cycle to dissipate excess excitation energy (Chen and Gallie 2006). AsA functions as an electron donor in the H2O2 detoxification reaction catalyzed by ascorbate peroxidase (APX), thereby enhancing photosystem (PS) II repair. AsA is also a multifunctional metabolite that influences many biological processes, including programmed cell death (de Pinto et al. 2006), flowering (Kotchoni et al. 2009), and plant growth (Pignocchi and Foyer 2003; Barth et al. 2004).

The Smirnoff/Wheeler pathway of ascorbate synthesis, which is the only physiologically significant source of ascorbate in Arabidopsis thaliana (Dowdle et al. 2007), consists of the formation of ascorbate from guanosine diphosphate mannose (GDP-Man) with the intermediates GDP-l-galactose (GDP-l-Gal), l-Gal-1-phosphate, l-Gal, and l-galactone-1,4-lactone (Wheeler et al. 1998). Laing et al. (2007), Linster et al. (2007) and Linster and Clarke (2008) elucidated that GDP-l-Gal phosphorylase (GGP) (EC 2.7.7.69) converts GDP-l-galactose to l-Gal-1-phosphate. Previous studies showed that GDP-l-galactose phosphorylase (EC 2.7.7.69) is a key enzyme in the major biosynthetic pathway (l-galactose pathway) of AsA in plants (Sasaki-Sekimoto et al. 2005; Wolucka et al. 2005; Gilbert et al. 2009; Zhang et al. 2010).

In the present study, the roles of GDP-l-galactose phosphorylase (GGP) in plant AsA biosynthesis and tolerance to chilling stress were investigated by producing transgenic tobacco plants with increased SlGGP expression and by measuring the changes in photosynthesis, growth, and oxidative damage in these modified plants. The transgenic plants demonstrated an enhanced tolerance to chilling stress compared with the wild-type (WT) plants. These results provide new insights into the association between AsA biosynthesis and chilling tolerance in plants.

Materials and methods

Plant growth and treatments

Seeds of tomato (Zhongshu 6) and transgenic tobacco (Nicotiana tabacum L.cv. NC89) were germinated on Murashige–Skoog (MS) agar medium and MS agar medium with kanamycin (50 μg mL−1), respectively, in closed glass bottles for 7 days at 25 °C. Sprouted seedlings were transplanted into sterilized soil and grown in a greenhouse under the following conditions: temperature, 25/20 °C (day/night); photoperiod, 16/8 h; PFD, 300–500 μmol m−2 s−1; and relative humidity, 50–60 %. The 8-week-old transgenic tobacco plants were used for subsequent chilling stress.

The chilling stress treatment was carried out by exposing the whole plants to a low temperature (4 °C) for 0, 3, 6, 12 and 24 h in an illuminated incubation chamber (GXZ-260C) under the following conditions: PFD, 200 μmol m−2 s−1; temperature, 25/20 °C (day/night); photoperiod, 16/8 h; and relative humidity, 50–60 %. All biochemical and physiological measurements were carried out on the youngest fully expanded leaves.

Germination rate was recorded by incubating the WT and transgenic tobacco seeds at 4 °C for 10 days and subsequently recovering them at 25/20 °C (day/night) for 15 days. Pictures of the samples were taken. In order to confirm all the seeds have the same vitality, all the seeds used in this experiment were harvested at the mature time and stored in the room temperature for the same time (about 2 months).

Plasmid construction and transformation of tobacco plants

The coding sequence of SlGGP cDNA was amplified with primers Pf2 GGATCCTTCCGACCTCCTCTTCCTT (BamHI site underlined) and Pr2 GAGCTCATGAACACCAGAGCTGGG (SacI site underlined). The fragment was then subcloned into the rebuilt pBI121 vector with an upstream 35S-caulifower mosaic virus (35S-CaMV) to form the sense construct pBI–RVSlGGP. The sense expression plasmid pBI121–SlGGP was transformed into tobacco plants by Agrobacterium-mediated cotyledon infiltration. Disks infected with A. tumefaciens were incubated on the medium to induce shoot growth. The regenerated shoots were transferred to a root-inducing medium after a few weeks. Each medium contained 50 μg mL−1 kanamycin and 250 μg cm−2 sodium cefotaxime. Fifteen kanamycin-resistant lines transformed with SlGGP were obtained and designated as T0. Each transgenic line appeared to represent an independent integration event, because a specific DNA fragment in each line was observed by genomic DNA gel blot analysis. The transgenic tobacco plants (T0 generation) were self-pollinated using glassine envelopes to produce T1 seeds. The kanamycin-resistant T1 plants were grown on MS agar medium at 25 °C, 16 h photoperiod, and 600 μmol m−2 s−1 PFD. Two-week-old seedlings were transplanted into pots with soil and grown in the greenhouse.

