Abstract
Valorization of the hemicellulose fraction of plant biomass is crucial for the sustainability of lignocellulosic biorefineries. The Cellulomonas genus comprises Gram-positive Actinobacteria that degrade cellulose and other polysaccharides by secreting a complex array of enzymes. In this work, we studied the specificity and synergy of two enzymes, CsXyn10A and CsAbf62A, which were identified as highly abundant in the extracellular proteome of Cellulomonas sp. B6 when grown on wheat bran. To explore their potential for bioprocessing, the recombinant enzymes were expressed and their activities were thoroughly characterized. rCsXyn10A is a GH10 endo-xylanase (EC 3.2.1.8), active across a broad pH range (5 to 9), at temperatures up to 55 °C. rCsAbf62A is an α-l-arabinofuranosidase (ABF) (EC 3.2.1.55) that specifically removes α-1,2 and α-1,3-l-arabinosyl substituents from arabino-xylo-oligosaccharides (AXOS), xylan, and arabinan backbones, but it cannot act on double-substituted residues. It also has activity on pNPA. No differences were observed regarding activity when CsAbf62A was expressed with its appended CBM13 module or only the catalytic domain. The amount of xylobiose released from either wheat arabinoxylan or arabino-xylo-oligosaccharides increased significantly when rCsXyn10A was supplemented with rCsAbf62A, indicating that the removal of arabinosyl residues by rCsAbf62A improved rCsXyn10A accessibility to β-1,4-xylose linkages, but no synergism was observed in the deconstruction of wheat bran. These results contribute to designing tailor-made, substrate-specific, enzymatic cocktails for xylan valorization.
Key points
• rCsAbf62A removes α-1,2 and α-1,3-L-arabinosyl substituents from arabino-xylo-oligosaccharides, xylan, and arabinan backbones.
• The appended CBM13 of rCsAbf62A did not affect the specific activity of the enzyme.
• Supplementation of rCsXyn10A with rCsAbf62A improves the degradation of AXOS and xylan.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Increasing environmental concerns and energy costs have resulted in a growing urgency to use plant biomass as a resource to produce fuels, chemicals, and bioproducts. However, the composition and biochemical properties of the secondary plant cell wall, which is the main component of plant biomass, confer resistance to deconstruction by microbes and enzymes, a trait known as biomass recalcitrance (Himmel 2008; Alonso et al. 2010; Zhao et al. 2012). The major constituents, cellulose, hemicellulose, and lignin, are arranged to form the plant cell wall, with a structure and relative composition that vary considerably between species, cell type, and developmental stage. Cellulose is tightly packed in microfibrils, which are aligned and bound together into fibril aggregates by a matrix of hemicellulose and lignin (Fahlen and Salmen 2003).
Hemicelluloses are the second most abundant polysaccharide on Earth after cellulose. These polysaccharides are complex and structurally diverse, and their deconstruction and/or valorization is crucial for the sustainability of lignocellulosic biorefineries (Qaseem et al. 2021). The predominant types of hemicelluloses in plant secondary cell walls are heteroxylans, including glucuronoxylans (GXs), arabinoxylans (AXs), and glucuronoarabinoxylans (GAXs), which have glucuronic acid and/or arabinose residues, decorating the β-1,4-xylose backbone (Rogowski et al. 2015). In particular, GAX and neutral AX are one of the main components of grasses and cereal crops (Pauly and Keegstra 2008; Saha 2003). AX has a high content of arabinose (33–45%) (Saha 2000), in single or double α-1,2 and/or α-1,3-l-arabinosyl substitutions of the xylan backbone (Perlin 1951).
In nature, enzymatic hydrolysis of xylans is performed by a diverse group of enzymes. Among them, endo-1,4-β-xylanases (XYNs) (EC 3.2.1.8), which hydrolyze the xylan backbone, can be found in nine different glycosyl hydrolase (GH) families: GH 5, 8, 10, 11, 30, 43, 51, 98, and 141, according to the carbohydrate-active enzymes (CAZy; www.cazy.org) database (Drula et al. 2022). These enzymes often act in concert with debranching enzymes that are able to remove substituents present on heteroxylans (Kormelink and Voragen 1993; Poutanen and Puls 1989; Bachmann and McCarthy 1991; Long et al. 2020). In this regard, α-l-arabinofuranosidases (ABFs) (EC 3.2.1.55, CAZy families GH 2, 3, 43, 51, 54 and 62), which remove α-1,2 and/or α-1,3-l-arabinosyl residues from the xylose backbone, are key for complete deconstruction of AX. The biochemical properties and activity profiles of all these enzymes need to be studied to evaluate their applications in the bioconversion of lignocellulosic biomass (Lagaert et al. 2014).
Hydrolysis products of rCsXyn10A, rCsAbf62A, and rCsAbf62A-cd. A Thin-layer chromatography (TLC) of soluble reaction products of beechwood xylan (BX) and low-viscosity wheat arabinoxylan (WAX-lv) treated with the recombinant enzymes, as indicated ( +). The lane with no enzymes corresponds to the substrate control. B TLC of soluble reaction products of rCsXyn10A on xylo-oligosaccharides (X3 to X6) with varying incubation times. TLC standards were loaded at 0.2 mg/mL: ARA (arabinose), X1 (xylose), X2 (xylobiose), X3 (xylotriose), X4 (xylotetraose), X5 (xylopentaose), and X6 (xylohexaose). C MALDI-TOF sprectra of reaction products of rCsXyn10A on BX. [a.u.]: arbitrary units. XnMeGlcA [M + Na +]: sodium adduct of xylo-oligosaccharides with 4-O-methyl glucuronic acid with n degree of polymerization
Significant advances in bioconversion of lignocellulosic biomass rely on identification of new microorganisms and enzymes that can utilize biomass from different plant sources and increase the efficacy of industrial processes. An encouraging approach is the exploration of microorganisms growing in aerobic environments where lignocellulose represents the main carbon-based nutrient source. Following this strategy, the strain Cellulomonas sp. B6 was obtained from a subtropical forest soil consortium (Campos et al. 2014). Genomic analysis of Cellulomonas sp. B6 revealed a wide set of genes encoding CAZymes with biotechnological potential (Piccinni et al. 2019). This novel isolate, related phylogenetically to Cellulomonas flavigena, was shown to secrete a repertoire of enzymes involved in xylan deconstruction when grown on wheat bran, wheat straw, and sugar cane straw. Enzymes identified in the extracellular proteome of Cellulomonas sp. B6 include six xylanases from families GH10, a xylanase GH11, and a debranching enzyme from family GH62 (Piccinni et al. 2019; Ontañon et al. 2021). The relative abundance of these enzymes varied depending on the culture carbon source substrate, suggesting differences in their biological role.
