Introduction

The past three decades witnesses the successfully commercial application of biomining to extract copper, uranium, and gold from flotation concentrates and low-grade sulfide ores employing microbial consortia consists with chemolithoautotrophic and mixotrophic acidophiles [5, 37, 38]. The ferrous iron oxidation catalyzed by these iron-oxidizing acidophiles plays a pivotal role in providing energy for their proliferation [29], and offering the resultant ferric iron for the dissolution of metals from sulfide minerals via the ‘indirect mechanism’ [2, 32, 36]. With the dissolution of target metals, the ferric iron is converted simultaneously to ferrous iron. Thus, the iron-oxidizing acidophiles involve in the regeneration of ferric iron, the major bioleaching oxidant, throughout the bioleaching process [33]. Therefore, a complete understanding of the molecular mechanisms underlying their ferrous iron oxidation abilities is fundamental to improve their bioleaching capacities through metabolic engineering in the future. Recently, several species-specific pathways for the ferrous iron oxidation of bioleaching acidophiles have been hypothesized primarily based on their genome sequences except for the Acidithiobacillus ferrooxidans [8, 18].

A. ferrooxidans, an obligate chemolithoautotrophic mesophile with an optimal growth temperature of 30 °C, derives energy for cellular metabolism via the oxidation of ferrous iron and reduced inorganic sulfur compounds (RISCs). Recent studies have shown that the metalloproteins encoded by the rus and pet I operons participates in ferrous iron oxidation in A. ferrooxidans [6, 29]. The biochemical properties of the rus operon encoded metalloproteins (Cyc2, Cyc1, AcoP, CoxB, CoxA, CoxC, CoxD, and Rus) have been extensively characterized in recent years [7, 9, 22, 28, 30]. Cyc2, a high-molecular-weight cytochrome c locates in the outer membrane, carries out the first step of Fe2+ oxidation [41]. Then, the electron derives through Cyc2 is transferred to Rus, a copper-binding redox protein, which locates at periplasm. Rus is the branch point of the ferrous iron oxidation pathways: (1) Most of the electron follows a ‘downhill’ pathway through Cyc1, a c4-type cytochrome c552 locates at periplasm [22], to reach its final electron acceptor cytochrome c oxidase that locates at cytoplasm membrane, for the ATP generation [29]. (2) Meanwhile, some of the electron follows the ‘uphill’ pathway through CycA1 (AFE_3107), a double-heme-binding metalloproteins in periplasm, to reach the cytoplasm membrane-bound bc 1 complex, then finally reaches the Complex I via the quinone pool for reducing NAD+ to NADH [29]. AcoP, a copper-binding protein in periplasm [30], stabilizes cytochrome c oxidase and protects its copper center from acidic environment [7].

A recent study has shown that the Fe2+-oxidizing Acidithiobacillus species are phylogenetically divided into four monophyletic groups that each probably uses different iron oxidation pathways [3]. Three cytochromes c (Cyc2, Cyc1, and CycA1) are believed to participate in ferrous iron oxidation via these proposed pathways [3]. However, the structures and functions of other cytochromes c encoded in the genome of these Acidithiobacillus species are still unclear. Since cytochromes c generally function as electron carriers involving in energy-transducing processes [31], the possibilities of other cytochromes c to be involved in ferrous iron oxidation can not be excluded.

The aim of this study was to screen novel cytochromes c that probably involved in ferrous iron oxidation in A. ferrooxidans ssp. by bioinformatic analysis. A novel highly conserved gene cluster encoding two cytochromes c was first identified in the genome of A. ferrooxidans ssp. The transcriptional levels of these two genes in the presence of ferrous iron or sulfur as the sole energy substrate were compared. Bioinformatic analysis together with transcriptional study showed that these two cytochrome c encoded by this novel gene cluster was the respective paralog of Cyc2 and Cyc1. The physiological roles of these two cytochromes c were first proposed. This study provides novel insights into the ferrous iron oxidation mechanism in A. ferrooxidans species, and shed lights into characterization the gene expression regulation, structure, and biochemical properties of these cytochromes regarding on this novel gene cluster in the future.