Rt-pcr

Total RNA was isolated as described as total RNA isolation system (Tiangen, Beijing, China). The first-strand cDNAs were synthesized using First-Strand cDNA Synthesis kit (Fermentas, Glen Burnie, MD, USA). PCR amplifications were pre-denaturated at 94 °C for 5 min, 29 cycles of 94 °C for 1 min, 56 °C for 30 s and 72 °C for 40 s, followed by a final extension step at 72 °C for 10 min. Reaction products were separated on 1.0 % agarose gels. Primers were designed for PCR according to published sequences. The following primers were used: SlGGP, forward 5′-GAAGCAAGTGAGGAAGATG-3′ and reverse 5′-CTCCCAAACAGCAGGATTG-3′. actin, forward 5′-AGCAAGAGTTGGAGACTGC-3′ and reverse 5′-GACAATGGAAGGACCAGATT-3′.

Western blotting analysis

The coding region of SlGGP was integrated into the pET-30a (+) vector and transformed to E. coli. BL21 and then expression was induced with IPTG. Expression and purification of the recombined GGP protein was processed using Ni-NTA agarose system in accordance with the manufacturer instructions (Qiagen, Hilden, Germany). To prepare antiserum, the BALB/c mice (60–90 days old) were immunized by the purified recombined protein. Antiserum was then purified according to the 18-1037-46 Amersham Biosciences (Piscataway, NJ) antibody purification protocol to obtain the primary antibody. The antibody titer was determined by indirect ELISA. Secondary antibody was peroxidase-conjugated goat anti-mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA). The primary and secondary antibodies were used at 1:1,000 and 1:5,000 dilutions, respectively.

For immunoblotting, total plant proteins separated by SDS–PAGE were electrophoretically transferred to PVDF membranes (Millipore, Billerica, MA) and detected with antibody preparations. Protein content was determined by the dye-binding assay method of Bradford (1976).

Determination of reduced, oxidized and total AsA

WT and transgenic tobacco (8-weeks-old) were allowed to grow at 4 °C for 12 h. The control plants were grown at 25 °C. The contents of reduced AsA, oxidized AsA (DHA), and total AsA (AsA+DHA) were determined following the method described by Li et al. (2010).

GDP-l-galactose phosphorylase assays

The GGP activities were assayed by production of GDP from GDP-l-galactose as described by Dowdle et al. (2007) with little modification. The GDP-l-galactose was obtained from Carbosynth Ltd, UK. The GDP was obtained from Zhongsheng, China. Tobacco leaf tissue (0.5 g) was homogenized in 1-mL extraction buffer with 50 mM HEPES, pH 7.5, 10 mM MgCl2, 2 mM dithiothreitol, 1 mM aminocaproic acid, 1 mM benzamidine, 1 mM PMSF. The homogenate was centrifuged at 20,000g for 20 min. The supernatant was used for enzyme activity measurements. The following solutions were used: 20 μL of sample, 65 μL 50 mM Tris, pH 7.5, 3 mM MgCl2, 5 mM phosphate, and GDP-l-Gal (final concentration 115 M). This mixture was incubated for 180 min at 20 °C, then the reaction was stopped by boiling for 2 min. GDP produced of the reaction was detected by HPLC according to the method described by Linster et al. (2007) with little modification, the GGP activities were assayed by production of GDP and GDP were assayed by absorbance at 260 nm. Supernatants were filtered through a 0.45 μm membrane filter and then injected into a reversed-phase high performance liquid chromatography (HPLC) using a Shimadzu Series model SCL-10AVP (Japan) on an Accurasil ODS2 4.6–250 mm cartridge column (UA). Protein in the extracts was measured using Bradford Coomassie assay (Bradford 1976).