In this work, we cloned and biochemically characterized CsXyn10A and CsAbf62A, which are among the most abundant proteins in the extracellular enzymatic extract of Cellulomonas sp. B6, when grown on wheat bran (Ontañon et al. 2021). We thoroughly characterized both enzymes and explored their possible synergism to understand their contribution to pentose utilization. We show that CsXyn10A is an endo-1,4-β-xylanase with no activity on cellulosic substrates (enzymes known as cellulase-free xylanases (Walia et al. 2017)) and CsAbf62A is an α-l-arabinofuranosidase that selectively removes single α-1,2 and α-1,3-arabinosyl substituents, but not double substitutions, from xylan, arabinan, and xylo-oligosaccharides. To further study the role of these enzymes in biomass deconstruction, we determined their activity profiles and possible synergy. We also investigated the contribution of its native appended carbohydrate binding module CBM13 to the activity of CsAbf62A.
Materials and methods
Bioinformatic analysis
The peptide sequences of CsXyn10A (GenBank KSW20567.1) and CsAbf62A (GenBank KSW17752.1) were aligned using protein BLAST (BLASTP, NCBI database) (Altschul et al. 1990) against protein sequences from Protein Data Bank (pdb) (Berman et al. 2000) and reference proteins (refseq_protein) available in the NCBI database to identify putative catalytic residues. Protein parameter calculations and signal peptide predictions were performed using the ProtParam (Expasy; Swiss Institute of Bioinformatics) and SignalP v5.0 (Almagro Armenteros et al. 2019) servers, respectively.The Swiss model (Waterhouse et al. 2018) was used to create three-dimensional models of the corresponding structures which were evaluated using GMQE and QMEAN values. These were 0.93 and 0.89, respectively, for CsAbf62A (with pdb:4O8N as template), and 0.91 and 0.89, respectively, for CsXyn10A (with pdb:1E0V as template). Models were then rendered using VMD software (Humphrey et al. 1996).
Cloning and expression of rCsXyn10C
Total DNA from Cellulomonas sp. B6 was extracted using a Wizard® Genomic DNA Purification Kit (Promega, Madison, USA). The coding sequence for the mature CsXyn10A protein (1333 bp; amino acids 34–471) was amplified from 20 ng of bacterial genomic DNA, using Taq polymerase and primers gh10Emf (TTGGATCCGCCGCCGCCGGCAGCACGCTCCAG) and gh10EMr (TTAAGCTTTTACGACGCCGAGCAGGTCAGCGTCGG). The amplified product was digested with BamHI and HindIII restriction enzymes, gel purified (Wizard® SV Gel and PCR Clean-Up System, Promega, Madison, USA), and cloned into the protein expression vector pET28a using the same restriction sites (Novagen, Madison, USA). Correct integrity of the recombinant plasmid pET28a-His-CsXyn10A was corroborated by sequencing analysis (Macrogen, Seoul, Republic of Korea). The resulting pET28a-His-CsXyn10A construct encodes a fusion protein with a resulting N-terminal 6X histidine tag followed by amino acids 34–471 of CsXyn10A. Competent cells of Escherichia coli Rosetta (pLys) strain (Novagen, Madison, USA) were transformed for protein expression, which was induced in 250 mL cultures at Abs600 nm: 0.8 with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 16 h at 20 °C. Cells were centrifuged at 4000 g, 20 min, 4 °C, and the pellet was processed for recombinant protein purification.
Cloning and expression of rCsAbf62A and rCsAbf62A-cd
The complete gene coding for the mature CsAbf62A protein (1416 bp; amino acids 23–493) and the sequence coding for the catalytic module alone (904 bp; amino acids 194–493) were amplified using the following primers: GH62Fw1 (AAAGGATCCGCGACCGTCGACACGAACGCGTAC)-GH62Rv (AAACTCGAGCTACCGCTGGAGCGTCAGCAGC) for rCsAbf62A and GH62Fw2 (AAAGGATCCGTGCTCGCTGCCGAGCAGCTAC)-GH62Rv for rCsAbf62A-cd. The amplified products were cloned into pET28a (Novagen, Madison, USA) as described above, but using BamHI and XhoI restriction sites in these cases. The resulting pET28a-His-CsAbf62A and pET28a-His-CsAbf62A-cd constructs encode fusion proteins with a N-terminal 6X histidine tag followed by amino acids 23–493 and 194–493 of CsAbf62A, respectively. Escherichia coli Arctic Express (DE3) competent cells (Agilent Technologies, Santa Clara, USA) were transformed with the plasmids and recombinant clones were induced with 1 mM IPTG for 24 h at 13 °C.