Materials and Methods

Bacterial Strain and Growth Medium

A. ferrooxidans ATCC 23270 was obtained from American Type Culture Collection.

The composition of iron-free 9K medium was (NH4)2SO4 (3 g/L), K2HPO4 (0.5 g/L), MgSO4·7H2O (0.5 g/L), KCl (0.1 g/L), Ca (NO3)2 (0.01 g/L). FeSO4·7H2O (50, 100 or 200 mM) or sulfur powder (10 g/L) was added to the iron-free 9K medium respectively as the sole energy substrate. The initial pH of these growth media were adjusted to 2.0 using 5 mol/L H2SO4. A. ferrooxidans ATCC 23270 was aerobically cultured in an air-bath incubator at 30 °C with a shaking speed of 170 rpm.

Bioinformatics Analysis

The following programs or webservers were employed to analyze the gene structure and the encoded proteins of the tce gene cluster: SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/) for signal peptide prediction [26]; TMHMM server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) [19] and TMpred Server (http://www.ch.embnet.org/software/TMPRED_form.html) [13] for transmembrane regions prediction. The secondary structure of AFE_1428 was predicted by the PSIPRED protein structure prediction server [23]. Multiple sequence alignment of these proteins with their corresponding homologs was conducted using BioEdit [10]. Promoters ahead of this gene cluster were predicted by using Berkeley Drosophila Genome Project (http://www.fruitfly.org/seq_tools/promoter.html). The three-dimensional structure of AFE_1429 was simulated by the online server Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) [15], using the crystal structure of Cyc1 (PDB: 1H1O) from A. ferrooxidans ATCC 23270 as template [1]. This simulated structure was viewed and superimposed with the Cyc1 using the Chimera package [27].

RNA Preparation, cDNA Synthesis

The A. ferrooxidans ATCC 23270 culture grown in iron-free 9K medium with sulfur (10 g/L) as the sole energy substrate was repeatedly sub-cultured to fresh medium for a total of three times. Culture in middle-logarithmic phase was then sub-cultured to fresh iron-free 9K medium with ferrous iron (50, 100, or 200 mM) or sulfur (10 g/L) as the sole energy substrate, respectively. These cultures were harvested respectively by filtering through filter paper, and then centrifuged for 10 min at 10,000 rpm when they reached the middle-logarithmic phase. Cell pellets were suspended with autoclaved 9K medium (pH 2.0) and collected by centrifugation for 10 min at 10,000 rpm. Total cellular RNA was isolated using TRIZOL® reagent (Invitrogen). The extracted RNA samples were treated by addition of 1 U of DNase I (Fermentas) to remove DNA at room temperature for 15 min, then purified by using RNeasy kit (QIAGEN). The purity of these purified RNA samples was validated by setting up regular PCR amplification with gene-specific primer pairs and then electrophoresis in 2% (wt/vol) agarose gel. The complementary DNA (cDNA) was synthesized using ReverTra Ace-α-® cDNA synthesis kit (TOYOBO) with random ennea-nucleotide primers according to the manufacturer’s instructions.

Co-transcription Analysis

The cDNA that was synthesized from the RNA extracted from cultures grown in the presence of ferrous iron (100 mM) was amplified by the following primer pair: F28: 5′TCGCGGGCTGACGAACAGTACG3′; R29: 5′TCATGCATGACTGATGGAC AGA3′. The fragment amplified by primer pair F28 and R29 covered partial regions (241 bp) of AFE_1248 and AFE_1429.

Quantitative Reverse Transcription PCR (qRT-PCR) Analysis of AFE_1428 and AFE_1429

The primer pairs for these reference genes were designed using the software Primer Premier 5 and validated by electrophoresis in 2% (wt/vol) agarose gel (Table S1). The gene sequences of AFE_1428 and AFE_1429 were aligned with their corresponding paralog genes cyc2 and cyc1 to figure out the divergent regions between paralog genes. A couple of primer pairs were originally designed for AFE_1428, AFE_1429, cyc2 and cyc1 based on their divergent regions, then validated by PCR amplification of target fragment from the genomic DNA of A. ferrooxidans ATCC 23270 and electrophoresis on 2% (wt/vol) agarose gel. The primer pair without unspecific amplification for each gene was selected for the following qRT-PCR experiment (Table S1).