Measurement of relative electronic conductance (REC) and malondialdehyde (MDA) level

Twenty leaf disks (0.5 cm2 each) were placed in a cuvette containing 15 mL distilled water, vacuumized for 30 min, and then surged for 10 h to measure the initial electronic conductance (S1). The cuvette was heated in boiling water for 30 min and cooled to room temperature to determine the final electronic conductance (S2). REC was evaluated as REC = (S1/S2) × 100.

Malondialdehyde (MDA) content was determined by the thiobarbituric acid (TBA) method, as described by Hodges et al. (1999).

Measurement of chlorophyll content

Eight-week-old tobacco plants were treated for 12 h at 4 °C. Leaf disks (0.5 g) were homogenized in 5 ml of 80 % (v/v) acetone for 24 h, and the homogenate was centrifuged at 3,500g for 5 min. The absorbances of supernatant were recorded at 663 and 646 nm.

Histochemical detection of O •−2 and H2O2

Three-week-old seedlings of WT and transgenic tobacco plants grown on MS agar medium were used for histochemical detection. Plants were harvested at 0 and 12 h after 4 °C treatment. O •−2 was visually detected by the NBT method following the procedure described by Rao and Davis (1999). Seedlings were steeped in 0.5 mg mL−1 NBT (Sigma) supplied with 10 mM sodium phosphate buffer (pH 7.8) for 10 h. The seedlings were decolorized by boiling in acetic acid:glycerol:ethanol (1:1:4 [v/v/v]) solution to reveal the green color. The samples were photographed after cooling.

H2O2 was detected with pH 3.8, 1 mg mL−1DAB solution (Sigma) following the method described by Giacomelli et al. (2006). The seedlings were left into the solution for 10 h in the dark and then decolorized according to the above method.

Measurement of O •−2 and H2O2 concentration

The hydrogen peroxide (H2O2) concentration was measured according to the method as described by Sairam and Srivastava (2002). The assay for O •−2 was performed as described by Wang and Luo (1990).

Measurement of net photosynthetic rate and chlorophyll fluorescence

Plants were treated at 4 °C. The net photosynthetic rate (Pn) was measured with a portable photosynthetic system (CIRAS-2, PP Systems, Herts, UK) under the following conditions: ambient CO2 concentration, 360 μL L−1; PFD, 800 μmol m−2 s−1; and relative humidity, 80 %. Before Pn measurement, stomatal opening was induced by illuminating the plants with 200 μmol m−2 s−1 PFD at 25 °C for 30 min and then with 800 μmol m−2 s−1 PFD at 25 °C for 15 min to acclimatize.

Chlorophyll fluorescence was measured with a portable fluorometer (FMS2, Hansatech, Norfolk, UK) at 4 °C according to the method described by Van Kooten and Snel (1990). The minimum fluorescence (Fo) with all PSII reaction centers opened was determined in modulated light at approximately 10 μmol m−2 s−1, which was low enough to prevent inducing any significant variable fluorescence (Fv). The maximum fluorescence (Fm) with all the reaction centers closed was determined by 0.8 s saturated light of 7,000 μmol m−2 s−1 PFD on a dark-adapted (20 min in darkness) leaf. The maximum photochemical efficiency (Fv/Fm) of PSII was expressed as Fv/Fm = (Fm−Fo)/Fm.

Absorbance at 820 nm

The PSI redox status was investigated by determining the oxidation and reduction of P700 at 820 nm absorbance using a plant efficiency analyzer sensor (Hansatech, Norfolk, UK) as described by Schansker et al. (2003). The plants were treated at 4 °C with a low irradiance of 100 μmol m−2 s−1 PFD and were transferred to 25 °C for recovery. Electron transport chain was first reduced by a 1 s red light pulse of 1,800 μmol m−2 s−1 PFD (phase 1), subsequently oxidized by a 10 s far-red pulse of 200 μmol m−2 s−1 PFD (phase 2), and finally reduced again by a 2 s red light pulse (phase 3). The difference between the minimum and the maximum of phase 3 was used to determine the maximum reducible/oxidizable amplitude.

Measurement of APX activity

APX activity was measured by monitoring the decrease in absorbance at 290 nm following the procedure described by Kwon et al. (2002). One unit of APX activity is defined as the amount of enzyme that oxidizes 1 μmol AsA per minute.