Recombinant protein purification and quantification
The QIAexpressionist protocol (Qiagen; Germantown, USA) was used to test the solubility of the recombinant proteins and to purify them from the soluble intracellular fraction. Briefly, pellets from 250 mL induced cultures were resuspended in 25-mL lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole pH 8.0), cells were lysed by sonication (2 cycles of 10 s ON- 10 s OFF pulses, for 2 min), and the soluble fraction was recovered by centrifugation (30 min, 10,000 g, 4 °C). Recombinant proteins were purified from the soluble fraction by immobilized metal affinity chromatography (IMAC) with Ni–NTA agarose resin (Qiagen; Germantown, USA), using 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole pH 8.0 as elution buffer (QIAexpressionist). Quantification of the purified proteins was determined by Bradford assay (Promega; Madison, USA) and with a nanodrop equipment (Thermo Fisher Scientific, Waltham, USA), using the corresponding molecular weight and extinction coefficient. The yields obtained were 65 mg/L of cell culture of purified rCsXyn10A and 30 mg/L of cell culture of purified rCsAbf62A and rCsAbf62A-cd.
Polyacrylamide gel electrophoresis and immunoblotting
Recombinant proteins in crude cell-free extracts were loaded into reducing 10% SDS-PAGE gels, run at 100 V, and transferred to 0.45-μm nitrocellulose membrane (Bio-Rad Laboratories Inc., Hercules, USA). The membrane was first incubated with 5% non-fat dried milk in Tris-buffered saline (TBS; 20 mM Tris–HCl, pH 7.5, 150 mM NaCl) O.N. at 4 °C, and then, Western blot was performed by probing the membrane with 0.1 μg/mL of polyclonal rabbit anti HIS antibody (Genescript, Piscataway, USA) for 1 h in agitation, washed three times with TBS buffer for 15 min, and then incubated with 1:15,000 dilution of alkaline phosphatase-linked goat anti rabbit antibody (Sigma Chemical Co., Saint Louis, USA), for 1 h in agitation. The membrane was washed with TBS buffer as previously specified, incubated with BREFA buffer (100 mM Tris–HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl2) for 10 min, and phosphatase activity was revealed by a chromogenic reaction using 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitroblue tetrazolium (NBT) as substrates (Sigma Chemical Co., Saint Louis, USA).
Activity assays
Activity assays to test substrate specificity of rCsXyn10A were assayed using 0.5% polymeric substrates or 2 mM 4-nitrophenyl-β-d-xylopyranoside (pNPX). Reactions (0.1 mL) contained enzyme (final concentration 0.002–0.02 μM) or buffer and mixtures were incubated at 40–50 °C and pH 6.0 for 10–20 min. Reactions containing BX or CMC were stopped by boiling for 10 min, and the reaction products were analyzed by the quantification of reducing sugars by the 3,5-dinitrosalicylic acid (DNS) method (Miller et al. 1960). Reactions containing pNPX were stopped by the addition of 2% Na2CO3, and the released p-nitrophenol (pNP) was measured by reading the absorbance at 410 nm. Xylanase activity was additionally measured using 0.5% medium or low-viscosity wheat flour arabinoxylan (WAX-mv and WAX-lv, respectively) (Megazyme, Bray, Ireland), following the same procedure as for BX.
Typical reactions for assaying arabinofuranosidase activity of rCsAbf62A and rCsAbf62A-cd consisted of 2 mM pNP-α-l-arabinofuranose (Sigma Chemical Co., Saint Louis, USA) and 1 μM enzyme in sodium phosphate buffer pH 6.0. Reactions were allowed to proceed for 10 min and stopped with 2% Na2CO3 as described above. Further experiments were performed by incubating 0.5% (w/v) polymeric substrates and 0.1–1 μM enzyme at 30 °C for 5 to 60 min as indicated. Reaction products were quantified by the DNS method (Miller et al. 1960) (reducing sugars) and/or high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) or visualized by thin-layer chromatography (TLC) or 1D 1H nuclear magnetic resonance (NMR) spectroscopy.
For reactions performed with natural substrates, one unit (U) of xylanase or arabinofuranosidase activity was defined as the amount of enzyme that releases 1 μmol of xylose or arabinose per min at the reaction conditions. For commercial p-nitrophenol (pNP)-sugar substrates, activity was defined as the amount of enzyme that liberates 1 μmol pNP per min.
Activity assays using xylo-oligosaccharides (XOS), with degrees of polymerization (DP) 2 to 6 (X2-X6, Megazyme, Bray, Ireland), were performed by incubating 1.5 mg/mL substrate prepared in 50 mM citrate/phosphate buffer pH 6.5 with 0.01 μM of rCsXyn10A. Reactions were incubated at 45 °C for 0, 30, and 120 min, stopped by boiling, and cleared by centrifugation (10,000 g, 10 min). Activity assays using AXOS were performed in 50 μL reactions containing 50 mg/mL 33-α-l-arabinofuranosyl-xylotetraose (XA3XX), 23-α-l-arabinofuranosyl-xylotriose (A2XX) or 33-α-l-plus 23-α-l-arabinofuranosyl-xylotetraose mixture (XAXX-mix) (Megazyme, Bray, Ireland), and 0.5 μM of purified enzyme in 50 mM sodium phosphate buffer pH 6.0. Reactions were carried out at 30 °C and 300 rpm for 4–16 h. Reaction products were analyzed using HPAEC-PAD or TLC.
Simultaneous activity assays
Combined activity of the recombinant proteins was first evaluated by incubating 5 mg/mL AXOS (XA3XX or XAXX mix) with 0.5 μM rCsXyn10A alone or with equal molar concentration of rCsAbf62A or rCsAbf62-cd. Reactions were incubated at 30 °C and pH 6.0 for 4 h and soluble reaction products were visualized by TLC. Similar enzymatic reactions were performed by incubating 0.5% WAX-lv with 0.1 μM rCsXyn10A and 0.6 μM rCsAbf62A or rCsAbf62A-cd at 30 °C for 5 h. The substrate was also incubated with each enzyme alone, in the same concentrations. Reactions were stopped by heating at 80 °C for 10 min and soluble reaction products were analyzed by HPAEC-PAD.