Each real-time PCR mixture (total volume 25 µL) contained 12.5 µL of SYBR® Green Real-time PCR Master Mix (Toyobo Co., LTD., Osaka, Japan), 1 µL of a 10 µM forward and 1 µL of a 10 µM reverse primer, 1 µL of cDNA template, and 9.5 µL of nuclease-free water. The real-time PCR was carried out with the iCycler iQ Real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA): 1 cycle of 95 °C for 3 min; and then 40 cycles of 95 °C for 40 s, 60 °C for 20 s, and 72 °C for 25 s. At the completion of each run, melting curves for the amplicons were measured by raising the temperature in increments of 0.5 °C from 60 to 95 °C while monitoring fluorescence. The ∆∆Ct-based method (GeNorm software) was employed to normalize the expression of these genes (AFE_1428, AFE_1429, cyc2, and cyc1) by relating their Ct values of samples grown in the presence of different concentrations of ferrous iron as sole energy substrate to the control sample grown in the presence of sulfur (10 g/L) and to the Ct value of these three reference genes (AFE_RS01820, AFE_1401, and AFE_0925) in both samples [24]. In order to recognize the change trend easily, we set the expression level of each target gene in the presence of sulfur (10 g/L) as one.

Comparative Genomic Analysis of the tce Gene Cluster in A. ferrooxidans ssp.

The amino acid sequence of AFE_1428 from A. ferrooxidans ATCC 23270 was used as the initial query for a BlastP search with these Acidithiobacillus spp. at the database of National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). The BLASTP hits with a sequence identity >60% were explored further: their gene sequences, the flanking nucleotide sequences (around 5 kb), and the gene annotation information were downloaded in GenBank format for analysis.

Phylogenetic Analysis of tce Gene Cluster Containing A. ferrooxidans ssp.

Phylogenetic analysis of these isolated Fe2+-oxidizing Acidithiobacillus species including the strains that containing the tce gene cluster was conducted using MEGA 5.2 with maximum-likelihood method [35]. Bootstrap values of 1000 replicates were calculated. The phylogenetic marker adopted for analysis was 16S rRNA gene. Two closely related yet deficient in Fe2+-oxidizing species (Acidithiobacillus albertensis DSM 14366 and Acidithiobacillus thiooxidans ATCC 19377) were selected as the outgroup.

Results

Bioinformatics Analysis

The gene structure and the proteins encoded of the tce gene cluster were characterized by various bioinformatics methods. AFE_1428 and AFE_1429 located on the same strand in chromosome. Both AFE_1428 and AFE_1429 contained a signal peptide at the N-terminal. In addition, no cytoplasm-membrane-spanning region was found in either AFE_1428 or AFE_1429.

The mature protein of AFE_1428 contained 446 amino acid residues and showed 64% in identity (and 77% in similarity) to its paralog Cyc2. A typical C–A–T–C–H heme-binding motif (residues 12–16) was found in AFE_1428 (Fig. 1). AFE_1428 also showed high identity (61%) to the Cyc2 (Acife_1872) from A. ferrivorans SS3. The mature protein of AFE_1429 contained 177 amino acid residues and showed 55% in identity (69% in similarity) to its paralog Cyc1 (Fig. 2). The holoprotein of AFE_1429 was a diheme-containing cytochrome since its primary protein sequence contained two probable heme-binding motifs. In previous studies, the three-dimensional structure and function of Cyc1 were characterized in details [1, 22], which providing insights into the structural and functional characteristics of AFE_1429. Sequence alignment showed that the amino acid residues directly involved in coordinating heme prothetic groups in Cyc1 were also conserved in AFE_1429 (Fig. 2) [1, 22]. The cysteine and histidine residues in the C–M–I–C–H motif (residues 10–14), Pro27, Leu29, and Met58 probably interacted with heme B; the cysteine and histidine residues in the C–M–A–C–H motif (residues 112–116) together with the Pro127, Leu129, Leu141, and Met154 probably interacted with heme A in AFE_1429. The amino acid residues (Gln32, Tyr36, Gln40, Arg49, Gln132, Tyr136, Arg149) were likely to be participated in hydrogen bonding in the vicinity of heme A and heme B in Cyc1 were also highly conserved in AFE_1429 [1, 22]. The structural roles of these amino acid residues that involved in coordinating or interacting with heme prothetic groups were confirmed by comparison the simulated structure of AFE_1429 with the crystal structure of Cyc1 (PDB: 1H1O) from A. ferrooxidans ATCC 23270 (Fig. S1). The modeled structure of AFE_1429 showed high resemblance to its paralog Cyc1, which mainly consisted of α-helix and random coil. The quality of modeled structure of AFE_1429 was evaluated by analyzing the Ramachandran plot (Fig. S2). Ramachandran plot indicated that 86 and 12.67% amino acid residues were in the most favored and additionally allowed regions, respectively, when excluding glycine and proline residues. Thus, the modeled structure of AFE_1429 should be reliable.