Thylakoid membrane preparation

Thylakoid membranes were prepared according to the method of Zhang et al. (1999). The tobacco leaves were homogenized in an ice-cold isolation buffer containing 400 mM sucrose, 50 mM HEPES, pH 7.8, 10 mM NaCl, 2 mM EDTA and 2 mM MgCl2 and then filtered through three layers of pledget. The filtrate was then centrifuged at 5 000g for 10 min. The thylakoid pellets were washed with ice-cold isolation buffer, recentrifuged and finally suspended in the isolation buffer. The thylakoid membranes were stored at –80 °C before use.

SDS–PAGE and western blot analysis

Thylakoid membrane proteins were denatured and separated using 15 % polyacrylamide gradient gel that contained 6 M urea. Separated proteins were electroblotted to (polyvinylidene fluoride) PVDF membrane and then probed with polyclonal antibodies raised in rabbits against the full-length D1 protein. The secondary antibody was peroxidase-conjugated goat antirabbit IgG (Zhongshanjinqiao, Beijing, China). The D1 protein antibody (Jingtiancheng, Beijing, China) was used at a dilution of 1:500, and the secondary antibody was used at 1:1,000 dilutions. The western blot analysis of control and chilling stress was exposed same times.

Statistical analysis

Statistical analysis was conducted using DPS (date processing system) procedures (Zhejiang University, China). Differences between the means were compared using Tukey’s multiple range tests at 0.05 probability level.

Results

Identification of transgenic plants

The SlGGP gene (GenBank accession number: JQ517313) was isolated from tomato. SlGGP cDNA was found to comprise a 1,314-bp open reading frame that encodes for a protein of 438 amino acids (Wang et al. 2013). In the present study, 15 individual kanamycin-resistant transgenic lines (T0) of tobacco were obtained. The kanamycin-resistant T1 plants were verified by PCR. The upstream primer of PBI121 and the 3′ primer of the SlGGP gene were used in the amplification, and a 1,500-bp DNA fragment similar in size to the SlGGP product was obtained in each transgenic plant by PCR analysis. However, no PCR products were detected in the WT tobacco (data not shown). Three independent T1 lines showed higher SlGGP expression at the mRNA levels by RT-PCR (Fig. 1a) and protein levels by western blot analyses (Fig. 1b). These three lines of SlGGP transgenic plants were selected for further analysis.

Fig. 1
figure 1

Analysis of SlGGP in transgenic plants and overexpression of SlGGP transgenic plants enhanced chilling tolerance in young seedlings. a RT-PCR analysis of SlGGP in WT and transgenic plants. Actin is 440 bP and SlGGP is 454bP b western blot analysis of SlGGP in WT and transgenic plants. The SlGGP is about 44 kDa and the Rubisco is about 50 kDa. The same proteins were separated by SDS–PAGE and then stained with Coomassie brilliant blue R250 as a loading control for the western blotting. c WT and transgenic tobacco seed germination rate under low-temperature stress (4 °C). The seeds were incubated for 10 days at 4 °C, and subsequent recovery at 25/20 °C (day/night) for 15 days before the photographs were taken. d NBT staining for O •−2 in leaves of WT and transgenic tobacco plants under normal conditions and after 12-h low-temperature treatment. e DAB staining for H2O2 of WT and transgenic tobacco plants under normal conditions and low temperature. f O •−2 content in tobacco plants. g H2O2 content in tobacco plants. The experiments were repeated at least three times with similar results. Different letters indicate statistically significant differences at P ≤ 0.05. The bar in c represents 1 cm. The bar in d and e represents 0.5 cm

Full size image

SlGGP overexpression enhanced tolerance to chilling stress

The SlGGP-overexpressing lines did not show significant differences in vegetative or reproductive growth under normal conditions. The germination frequencies of the seeds from transgenic lines 1 (T1-1), 3 (T1-3), and 15 (T1-15) were 90, 91, and 93 %, respectively, after incubation at 4 °C for 10 days and recovery at 25/20 °C (day/night) for 15 days, by contrast, the germination frequency of WT seeds was only approximately 50 % (Fig. 1c) under the same condition.