Alcohol insoluble residue (AIR) preparation from wheat bran
Wheat bran was first ground to reduce particle size and then suspended in 80% ethanol and homogenized. The material was filtered by 50-μm nylon mesh and washed thoroughly with 80% ethanol. The sample was resuspended in 1:1 chloroform/methanol, stirred for a minimum of 4 h, and re-filtered by 50-μm nylon mesh. AIR was obtained by drying the sample at room temperature after a thorough wash with acetone.
Reducing sugar analysis by the DNS method
Reducing sugars were analyzed by the DNS method (Miller et al. 1960). Briefly, 100 μL of the reaction products was mixed with 200 μL of DNS and boiled for 10 min, followed by a 10-min incubation on ice. Two hundred microliters of each mixture was transferred to a 96-well plate and absorbance was measured at 540 nm. Results were compared to a xylose standard curve (0–1 mg/mL) obtained under the same conditions. Control reactions without enzyme and/or substrate were included in the analysis.
Visualization of products by thin-layer chromatography (TLC)
TLC was performed using silica gel plates (Sigma-Aldrich, Saint Louis, USA) in a glass chamber. First the chamber was saturated overnight (O.N.) with 25 mL of butanol/acetic acid/water (2:1:1). The silica plate was seeded at the baseline with 2.5–10 μL of each reaction product and standards (0.25 mg/mL arabinose, xylose, xylobiose, or XOS with DP 3–6), and left to dry for 15 min at 30 °C. The seeded plate was incubated in the glass TLC chamber with the saturating solution as mobile phase, allowing two consecutive runs (until mobile phase reached 1 cm below the upper end of the plate). Plates were then removed, dried, and revealed by spraying a solution of water/ethanol/sulfuric acid (20:70:3) with 1% orcinol, drying, and then heating slightly with a heat gun until visualization of sugars.
Product analysis by mass spectrometry
Reaction supernatant (10 μL) was incubated with 2 μL DOWEX-50 resin (Sigma-Aldrich, Saint Louis, USA) for 30 min at room temperature. Tubes were spun down and 1 µL of the supernatant was mixed with an equal volume of 10 mg/mL 2,5-dihydroxybenzoic acid (DHB) in methanol on a microSCOUT-MSP 96 target ground steel plate (Bruker, Billerica, USA). The spotted samples were then dried before being analyzed by mass spectrometry on a Microflex LT matrix-assisted laser desorption ionization time of flight (MALDI/TOF) instrument (Bruker, Billerica, USA).
Product analysis by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD)
Arabinose, xylose, and xylobiose were analyzed by HPAEC-PAD in a CarboPac PA20 analytical column, 3 × 150 mm, and a CarboPac PA20 guard column, 3 × 30 mm, (Dionex, Thermo Fisher Scientific, Waltham, USA). After equilibration of the column with 50 mM NaOH for 5 min, sample aliquots of 20 μL were injected and separated at a flow rate of 0.4 mL/min at a constant temperature of 30 °C. The elution conditions were as follows: 0–5 min: from 0 to 40 mM NaAcO in 50 mM NaOH (curve 5); 5–11 min: from 40 to 150 mM NaAcO in 50 mM NaOH (curve 5), 11–15 min: 150 mM NaAcO in 50 mM NaOH. The detector temperature was set at 30 °C. Chromeleon software (Thermo Fisher, Waltham, USA) was used for processing and data acquisition. Integrated peak areas were compared to mono and oligosaccharide calibration standards (xylose, xylobiose, and arabinose) purchased from Megazyme (Bray, Ireland).
1D 1 H nuclear magnetic resonance (NMR) spectroscopy
Reactions (200 μL) containing 0.5% (w/v) WAX-mv (Megazyme, Bray, Ireland) and CsAbf62A (1 μM), CsAbf62A-cd (1 μM), or buffer were incubated at 30 °C and pH 6.0 for 24 h followed by a 10-min incubation at 80 °C to stop the reactions. Precipitation of the substrate was achieved by adding 400 μL of 70% ethanol and incubating at 4 °C 16 h. Samples were then centrifuged, and the pellets were resuspended in 200 μL of deterium oxide (99.9%; Cambridge Isotope Laboratories, Tewksbury, USA) and freeze-dried. The dried substrates were then resuspended again with 200 μL of deterium oxide and placed in a 3-mm NMR tube. 1D and 2D 1H-NMR spectra were recorded with a Varian Inova NMR spectrometer (Varian, Inc., Agilent Technologies, Palo Alto, USA) operating at 600 MHz equipped with a 5-mm cold probe and with a sample temperature of 298 K. Chemical shifts are given in ppm relative to an internal dimethyl sulfoxide (DMSO) standard (δ1H 2.721). The NMR spectra were processed using MNova software (Mestrelab Research S.L., Santiago de Compostela, Spain).
Determination of kinetic parameters
GraphPad 6.01 software (GraphPad Software Inc.) was employed to identify the best kinetics model for each recombinant enzyme and to calculate the kinetic parameters Kcat, KM, and Vmax.
Thermal shift assay
For thermal shift analysis, reactions (30 μL) containing 3 μL of a 1:10 dilution of SYPRO™ Orange protein gel stain (Sigma-Aldrich, Saint Louis, USA) in H2O, and 5 μM purified enzyme in 50 mM sodium phosphate buffer pH 6.0, in the presence or absence of 10 mM CaCl2, were incubated in a OneStep Plus qPCR System (Applied Biosystems, Waltham, USA). Melting curves were generated by measuring fluorescence intensity at a temperature gradient of 25–90 °C with 1 °C intervals. The melting temperature (Tm) of the proteins was determined for each condition tested.