Fig. 1
figure 1

Sequence alignment of AFE_1428 with the paralogs Cyc2 from A. ferrooxidans ATCC 23270 and Acife_1872 from A. ferrivorans SS3. The probable heme-binding motif is labeled with underline

Full size image
Fig. 2
figure 2

Sequence alignment of AFE_1429 with the paralogs Cyc1 and CycA1 in A. ferrooxidans ATCC 23270. The classic heme-binding motifs are labeled with underline, the amino acid residues covalently binding heme B are indicated by filled triangles, the amino acid residues covalently binding heme A are indicated by open triangle. Amino acid residues engage in hydrogen bonds surrounding these heme prothetic groups are indicated by open cycles. The amino acid residues involves in interacting with Cox II subunit of cytochrome c oxidase are indicated by open stars, with the key amino acid residue Tyr57 is labeled with filled star. The Glu121 in Cyc1 is indicated with filled rhombus

Full size image

Co-transcription and qRT-PCR Analysis of tce Gene Cluster

The AFE_1428 and AFE_1429 were co-transcribed in the presence of ferrous iron as the sole energy substrate (Fig. S3). No amplification was observed from the DNA-depleted RNA sample extracted from culture grown with ferrous iron as the sole energy substrate, thus exclude the possibility of genomic DNA contamination in the following reverse transcribe cDNA sample. A single band was amplified from the cDNA, with a comparable fragment size to that amplified from the genomic DNA of A. ferrooxidans ATCC 23270 (Fig. S3).

The standard curve, equation, and amplification efficiency for each gene-specific primer pair used for qRT-PCR were analyzed (Fig. S4). The amplification efficiency ranged from 90.4 to 112.1%. Three genes (AFE_RS01820, AFE_1401, and AFE_0925) were selected as the reference for normalization in the qRT-PCR analysis in this study. Previous study has evaluated that these genes have the most stable expression levels under 5 different growth conditions that frequently adopted for A. ferrooxidans strains [24]. The using of multiple stable reference gene indicated that the normalized expression levels of target genes were more accurate. The qRT-PCR data indicated that the transcriptional levels of both AFE_1428 and AFE_1429 were significantly up-regulated in ferrous iron grown culture as compared with that in sulfur-grown culture (Fig. 3). AFE_1428 and AFE_1429 were up-regulated by 4.16 ± 1.37 and 4.81 ± 1.44-fold, respectively, in the presence of 50 mM ferrous iron. And 8.15 ± 2.09 and 19.26 ± 2.12-fold up-regulation were observed for AFE_1428 and AFE_1429, respectively, with 100 mM ferrous iron. The transcriptional levels of AFE_1428 and AFE_1429 decreased to 2.80 ± 1.53 and 3.83 ± 1.44, respectively, in the presence of 200 mM ferrous iron. In this study, no significant up-regulation was observed for the expression of cyc2 and cyc1 in the presence of 50 mM ferrous iron (Fig. 3). While, cyc2 and cyc1 were up-regulated by 8.23 ± 1.07 and 6.96 ± 1.17-fold, respectively, in the presence of 100 mM ferrous iron, which were comparable with the observation that showed in a previous study in the presence of 3.5% (wt/vol) FeSO4 [40]. The transcriptional levels of cyc2 (AFE_3153) and cyc1 (AFE_3152) decreased to 1.86 ± 0.84 and 0.83 ± 0.31, respectively, in the presence of 200 mM ferrous iron. The decrease of tce gene cluster together with cyc2 and cyc1 in the presence of 200 mM ferrous iron might be ascribed to the osmotic stress exerted by the large quantity of ferrous sulfate added.

Fig. 3
figure 3

Relative expression levels of AFE_1428, AFE_1429, cyc2 (AFE_3153), and cyc1(AFE_3152) in the presence of 50, 100, or 200 mM Fe2+ as the sole energy substrate versus that of sulfur (10 g/L)

Full size image

Comparative Genomic Analysis of the tce Gene Cluster in A. ferrooxidans ssp.

