Introduction

Bacillus thuringiensis is a gram-positive bacterium that produces regular parasporal crystals during the sporulation phase. The crystal proteins are specific and lethal only to larvae in the orders Lepidoptera, Diptera, Coleoptera, and Orthoptera [1, 6]. In addition, showing no toxicity to humans, animals, and nontarget insects, the crystal protein has great ecological value in agriculture and has become the most widely used microbiological insecticide in the world. However, biopesticides based on B. thuringiensis have some shortcomings, such as the narrower activity spectrum, inferior stability, and shorter persistence, which restricts adoption more widely. At present, many research institutes have constructed recombinant crystal proteins and B. thuringiensis strains which have a high toxicity and broad activity spectrum by genetic engineering technology, such as site-directed mutations, transgenic plants, and fusion genes [5, 13, 15]. In studies of fusion including different B. thuringiensis toxin genes and their foreign toxin gene, researchers have gained some important advantages in the application of B. thuringiensis [9].

Huwentoxin-I (HWTX-I) is a peptide neurotoxin isolated from the venom of the Chinese bird spider (Selenocosmia huwena), which can block neuromuscular transmission in an isolated mouse phrenic nerve-diaphragm preparation [12]. It is of interest for research on neurobiology and for potential applications as insecticides and pharmaceuticals. It has been shown that HWTX-I acts as a presynaptic toxin and can block high-voltage activated calcium channels. It functions as an inhibitor of the N-type acetylcholine receptor [11]. The mature peptide of this toxin is composed of 33 amino acids and the relative molecular weight is 3.75 kDa. Two-dimensional (2D)-NMR analysis indicated that it has three intramolecular disulfite bonds, and the 3D structure appears to be the pattern of “three sheets, three bridges” [17]. Previously, we isolated a B. thuringiensis strain 4.0718 expressing Cry1Ac with a high toxicity to insects and combined the cry1Ac with the hwtx-I gene to form a new fusion gene under the native promoter of the cry1Ac gene, to enhance the toxicity and broaden the activity spectrum as a biopesticide. After transforming the expression plasmid into B. thuringiensis acrystalliferous strain (XBU001), the fusion protein was mass-expressed. Serial examinations of the protein were done and the toxicity to the larvae of Plutella xylostella was tested.

Materials and Methods

Bacterial Strains, Plasmids and Medium

Bacterial strains and plasmids are reported in Table 1. B. thuringiensis (Bt) strain 4.0718 (CCTCC No. M200016) was from our laboratory collection. Bt acrystalliferous strain XBU001 was used for expression of the fusion gene and E. coli DH5α for the cloning. pUC19 was used for DNA subcloning and sequencing and the shuttle vector pHT304 was used for expression in XBU001. Recombinant strain XL002 was grown at 28°C in fermentation medium, pH 7.3. For solid media, 2% agar was added to the liquid medium.

Table 1 Strains and plasmids
Full size table

Construction of Recombinant Plasmids

A fragment of the cry1Ac gene including the upstream promoter region was obtained by PCR using the extracted plasmids as a template. Primer sequences were as follows: Ac-F SalI, 5′ ACGCGTCGACTTGCA GGTAAATGGTTC 3′; and Ac-R BglII, 5′ GCGC AGATCT AGATTCCTCCATAAGAGTAA3′. The cDNA sequences (No. AF157504) of the hwtx-I and Enterokinase sites described by Ausubel et al. [2] and Liang et al. [12] were designed according to the preference codon usage of B. thuringiensis. The designed sequences were then synthesized chemically with a BglII restriction site and Enterokinase recognition site at 5’. After BglII digestion of cry1Ac, PCR fragments and synthesized hwtx-I fragments were ligated with T4 DNA ligase to form the fusion gene.

The construction process of expression vector pXL43 is shown in Fig. 1a. The digestion and transformation were carried out as elaborated by Sambrook [20]. The fusion gene fragment carrying the upstream promoter region and the downstream terminator region of the cry1Ac gene was cloned into the shuttle vector pHT304, and the resulting plasmid was designated pXL43. Final expression construct pXL43 was verified by sequencing.

Fig. 1
figure 1

(a) Diagram of construction of fusion gene expression. (b) Identification of recombinants by PCR of a molecular weight marker (λDNA/HindIII; lane M), PCR of B. thuringiensis acrystalliferous strain XBU001 (lane 1), and PCR of different recombinant strains (lanes 2–4)

Full size image

Electroporation

Electroporation was performed as described by Bauer [19], and in a Gene Plusher Xcell (Bio-rad), pXL43 was transformed into XBU001 and called XL002, under the following conditions: 2.0 kV, 200 Ω, and 25 μF. Positive recombinants were selected on BHI medium (3.7% brain heart infusion, 17.1% sucrose, 2.0% agar).