Results
Recombinant expression of CsXyn10A and CsAbf62A
CsXyn10A and CsAbf62A are both modular enzymes, with a GH catalytic domain (CD) and a carbohydrate binding module (CBM): GH10-CBM2 and CBM13-GH62. Homology-based comparisons and protein modeling allowed us to predict structure, catalytic residues, and potential calcium binding motifs (only present in CsAbf62A) as well as to identify the sequence corresponding to the N-terminal signal peptide (they are both extracellular enzymes) and the catalytic (CD) and carbohydrate binding (CBM) modules (Supplementary Fig. S1a). These results supported the endo-1,4-β-xylanase (XYN; EC 3.2.1.8) prediction for CsXyn10A and α-l-arabinofuranosidase (ABF; EC 3.2.1.55) prediction for CsAbf62A. To further characterize each protein, CsXyn10A (amino acids 34–471) and CsAbf62A (amino acids 23–493) were expressed, lacking the native signal peptide, in E. coli as recombinant N-terminal His-tagged fusion proteins. We also expressed only the CD of CsAbf62A (CsAbf62A-cd, amino acids 194–493) to evaluate the contribution of CBM13 to enzyme function. Recombinant (r) CsXyn10A, CsAbf62A, and CsAbf62A-cd were successfully produced and purified from the soluble fraction (Supplementary Fig. S1b).
Substrate specificity of rCsXyn10A
Hydrolytic activity of rCsXyn10A was evaluated on several substrates to characterize its specificity and mode of action. Specific activity was 444.3 ± 44.6 and 408.6 ± 69.8 UI/mg from beechwood xylan (BX) and low-viscosity wheat arabinoxylan (WAX-lv), respectively (by the DNS method, at 40 °C and pH 6.0). Analysis of the reaction products from BX hydrolysis by thin-layer chromatography (TLC) and matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) showed the enzyme released mainly X2 as well as XOS and xylose (X1) (Fig. 1a and c). No activity was detected on Avicel (crystalline cellulose), phosphoric acid swollen cellulose (PASC), carboxymethylcellulose (CMC), xylobiose (X2), and p-nitrophenyl xylopyranoside (pNPX) (Table 1), demonstrating that CsXyn10A is a cellulase-free endo-1,4-β-xylanase. Next, we evaluated the ability of rCsXyn10A to degrade linear XOS with degrees of polymerization (DPs) of 3 to 6 (X3-X6) and visualized the reaction products by TLC after 0, 30, and 120 min of incubation (Fig. 1b). In all cases, xylobiose (X2) was the main product, although xylotriose (X3) and xylose were also obtained, suggesting an endo-mechanism, with preference for internal sites. Based on the degradation pattern, we think that there is also a less favored exo-activity, releasing X1 from either the reducing or non-reducing end, which still remains to be determined.
Substrate specificity of rCsAbf62A and rCsAbf62A-cd
To date, the majority of characterized GH62 enzymes is type B arabinofuranosidases (ABFs), which have been described to act on polysaccharides as well as arabino-xylo-oligosaccharides (AXOS) and, in some cases, p-nitrophenyl-α-l-arabinofuranoside (pNPA) (while type A ABFs act only on AXOS and pNPA) (Wilkens et al. 2017). To characterize rCsAbf62A, substrate specificity was determined using several polysaccharide substrates and monitored by measuring the release of arabinose substituents from WAX, wheat bran, and arabinan (Table 1). Specific activity was determined on WAX-lv for rCsAbf62A (17.31 ± 1.03 IU/mg) and rCsAbf62A-cd (23.56 ± 2.30 UI/mg) using the DNS method. Soluble reaction products were visualized by TLC, demonstrating that the enzyme hydrolyzed arabinose from WAX-lv (Fig. 1a). Release of arabinose was also confirmed for wheat bran, wheat xylan, and sugar beet arabinan by high-performance anion-exchange chromatography/pulsed amperometric detection (HPAEC-PAD). As for pNP substrates, rCsAbf62A and rCsAbf62A-cd were only able to hydrolyze pNPA, among the ones tested (pNP-β-d-xylopyranoside/-d-cellobioside/-β-d-lactobioside/-β-d-glucopyranoside).
To further determine the linkage-specificity of CsAbf62A, we analyzed the activity on AXOS with different arabinose substitutions. Activity was tested using a XAXX mix (XA3XX/XA2XX) (xylotetraose with α-1,2 or α-1,3-linked arabinose substituents), XA3XX (xylotetraose with α-1,3-linked arabinose), and A2XX (xylotriose with α-1,2-linked arabinose). HPAEC-PAD analysis of the reaction products revealed rCsAbf62A (and rCsAbf62A-cd) was able to catalyze the complete hydrolysis of arabinose substituents on either the O-3 or O-2 positions of xylose, regardless of the position along the backbone (Supplementary Fig. S2).
Medium viscosity WAX (WAX-mv) is heavily substituted with arabinose (approximately 38%) and is known to have α-1,3 single and α-1,3 /α-1,2 double substitutions and little, if any, α-1,2 single substitutions (Pitkanen et al. 2009). To determine whether arabinose could be released from the single or doubly substituted xylose present in the polymer, 1H NMR analysis was conducted after incubation of WAX-mv with rCsAbf62A, rCsAbf62A-cd, or buffer as control. Spectra obtained revealed the disappearance of the signal corresponding to 3-linked arabinofuranosyl residues attached to single substituted xylose, confirming complete degradation of this linkage, but not of the ones corresponding to arabinoses attached at O-3 and O-2 of the doubly substituted xylose (Fig. 2) (De Man et al. 2021). This could be related to the narrow active site pocket, capable of accommodating only one arabinose residue, in the cleft that accommodates the xylan backbone (dos Santos et al. 2018; Maehara et al. 2014).