DAB staining revealed that the WT and transgenic plants exhibited low H2O2 accumulation under normal conditions with no significant differences (Fig. 1e). The brown polymerization product of H2O2 accumulation increased after 12-h treatment (Fig. 1e), and the brown color was less intense in the transgenic plants than in WT plants, especially T1-1 (Fig. 1e). NBT staining showed that slight blue marks emerged in the leaves of both WT and transgenic plants under normal conditions (Fig. 1d). The blue polymerization product of O •−2 accumulation increased in both WT and transgenic plants subjected to chilling stress; however, the staining was less intense in the transgenic leaves than in WT leaves, especially in T1-1and T1-15 lines (Fig. 1d). Quantitative analysis of O •−2 and H2O2 confirmed the observation (Fig. 1f, g). These results indicated that chilling treatment increased H2O2 and O •−2 contents and that SlGGP overexpression reduced ROS production in tobacco plants.

The chilling stress tolerance of transgenic plants was also determined by examining the growth of the grown plants (about 8-week-old). Under normal conditions, there were no significant difference in WT and transgenic plants (Fig. 2e). After treatment at 4 °C for 12 h, the old leaves of all plants were obviously withered, but the mature leaves of WT plants were more withered compared with transgenic plants. These results indicated that the SlGGP-overexpressing plants exhibited higher chilling tolerance than WT plants. It is also be proved by the levels of REC, MDA and chlorophyll contents. No difference in REC was observed between the WT and transgenic plants under normal conditions; however, the REC of T1-1, T1-3, and T1-15 was lower than that of WT after treatment at 4 °C for 12 h (Fig. 2a). The amount of malondialdehyde (MDA) was commonly used as an indicator of membrane lipid peroxidation. After 4 °C treatment for 12 h, the MDA level was significantly lower in GGP-overexpressing plants compared with WT plants (Fig. 2b). After chilling stress for 12 h, there was obviously a decrease in the contents of chlorophyll in both WT and transgenic plants (Fig. 2d). The decrease in WT plants was much greater than that in transgenic plants.

Fig. 2
figure 2

The effect of overexpression of SlGGP on REC, MDA content, GDP-l-galactose phosphorylase activity, chlorophyll contents and plant growth in tobacco leaves under chilling tolerance. a Changes of REC in tobacco leaves under low temperature (4 °C) for 12 h. b Changes of MDA in tobacco leave under low temperature (4 °C) for 12 h. c GDP-l-galactose phosphorylase activity in WT and transgenic tobacco leaves under low temperature (4 °C) for 12 h. d Chlorophyll contents in WT and transgenic tobacco leaves under low temperature (4 °C) for 12 h. e Plant growth of WT and transgenic tobacco leaves under low temperature (4 °C) for 12 h. Data are expressed as mean values ±SD (n = 5, five measurements on each of the five plants). Different letters indicate statistically significant differences at P ≤ 0.05. The bar in e represents 8 cm

Full size image

SlGGP overexpression increased GGP activity

We then examined the GGP activities of transgenic and WT plants. As shown in Fig. 2c, T1-1, T1-3 and T1-15 exhibited about 1.5-fold increased GGP activity under normal conditions. The GGP activities of WT and transgenic plants increased markedly under 4 °C stress, and the activities were higher in the transgenic plants than in WT plants (Fig. 3c).

Fig. 3
figure 3

Content of AsA (a), total AsA (b), DHA (c), and the redox status of AsA/DHA (d) in transgenic and WT plants under chilling stress. Data are expressed as mean values ±SD (n = 5, five measurements on each of the five plants). Different letters indicate statistically significant differences at P ≤ 0.05

Full size image

Measurement of AsA content in transgenic tobacco

The function of GGP was further analyzed by measuring the amount of reduced AsA, DHA, total AsA, and AsA/DHA in the leaves of the WT plants and selected T1 transgenic lines. The levels of reduced AsA increased by 1.31-, 1.41-, and 1.43-fold in the youngest fully expanded young leaves of T1-1, T1-3, and T1-15, respectively, compared with that of the WT plants (Fig. 3). These results indicated that SlGGP overexpression increased the AsA content in the transgenic plants. The levels of AsA and AsA/DHA increased in the transgenic and WT plants under chilling stress, and the ratio of AsA/DHA was slightly higher in the transgenic plants than in the WT plants (Fig. 3).

Activities of APX enzymes under chilling stress

The APX activity was evidently higher in the most transgenic plants (T1-1 and T1-3) than in WT plants under normal growth conditions (Fig. 4). APX activities decreased in both WT and transgenic plants exposed to chilling temperature for 12 h. The APX activities in T1-1, T1-3, and T1-15 were 16.54, 21.90, and 14.96 µmol g−1 FW min−1, respectively, whereas that in the WT plants was only 12.74 µmol g−1 FW min−1.