Purification of Fusion Inclusions and SDS-PAGE

The crystal-spore mixture was transferred into a tundish and mixed with Na2SO4 and CCl4 at the following proportions: crystal-spore suspension:1% Na2SO4:CCl4, 7:6:7 (v/v). The tundish was shaken rigorously for 10 min. The aqueous phase was kept and centrifuged at 10,000 g and 4°C for 15 min, and the pellets were washed once with distilled water, twice with 5% acetone, and twice with distilled water. Finally, the pellets were collected, freeze-dried, and stored at −80 °C.

Purified fusion inclusions were boiled with loading buffer and loaded onto sodium dodecyl sulfate (SDS)/8% polyacrylamide gels and subjected to electrophoresis. They were then stained with Coomassie brilliant blue and quantitative analysis was performed with the Gel-pro Analyzer software (American).

Scanning of Atomic Force Microscope and Insecticidal Activity Assays

Strain XL002 was grown in fermentation medium with shaking at 28°C for 72 h. The collection was washed with distilled water repeatedly and diluted ton a certain optimum concentration. A trace of solution was dripped on the mica disk. After air-drying by blowing, the sample was scanned under the atomic force microscope.

Plutella xylostella eggs were hatched and reared to the third instar using standard protocols [14]. Purified fusion inclusions were prepared at five different concentrations. Groups of 12 larvae were allowed to eat cabbage leaf disks dipped in the crystal protein suspension of each concentration, and each bioassay was preformed three times. Bioassay conditions were as follows: 14 h of light and 10 h of darkness, alternately, a light intensity of 3000 lux, and a temperature of 25°C. Larval mortality was recorded at 48 h after inoculation, each experiment was replicated three times, and 50% lethal concentration (LC50) values were calculated as disintegrations per second (dps).

Results

Construction of Fusion Genes and Expression Vector

The plasmid template from B. thuringiensis strain 4.0718 was used for PCR with primer Ac-F and primer Ac-R. A 3.9-kbp fragment was amplified, which was consistent with the predicted result. A BglII fragment of 3.9 kb was ligated with the synthetic fragment of hwtx-I and Enterokinase recognition site. Using this ligated fragment as a template for amplification of the fusion gene, a 4.0-kb fragment was amplified with a size as predicted.

Through a series of restriction enzyme digestions and ligations (Fig. 1a), the fusion gene fragment of cry1Ac gene was cloned into the shuttle vector pHT304, and the recombinant plasmid was named pXL43. The fragment in pXL43 was verified by sequencing and Blast analysis of the sequencing result shows that the orf of cry1Ac from strain 4.0718 is identical to the cry1Ac5 gene (accession no. M73248), and the sequence of the hwtx-I gene and Enterokinase site corresponds with the designed sequence.

Expression of Fusion Gene Analysis

Identification of recombinants by PCR indicated that the expression vector was transformed in strain XBU001 (Fig. 1b). The fusion protein was mass-expressed in strain XBU001 (Fig. 2a). The cry1Ac gene encodes 1178 amino acids, while the hwtx-1 gene encodes 33 amino acids and the Enterokinase recognition site encodes 5 amino acids. The theoretical molecular weight of the fusion protein approximates 138 kDa, and the experimental data were approximately equivalent to the theoretical value. Quantitative analysis indicates that the expressed fusion protein accounted for 61.38% of the total cellular proteins.

Fig. 2
figure 2

(a) SDS-PAGE analysis of expressed products of the fusion gene, protein markers (lane M), XBU001 strain (lane 1), XBU304 strain (lane 2), XL002 strain (lane 3), and purified recombinant crystals (lane 4). (b) Atomic force microscopy of recombinant crystals of the engineering XL002 strain with different scanning sizes

Full size image

Scanning and Bioassay Analysis

Cry1A-type protoxins can accumulate in big rhombus crystal inclusions. The fusion gene cloned also expressed a large amount of protoxins and big rhombus crystal inclusions were formed in the XL002 strain during sporulation. Maps of atomic force microscope scans are shown in Fig. 2b. There were some bipyramidal crystals, 1 × 2 μm. Bioassays showed that the fusion protein crystals from the XL002 strain had a high toxicity against larvae of Plutella xylostella, with an LC50 value of 5.12 μg/mL, and for HTX42 tthis value was 70.78 μg/mL at 48 h. The toxicity of XL002 was 13.8 times higher than that of HTX42 at 48 h.