1D 1H NMR of rCsAbf62A and rCsAbf62A-cd wheat arabinoxylan reaction products. In the schematic, linkages within the polysaccharide (a–c) are labeled to correspond with peaks in the NMR spectra (a: α-1,3 linked Araf in single substitutions; b: α-1,3 linked Araf in double substitutions; c: α-1,2 linked Araf in double substitutions). Spectra are vertically aligned and the yellow dotted line indicates the position of peak “a.” The control spectrum is arabinoxylan that was incubated with protein buffer
When incubated with branched and debranched sugar beet arabinan, arabinose was released only from the former. Branched sugar beet arabinan consists of a α-1,5-linked arabinofuranose backbone to which α-1,3-linked (and possibly some α-1,2-linked) l-arabinofuranosyl residues are appended, whereas the debranched substrate has been enzymatically treated to remove all α-1,2 and α-1,3-l-arabinofuranosyl substituents from the backbone. Taken together, these data indicate that rCsAbf62A is able to remove α-1,3 or α-1,2-arabinosyl substitutions from arabinan, but does not act upon the main α-1,5-linked arabinan backbone (Supplementary Fig. S3). The enzymes were tested alone or in combination with a commercial α-1,5-arabinanase (EC 3.2.1.99), and the DP of the oligosaccharide products (DP 2 to 5) did not change when rCsAbf62A or rCsAbf62A-cd were added, further supporting that this enzyme cannot act on α-1,5-arabinofuranosidic linkages in an endo or exo-manner (Supplementary Fig. S3). Moreover, no activity was observed on BX, which has α-1,2-linked 4-O-methyl glucuronic acid substituents (but no arabinose) or arabinogalactan from larch wood (ARGAL), which is appended with α-1,6-arabinosyl residues.
These results demonstrated unequivocally that CsAbf62A is a type B GH62 enzyme with specific α-l-arabinofuranosidase activity that can only remove mono-substituted α-1,2 and α-1,3-linked arabinose residues but not α-1,2 α-1,3 double arabinose substitutions. Truncation of the CBM13 did not affect the activity or specificity for any of the substrates assayed.
Biochemical characterization of rCsXyn10A, rCsAbf62A, and rCsAbf62A-cd
Hydrolytic activity of the recombinant proteins was examined within a wide pH range (from 4.0 to 10.0), using BX for rCsXyn10A and pNPA for rCsAbf62A and rCsAbf62A-cd. The activity profile showed the highest activity at pH 6.0 for rCsXyn10A and 5.5 for rCsAbf62A and rCsAbf62A-cd (Fig. 3a). These conditions were used to determine the optimal reaction temperature of each enzyme and showed the maximum catalytic activity is at 50 °C for rCsXyn10A and 40 °C for rCsAbf62A and rCsAbf62A-cd (Fig. 3b).
Activity profile of rCsXyn10A, rCsAbf62A, and rCsAbf62A-cd. Optimal A pH condition, B temperature, and C substrate concentration, for the activity of rCsXyn10A (left) and rCsAbf62A and rCsAbf62A-cd (right). Optimal pH was determined at 50 °C for rCsXyn10A and 30 °C for rCsAbf62A and rCsAbf62A-cd. Optimal temperature was tested at pH 6.0 for all enzymes. The curves shown in C were obtained at 50 °C and pH 6.0 for rCsXyn10A and 30 °C and pH 5.5 for rCsAbf62A and rCsAbf62A-cd. Error bars indicate standard deviation of triplicates
Kinetic parameters of rCsXyn10A were calculated by monitoring the release of reducing sugars from increasing concentrations of BX by the DNS method (KM 7.87 ± 1.03 mg/mL) and of rCsAbf62A and rCsAbf62A-cd by measuring pNP released from pNPA (KM 2.47 ± 0.41 μM and 2.46 ± 0.60 μM, respectively). Data was fitted by nonlinear regression to the Michaelis–Menten model in all cases, suggesting a unique catalytic site with no secondary substrate binding sites (Fig. 3c).
Thermal stability was assayed by pre-incubation of the proteins at 30 to 50 °C for 4 to 24 h, prior to activity measurements (at optimal conditions for each enzyme). rCsXyn10A retained more than 80% activity after being pre-incubated at 40 °C for 24 h, indicating a high potential for application in bioprocesses at this temperature, while its activity significantly decreased after pre-incubation at 45 °C (retaining 30% activity after 24 h) and 50 °C (only 20% residual activity after 1 h) (Supplementary Fig. S4a). rCsAbf62A and rCsAbf62A-cd were active at lower temperatures than rCsXyn10A (Fig. 3) and also showed less thermal, with higher residual activity at 30 °C than at 40 °C (Supplementary Fig. S4c and e). The recombinant enzymes were active for at least 5 months stored at 4 °C, while they lost activity when stored at − 20 °C (without glycerol).
Melting curves of the recombinant proteins were analyzed by thermal shift assays, to further investigate their thermal stability. As there was a prediction of calcium binding sites for CsAbf62A (Supplementary Fig. S1), the effect of calcium was also tested. The Tm, without the addition of CaCl2, was 55° C, 40.9° C, and 41° C for rCsXyn10A, rCsAbf62A, and rCsAbf62A-cd, respectively. A positive shift of 3 °C was observed in the Tm (44.6° C) of both, rCsAbf62A and rCsAbf62A-cd, in the presence of 10 mM CaCl2, suggesting that Ca2+ reduces the sensitivity of these proteins to thermal inactivation (Supplementary Fig. S4d and f). The shoulder present in the melting curve of rCsAbf62A corresponds to the CBM13 module as it is not present in rCsAbf62A-cd profile. As expected, no differences were observed for rCsXyn10A. These results are consistent with the predicted calcium binding sites in CsAbf62A (absent in CsXyn10A). Also, hydrolytic activity of the proteins was analyzed in the presence of divalent ions. Activity of rCsXyn10A was not affected by the presence of Ca2+, Cu2+, Ni2+, and Mg2+, but it decreased significantly when incubated with Mn2+ and Co2+ (Supplementary Fig. S5). The increase in stability of rCsAbf62A and rCsAbf62A-cd in the presence of Ca2+ correlated with an improvement in activity, both at 30 and 40 °C (assayed on pNPA) (Supplementary Fig. S6).