Comparative genomic analysis of the A. ferrooxidans strains with genome sequences available showed that the tce gene cluster was highly conserved (with identical sequence of ORFs and the intergenic region upstream of ORFs) in the following four phylogenetic-related strains that were originally isolated from different sites with huge geographical distance (several thousands of kilometers) (Fig. S5): A. ferrooxidans ATCC23270 [11]; A. ferrooxidans ATCC 53993 [12]; A. ferrooxidans Hel 18 [16]; and A. ferrooxidans YQH-1 [39].

Phylogenetic Analysis of tce Gene Cluster Containing A. ferrooxidans ssp.

Phylogenetic analysis showed that all these above-mentioned four A. ferrooxidans strains containing the tce gene cluster were sorted into the group I, while these two A. ferrivorans strains belonged to the group III based on their 16S rRNA gene sequences (Fig. 4) [3].

Fig. 4
figure 4

Phylogenetic tree of Fe2+-oxidizing Acidithiobacillus species based on their 16S rRNA genes (strains containing tce gene cluster were labeled with filled triangle)

Full size image

Discussion

Bioinformatics Analysis of tce Gene Cluster

The tce gene cluster consisted with two genes encoding a high-molecular-weight cytochrome c (AFE_1428) and a c4-type cytochrome c552 (AFE_1429) was identified in A. ferrooxidans ATCC 23270. To our best knowledge, this gene cluster has not been reported yet.

AFE_1428 and AFE_1429 were paralogous to the Cyc2 and Cyc1 respectively that encoded by the extensively studied rus operon. These two ORFs were likely to be co-transcribed as there was only 14 nucleotide intergenic region between them. Three putative promoters were identified upstream of the AFE_1428. Previous study showed that the ORFs of cyc2 and cyc1 genes in A. ferrooxidans ATCC 33020 also located at the same strand with a 11 nt nucleotides intergenic region between [4]. Two promoters upstream of cyc2 were identified [4]. Reverse transcription PCR experiments showed that the cyc2 and cyc1 genes were co-transcribed from different promoters depending on the available energy substrate in growth medium was ferrous iron or sulfur [4]. The Fis-like protein was suggested to be involved in the regulation of rus operon in A. ferrooxidans ATCC 23270 in the presence of sulfur [40]. Previous study showed that the RegBA (AFE_3136 and AFE_3137), a sensor/regulator two-component system, was likely participated in regulating the preferential expression of rus operon in the presence of Fe2+ than sulfur through this regulatory region that upstream of cyc2 [28]. Thus, it is reasonable to postulate that the expression of AFE_1428 and AFE_1429 may be regulated similarly through a versatile mechanisms towards the stimulation of different energy substrates, i.e., Fe2+ or RISCs. The nucleotide sequence of the tce gene cluster showed fairly high identity (66%) to that of cyc2 and cyc1 genes, which indicated that it might be occurred by duplication in evolution.

AFE_1428 and AFE_1429 were likely to be translocated at the outer membrane and periplasm like their corresponding paralogs, Cyc2 and Cyc1, respectively [4, 41]. The secondary structure of AFE_1428 was predicted to be mainly composed of β-sheets, which was characteristic for many outer membrane proteins [17]. These evidences indicate that AFE_1428 is likely to be translocated at the outer membrane of A. ferrooxidans ATCC 23270 and directly catalyzes ferrous iron oxidation as the paralog Cyc2 [6, 41].

The Glu121 in Cyc1, a surface-exposed glutamic residue located closely to heme A, was directly involved in the interaction with rusticyanin (Rus) [22]. However, this Glu residue in Cyc1 was substituted by an Ala at the corresponding site in AFE_1429 and the CycA1 (AFE_3107), a diheme cytochrome c, which interacted with the bc1 complex in the ‘uphill’ electron pathway of the Fe2+ oxidation (Fig. 2) [29]. Therefore, different mechanisms might exist regarding on the electron transfer from rusticyanin to AFE_1429 and CycA1. Considering the high similarity for the overall structures of AFE_1429 and Cyc1, it is possible that the substitution by Ala in AFE_1429 may be resulted from the mutation occurred in the ancestral strain during evolution. It is appealing to figure out the key amino acid residues in AFE_1429 that directly involves in transferring the electron from rusticyanin in the future study. Previous study showed that the Tyr63, an amino acid residue located in the hydrophobic area surrounding heme B, played a pivotal role in the electron transfer between Cyc1 and cytochrome c oxidase [22]. Molecular docking simulation indicated that Val12, Tyr29, Ile62, Tyr63, and Pro66 potentially engaged in interacting with the Cox II subunit of cytochrome c oxidase [22]. All these residues were highly conserved in the AFE_1429 (Val6, Tyr23, Ile56, Tyr57, Pro60), while they were not conserved in CycA1 (Fig. 2). Therefore, it is rational to postulate that AFE_1429 mediates the electron transfer to cytochrome c oxidase in the same way as Cyc1 [22].