Fig. 4
figure 4

Activity of APX in transgenic and WT plants under chilling stress. The data presented are expressed as mean values ±SD of five individual experiments. Different letters indicate statistically significant differences at P ≤ 0.05

Full size image

Effect of chilling stress on Pn, Fv/Fm, and P700 in WT and transgenic plants

The sensitivity of the WT and transgenic plant seedlings to chilling stress was assessed by measuring their Pn and Fv/Fm. No significant differences in Pn were observed between the WT and transgenic plants under normal growth conditions (Fig. 5a). Pn markedly decreased in both WT and transgenic plants after treatment at 4 °C; however, the decrease was more obvious in the WT plants than in the transgenic plants. Fv/Fm analysis showed a similar trend (Fig. 5b).

Fig. 5
figure 5

Effect of chilling stress on Pn (a), Fv/Fm (b) in WT and transgenic plants. Plants were treated at 4 °C. Before Pn measurement, plants were kept at 25 °C and at the PFD of 200 µmol m−2 s−1 about 30 min to induce stomata opening, and then illuminated at the PFD of 800 µmol m−2 s−1 about 15 min (a). During chilling stress, plants were adapted in darkness for 20 min before Fv/Fm measurement and then Fv/Fm was measured at 4 °C, and then recovery for 3 and 6 h at 25 °C. R3 and R6 mean recovery for 3 and 6 h (b). The data presented are the mean values ±SD of five individual experiments. Different letters indicate statistically significant differences at P ≤ 0.05

Full size image

The oxidizable P700 decreased evidently in both WT and transgenic plants under chilling stress; however, the decrease rate was faster in the WT plants than in the transgenic plants (Fig. 6). The recovery of oxidizable P700 was significantly delayed in the WT plants after being transferred to a suitable condition.

Fig. 6
figure 6

Effect of chilling stress on oxidizable P700 in WT and transgenic plants. The oxidizable P700 was measured during chilling stress (4 °C) and recovery for 3 and 6 h (25 °C). R3 and R6 mean recovery at 25 °C for 3 and 6 h. The data presented are the mean values ±SD of five individual experiments. Different letters indicate statistically significant differences at P ≤ 0.05

Full size image

Effects of chilling stress on D1 protein content

D1 protein is one of the key proteins in the PSII reaction center complex turnover, and it usually represents the degree of photoinhibition. The effect of chilling stress on the levels of D1 protein was determined by western blot analysis. Results showed that the D1 protein content in both WT and transgenic plants decreased after 12 h chilling stress; however, the decrease was significantly less in the transgenic plants than in the WT plants (Fig. 7).

Fig. 7
figure 7

Western blot analysis of D1 protein in WT and transgenic plants before and after chilling treatment (4 °C) for 12 h. Thylakoid membrane proteins were separated by SDS–PAGE and then probed with D1 antibody. The estimated molecular weight of D1 protein is 32 kD. As a loading control, the same thylakoid membrane proteins were separated by SDS–PAGE and then stained with Coomassie brilliant blue R250 (color figure online)

Full size image

Discussion

The tomato SlGGP cDNA was cloned and characterized in our previous study (Wang et al. 2013). The amino acid sequence analysis using DNAMAN software (Lynnon Biosoft, America), a software for molecular biology applications, showed that the SlGGP protein had a high identity with other members of the GGP family.

In the present study, a gene containing the tomato SlGGP cDNA in the sense orientation under the control of the 35S-CaMV promoter was transformed to tobacco plants. The stronger positive signals of RT-PCR and western blot in the transgenic plants compared with that in the WT plants (Fig. 1a, b) indicated that SlGGP was successfully introduced into the tobacco genome and was overexpressed at the RNA and protein levels.