Synergism in xylan degradation and substrate accessibility
Arabinose substitutions can hinder the hydrolytic activity of endo-1,4-β-xylanases and interfere with xylan depolymerization (Wong et al. 1988; Malgas and Pletschke 2019). Reaction products from WAX-lv hydrolysis using rCsXyn10A alone or in combination with rCsAbf62A or rCsAbf62A-cd were quantified by HPAEC-PAD and visualized by TLC. Our results showed that the release of X2 significantly increased when rCsAbf62A or rCsAbf62A-cd were added to rCsXyn10A (Table 2, Fig. 4a). Access to the substrate was also tested by investigating their combined ability to deconstruct arabino-xylo-oligosaccharides. Arabinose-substituted xylotriose (A3XX, XA3X, A2XX, or XA2X) and xylose (X1) were the main reaction products released from XA3XX and XAXX-mix by rCsXyn10A alone, whereas xylobiose (X2) was also released when rCsAbf62A, or rCsAbf62A-cd, was added to the reaction (Fig. 4b). These results confirm that the enzymatic removal of arabinose substitutions increases rCsXyn10A accessibility to the substrate and enhances its xylanase activity.
Hydrolysis of WAX-lv and AXOS by rCsXyn10A and rCsAbf62A or rCsAbf62A-cd. Soluble reaction products generated by recombinant proteins after incubation with WAX-lv (A) or AXOS (B) were visualized by TLC. Reactions were carried out using enzymes individually or combinations of rCsXyn10A with rCsAbf62A or rCsAbf62A-cd, as indicated ( +). XA3XX: xylotetraose with 1,3-linked Araf; XAXX mix: xylotetraose with 1,2- and 1,3-linked Araf
Wheat bran digestion assays
CsXyn10A and CsAbf62A were among the most abundant proteins in the extracellular enzymatic extract of Cellulomonas sp. B6 after growth in wheat bran (WB) as sole carbon source (Ontañon et al. 2021). WB is a composite that consists of layers of various tissues and the chemical fine structure of arabinoxylan varies in each layer. In addition to α-l-arabinofuranose substituents, some bran xylans contain complex sidechains and high content of ferulic acid esters residues (Saulnier et al. 2007). Composition analysis of the WB used for this study revealed a high arabinose content, with a ratio glucan:xylose:arabinose of 34:18:9.5 (Ontañon et al. 2021). We studied WB digestion by rCsXyn10A, rCsAbf62A, and rCsAbf62A-cd using as substrate the alcohol insoluble residue (AIR) of this biomass. The alcohol treatment of the biomass removes small sugars, proteins, nucleic acids, and lipids. When the enzymes were assayed individually, xylobiose was released from WB by rCsXyn10A and arabinose by rCsAbf62A and rCsAbf62A-cd (Fig. 5). Again, no effect of the CBM13 was observed for the release of arabinose from WB. When rCsXyn10A was assayed in combination with rCsAbf62A (or rCsAbf62A-cd) in the same proportion used for the WAX assay, the release of xylobiose remained unchanged, indicating that other factors, besides the single α-1,3- arabinose substitutions, may be acting as a bottleneck for deconstruction of this substrate. The presence of small phenolic compounds in WB, such as ferulic or p-coumaric acid, may also be interfering with the reaction (de Souza Moreira et al. 2013).
Wheat bran (WB) digestion by A rCsAbf62A or rCsAbf62A-cd and B rCsXyn10A. HPAEC-PAD of soluble reaction products generated by rCsXyn10A (0.1 μM) and rCsAbf62A or rCsAbf62A-cd (0.6 μM) after incubation with WB (5% w/v) (pH 6, 30 °C, 48 h). Retention times were compared against commercial arabinose (Ara) and xylobiose (X2) standards
Discussions
Cellulomonas sp. B6 is a Gram-positive actinobacterium closely related to Cellulomonas flavigena that has proven to be a very valuable source for the production of carbohydrate-active enzymes (CAZymes). It secretes several CAZymes, mainly active on hemicelluloses, with variable relative abundance depending on the available carbon source. Among the extracellular proteins, a GH10-CBM2 (rCsXyn10A) and a GH62-CBM13 (CsAbf62A) were identified in lignocellulosic biomass culture secretomes. These enzymes were highly abundant in wheat bran culture supernatant and less abundant in wheat straw and sugarcane straw supernatants (relative to all the secreted proteins), suggesting a preference for arabinoxylans (Piccinni et al. 2019; Ontañon et al. 2021). The most closely related homologues to these proteins in the Cellulomonas sp. reference strains were F4H4N7 (locus Celf_0088), from Cellulomonas fimi (83.1% identity, in 90% coverage, with rCsXyn10A), and D5UJU4 (locus Cfla_2848), from C. flavigena (75.4% identity, in 95% coverage, with CsAbf62A). These homologues have also been identified in studies of secretomes from common laboratory polysaccharide substrates (CMC and oat spelt xylan) cultures (Wakarchuk et al. 2016), which suggests they may play a core role in polysaccharides utilization.
In the present work, we demonstrated that rCsXyn10A has endo-1,4-β-xylanase activity (EC 3.2.1.8), with no additional glucanase or β-xylosidase activities, indicating it is an obligate xylanase. This is an important feature for eco-friendly pulp biobleaching applications, in which cellulase hydrolytic activity must be avoided to preserve cellulose fiber integrity (Walia et al. 2017). rCsXyn10A is active on different sources of xylan under moderate conditions (40 °C, pH 6), similarly to those reported for its C. fimi homologue (Khanna and Gauri 1993; Kane and French 2018).