Co-transcription and qRT-PCR Analysis of tce Gene Cluster

The co-transcription of AFE_1428 and AFE_1429 suggests that they involved in the same biological pathway. Bioinformatics analysis indicated that both AFE_1428 and AFE_1429 participated in the ferrous iron oxidation like their paralogs Cyc2 and Cyc1. Previous study indicated that the rus and petI operons which directly involved in the ferrous iron in A. ferrooxidans ATCC 23270 were preferentially expressed in the presence of ferrous iron compared with that operons directly engaged in sulfur oxidation [28]. The transcription profile of the tce gene cluster in the presence of ferrous iron or sulfur would provide insights into the physiological functions of the metalloproteins it encoded. The significantly up-regulated transcription levels of AFE_1428 and AFE_1429 in ferrous iron grown culture suggests that these two cytochromes c participated in ferrous iron oxidation.

Comparative Genomic Analysis of the tce Gene Cluster in A. ferrooxidans ssp.

Considering the differences in the genomes of these four A. ferrooxidans strains [11, 12, 25, 39], the conservation of an identical tce gene cluster in each of these strains implies that the cytochrome c it encodes are likely to be involved in important physiological functions, thus conferring beneficial traits for the survival of these strains in the harsh environment sites they naturally inhabit. The extensively studied rus operon in A. ferrooxidans ATCC 23270 was also conserved in other three A. ferrooxidans strains (Fig. S5). However, the tce gene cluster was absent in the genomes of A. ferrivorans SS3 and A. ferrivorans CF-27 [21, 34], which indicated that its existence in these Fe2+-oxidizing Acidithiobacillus strains likely related to their phylogenetic distance.

Previous study showed that iron-oxidizing Acidithiobacillus species could be phylogenetically divided into four monophyletic groups and different iron oxidation pathways might exist in each group [3]. Phylogenetic analysis of these four tce gene cluster containing A. ferrooxidans strains suggests that the tce gene cluster likely exists in other strains in the group I. It is unclear whether this gene cluster also exists in the A. ferrooxidans strains belongs to group II and group IV, since complete genome sequence for the strains of these groups is not available yet.

Collectively, these bioinformatic and transcriptional evidences indicate that AFE_1428 and AFE_1429 involve in ferrous iron oxidation like their paralogs Cyc2 and Cyc1, respectively in A. ferrooxidans ATCC 23270 (Fig. 5). In this schematic model, AFE_1428 and AFE_1429 integrate with the Fe2+ oxidation pathways that constitute by metalloproteins encoded by the rus and pet I operons [6, 29]. AFE_1428 locates at outer membrane and directly participates in oxidizing ferrous iron, then transferring the electron to rusticyanin. AFE_1429 locates at periplasm, which transfers electron from rusticyanin to cytochrome c oxidase. Previous studies have shown that the rate of electron transfer from Cyc1 to cytochrome c oxidase is extremely slow in vitro [14, 22]. Therefore, the existence of AFE_1428 and AFE_1429 may consolidate the Fe2+ oxidation capacity of A. ferrooxidans ATCC 23270. Rus (AFE_3146), the branch point in Fe2+ oxidation pathways, is much abundant than other components that encoded by rus and petI operons in periplasm [20]. The transferring of electron that derives from Fe2+ oxidation to these final acceptors should not be inhibited by the availability of Rus in these electron transfer chains. Thus, the existence of multiple electron transfer chains regarding on Fe2+ oxidation is feasible.

Fig. 5
figure 5

(The electron transfer chains consisted with the metalloproteins encoded by rus and pet I operon were adapted from the previous studies [6, 29])

The proposed role of AFE_1428 and AFE_1429 in the ferrous iron oxidation pathway in A. ferrooxidans ATCC 23270

Full size image