Discussion

We used B. thuringiensis strain 4.0718 as the original strain, and its genome was analyzed by PCR-RFLP. There were some cry genes existing on plasmids and 20-kb DNA in bipyramidal crystals, such as cry1Ac, cry1Aa, cry2Aa, and cry2Ab [7]. The toxicity experiment demonstrated that strain 4.0718 was highly toxic to larvae of P. xylostella [8]. Palidam [18] reported that the Cry1Ac crystal of the Cry1 family crystal protein was most toxic to larvae of Helicourpa armigori and P. xylostella. Therefore our research on the fusion gene was based on the cry1Ac gene, and we tried to construct a new fusion gene with an effective encoded insecticidal fusion protein.

We aligned the sequence of some cry1Ac genes and cry1Aa genes published in GenBank and found that both the 5′-end upstream promoter and the 3′-end orf of the two genes were highly homologous. Because the cry1Ac gene and cry1Aa gene coexist on the plasmid from B. thuringiensis strain 4.0718, the 3.9-kb PCR fragment probably contains both genes. In order to obtain the correct recombinant plasmid including the cry1Ac gene fragment, we identified and selected the recombinant plasmid pUAcH19 with PstI digestion. The result showed that both the cry1Aa gene and cry1Ac gene existed in different recombinant plasmids.

The hwtx-I gene was from venom of the Chinese bird spider, which was also a foreign gene to B. thuringiensis. So we designed the DNA sequence of the hwtx-I gene with the partial codon usage of the B. thuringiensis strain. As for construction of the expression vector of the fusion gene, we used the shuttle vector pHT304, which had been used most widely and successfully as the expression vector, pHT304, which has two replicons, which can multiply in two kinds of bacteria (E. coli and B. thuringiensis). However, its lacZ promoter cannot be recognized by RNA polymerase of B. thuringiensis. We retained the 5′-end promoting-region 376 bp and the 3′-end terminator-region 248 bp of cry1Ac gene at the two ends of the fusion gene, respectively. Within the promoter region, Wong et al. [21] discovered two adjacent transcript start sites (Bt I and Bt II) by S1 nuclease mapping which belong to the sporulation-dependent-type promoter. Sequencing analysis of terminator region reveals that there are two stem-loop structures, which are composed of four reverse repeats and one poly(T) structure. The two kinds of structures had two functions of stopping transcription and promoting the stability of mRNA [16]. From Fig. 2, we can see that the fusion protein was mass-expressed in XBU001. The causes are as follows: the two promoters were very suitable for expression in XBU001; the two stem-loop structures and poly(T) structure would stop further transcription and promote the stability of mRNA efficiently; and the designed DNA sequence of the hwtx-I gene and Enterokinase recognition site with codon usage of the B. thuringiensis strain was very suitable for expression in strain XBU001. Formation of the crystals prevented the protein from being degraded efficiently by the exogenous proteases.

The fusion protein could still form crystals as cry1 family proteins do. Some reports have shown that the Cry1 family crystals were sustained by intramolecular disulfate bonds in the C-end conservative region [4], and this was the key basis for sustaining the stability of the fusion protein constructed in this study. In addition, the mature HWTX-I peptide contains three intramolecular disulfate bonds, which can help fusion proteins form crystals.

Constructed of fusion insecticidal proteins has been reported previously. Bosch et al. [3] constructed a fusion gene with a toxic domain of the cry1C gene combined with the cry1E gene. Compared with the Cry1C protein, the fusion protein has different acceptors, a higher toxicity, and a combination of the cry1A gene with the proteinase inhibitor gene (CpTi). The fusion gene was introduced into the elite cotton, which resulted in double-effect-resistant insects in transgenic cotton [10]. We combined the cry1Ac gene with a neurotoxin gene (hwtx-I) to form a new fusion gene. The expression plasmid of the fusion gene was transformed into XBU001 and the fusion protein was mass-expressed successfully. We make the following speculations on the active mechanism of the fusion protein: (1) when the fusion crystal proteins were ingested by susceptible insects, they were dissolved in the alkaline midgut, followed by proteolytic processing by midgut protease; and (2) the fusion proteins were divided into two parts (Cry1Ac and HWTX-I) by Enterokinase. The stable 60-kDa Cry1Ac toxin bound to midgut receptors and inserted into the apical membrane of brush border epithelial cells to form pores, which disrupted the functional membrane process. The HWTX-I peptides entered into the lymphokinesis through these pores and inhibited the nervous system of the insect. The two toxins may have synergized the toxicity to the target insects. From the bioassay results, we observed that the toxicity of the fusion protein increased compared to the Cry1Ac protoxin. In addition, the fusion protein has the characteristic of safety: the fusion crystal protein cannot be dissolved in the acidic midgut of human or animal, hence the active 60-kDa toxins should not be released. The HWTX-I peptide can inhibit nerve conduction in the circulatory system but not in the digestive tubes. Therefore, the fusion protein should be safe to humans and animals. This study has laid the groundwork for constructing fusion genes of B. thuringiensis cry genes and other foreign toxin genes with a higher toxicity.