The role of GGP in AsA biosynthesis was clearly established by several studies. The Arabidopsis vtc2 mutant that encodes for GGP has lower AsA content than its WT counterpart (Linster et al. 2007). GGP genes may be a key rate-limiting step for AsA biosynthesis in Arabidopsis (Bulley et al. 2009), tobacco (Laing et al. 2007), and tomato (Zhang et al. 2010). The expression of tomato GGP is correlated with AsA accumulation in all tomato tissues (Wang et al. 2013). In the present study, the transgenic tobacco showed a significant increase in GGP activities (Fig. 2c), increased AsA content and AsA/DHA ratio compared with the WT plants (Fig. 3). This result indicated that SlGGP overexpression may increase the AsA content, which is consistent with previous studies (Bulley et al. 2012). The AsA/DHA ratio increased more substantially in the transgenic plants than in the WT plants after exposure to chilling stress. As a result, the transgenic plants had higher tolerance to chilling stress. The SlGGP-overexpressing lines showed higher tolerance to chilling stress than the WT plants, as shown by the germination rate (Fig. 1c). The transgenic plants also showed less accumulation of O •−2 and H2O2 (Fig. 1d, e, f and g), lower electrolyte leakage, lower MDA content and chlorophyll content, strong plant growth (Fig. 2a, b, d, e) than WT plants under chilling stress. The present results of GGP overexpression through the stable transformation in tobacco leaves confirmed the hypothesis that the SlGGP gene catalyzes an important control point of AsA biosynthesis through the l-galactose pathway and that GGP protects plants against chilling stress by maintaining the AsA pool and the AsA redox state in tobacco plants.

It is clear that APX utilizes ascorbic acid and its specific electron to reduce H2O2 to water in plants. In the present, the activity of APX was much higher in transgenic plants than that in WT plants even under normal condition (Fig. 4), which is consistent with the previous findings that overexpression of GMPase (GDP-mannose pyrophosphorylase), another predicted key enzyme in ascorbate synthesis, increased the APX activity of transgenic plants (Wang et al. 2011). However, the mechanism that overexpression of SIGGP can affect the activity of APX still needs to be researched. Under normal condition, WT plants and transgenic plants contain sufficient amount of AsA which is to clear off most ROS arising. However, under chilling stresses, the activity of APX decreased in WT and transgenic plants while the APX activity in transgenic lines was higher than that in WT plants, indicating that the regeneration of AsA might be sufficient to keep APX activity.

D1 protein is the primary target for photodamage in the PSII complex of plants suffering from photoinhibition (Andersson and Aro 2001; Pokorska et al. 2009). Substantial ROS accumulation is expected under chilling stress. The accelerated ROS generation under environmental stresses can enhance the extent of photoinhibition by inactivating the elongation factor of D1 protein and inhibiting the repair of PSII; moreover, the extent of photoinhibition in vivo depends on the balance between photodamage and repair rates (Yang et al. 2007). In the present study, western blot analysis revealed that the D1 protein of both WT and transgenic plants was markedly decreased under stress conditions; however, the decrease was more evident in the WT plants than in the transgenic plants (Fig. 7). Such result is not surprising because SlGGP overexpression increases AsA content and reduces ROS accumulation in transgenic plants (Figs. 2, 3). AsA can alleviate the photoinhibition of PSII not only by donating electron to violaxanthin de-epoxidase to dissipate excess excitation energy, but also by providing electron to APX for the detoxification of H2O2 in the chloroplast. AsA also donates electrons to PSII in the thylakoids to protect the complex from photoinhibition when electron donation from water is disturbed by heat stress (Mano et al. 1997). The decrease in D1 protein may be accounted for by the inhibition of PSII activity and also by the observed decline in Fv/Fm during chilling stress. Zhang and Scheller (2004) reported that the damage of PSI under chilling temperature stress is due to the hydroxyl radicals produced from the Fenton-type reaction between photogenerated H2O2 and Fe–S centers in PSI. H2O2 is critical to PSI photodamage during chilling stress (Terashima et al. 1998). In the present study, the oxidizable P700 significantly decreased in both transgenic and WT plants under chilling stress; however, the decrease rate was faster in the WT plants than in the transgenic plants (Fig. 6). This phenomenon may be attributed to the higher level of APX activity in the transgenic plants, which resulted in a more efficient H2O2 detoxification and a decreased photodamage to PSI compared with those in the WT plants (Fig. 4).

In summary, SlGGP overexpression in tobacco elevated the AsA levels and the enhanced plant tolerance to chilling-induced oxidative stresses. The efficient regeneration of AsA removed ROS and protected the photosynthetic apparatus by alleviating the photoinhibition of the two photosystems under chilling stress.