As mentioned, Cellulomonas sp. B6 also secretes CsAbf62A when cultured using wheat bran as the sole carbon source. According to the CAZy database, only 5 bacterial (and 19 eukaryotic) GH62 enzymes out of 637 known curated entries (April 2022) have been fully characterized biochemically, and there are several differences regarding modular structure and activity among them (Wilkens et al. 2017). rCsAbf62A, similarly to most GH62s, is a type B α-l-arabinofuranosidase (ABF) (EC 3.2.1.55), as it was able to release arabinose decorations from AXOS as well as from the polymers, WAX and arabinan, and also had activity on pNPA, which is a variable feature for type B ABFs. The closest homologue to CsAbf62A characterized to date is an ABF from Streptomyces lividans, which also showed activity on xylan and arabinan decorations but very low activity towards pNPA (Vincent et al. 1997). rCsAbf62A was able to release both α-1,2 and α-1,3-linked arabinose from single but not double-substituted xylose residues and was also able to remove single arabinose substituents from arabinan, an activity that has been reported for some other GH62 enzymes, mostly with lower specific activity on arabinan than on arabinoxylan (Wilkens et al. 2017; Mroueh et al. 2019; Wang et al. 2014). Attempts have been made to classify GH62 in subfamilies (Siguier et al. 2014; Kaur et al. 2015), but most available information is related to sequence data and there is still not enough biochemical information to associate differences between the subfamilies with functional characteristics (Wilkens et al. 2017). Therefore, thorough biochemical characterization of GH62 enzymes is necessary to further characterize this family.
Structural analysis of GH62 ABFs showed that calcium ions bind to histidine in the conserved “SHG” motif stabilizing their tertiary conformation (Siguier et al. 2014; Tonozuka et al. 2017). The effect of this ion on the activity of GH62 proteins has had ambiguous results on other enzymes: Abf62C from Scytadilium thermophilum (Kaur et al. 2015), STX-IV from Streptomyces thermoviolaceus (Tsujibo et al. 2002), and CcAbf62A from Coprinopsis cinerea (Tonozuka et al. 2017) were enhanced by Ca2+, whereas activity of Abf62A from S. thermophilum was inhibited (Kaur et al. 2015). However, both catalytic activity and thermal stability of rCsAbf62A were improved in the presence of CaCl2. As biomass deconstruction requires multiple enzymes, the optimal calcium requirement would have to be established for each specific process, considering all enzymes involved.
According to Wilkens et al. (2017), 52% of GH62 members found in public databases (from 845 analyzed) have one or two xylan binding CBM13 domains. CBMs can be essential for efficient degradation of complex substrates by enabling enzyme substrate accessibility or by controlling the direction in which the enzymes move. However, no significant differences were observed in the substrate specificity or hydrolytic activity of the full-length enzyme when compared to the catalytic domain alone, in any of the conditions tested in this work. Further assays using more complex biomass substrates in high solid loading may help to unravel the contribution of the CBM13 module to the enzymatic degradation efficiency of CsAbf62A.
Modification of xylans or specific xylan structures is of interest to the biomass-processing industry to allow full biomass degradation (Smith et al. 2017). Thus, much effort has been dedicated to the biochemical characterization of endo-1,4-β-xylanases, mainly from families GH10 and GH11. However, there is a growing interest in understanding the mechanistic action of debranching enzymes that act on hemicellulolytic polymers and their synergistic action with xylanases. Enzymes from GH62 are receiving increased attention for their valuable potential to be used in industrial processes, especially for cereal-derived feedstocks, and most of the characterizations of these enzymes have focused on crystallographic structures, phylogenetics, and specificity on model substrates (Phuengmaung et al. 2018). Here, we have demonstrated the potential of rCsXyn10A and rCsAbf62A for biomass valorization efforts due to their ability to act on polymeric substrates and oligosaccharides. In particular, when harsh biomass pretreatment steps are replaced by milder hydrothermal pretreatment (HT), digestibility can be enhanced by coupling pretreatment to hemicellulose enzymatic hydrolysis. Also, the resulting liquid effluent is enriched in soluble xylan fragments and XOS, which could be then valorized in a C5-sugars utilization platform (Dutta et al. 2022). Synergic interactions were observed using AXOS and xylan, but not on wheat bran, indicating the importance of having a detailed knowledge of the substrate and the mechanism of action to adjust cocktail formulations in response to the composition and concentration of complex saccharide substrates in order to achieve full biomass conversion for enhanced utilization of C5 sugars in modern bio-refineries or functionalization of xylans for biomaterials and bioproducts. rCsXyn10A and rCsAbf62A have shown activity in a wide range of pH and temperature conditions, supporting their potential to be evaluated for food and feed bioprocesses, in which xylanses and ABFs are required, such as the production of prebiotic XOS or improving cereal based poultry feed (Alokika and Singh 2019; Poria et al. 2020).
Data availability
The complete sequences of CsXyn10A and CsAbf62A are available at GenBank under the accession numbers KSW20567.1 and KSW17752.1 and at UniProtKB under A0A0V8SJU5 and A0A0V8SBR8, respectively. The datasets used and/or analyzed in the current study are available from the corresponding author on reasonable request.
References
AlmagroArmenteros JJ, Tsirigos KD, Sønderby CK, Petersen TN, Winther O, Brunak S, von Heijne G, Nielsen H (2019) SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol 37(4):420–423. https://doi.org/10.1038/s41587-019-0036-z
Alokika, Singh B (2019) Production, characteristics, and biotechnological applications of microbial xylanases. Appl Microbiol Biotechnol 103:8763-8784. https://doi.org/10.1007/s00253-019-10108-6
Alonso DM, Bond JQ, Dumesic JA (2010) Catalytic conversion of biomass to biofuels. Green Chem 12:1493–1513. https://doi.org/10.1039/C004654J
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
Bachmann SL, McCarthy AJ (1991) Purification and cooperative activity of enzymes constituting the xylan-degrading system of Thermomonospora fusca. Appl Environ Microbiol 57:2121–2130
Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE (2000) The protein data bank. Nucleic Acids Res 28:235–242. https://doi.org/10.1093/nar/28.1.235
Campos E, Negro Alvarez MJ, Sabarís Di Lorenzo G, Gonzalez S, Rorig M, Talia P, Grasso D, Saéz F, Manzanares Secades P, Ballesteros Perdices M, Cataldi A (2014) Purification and characterization of a GH43 β-xylosidase from Enterobacter sp. identified and cloned from forest soil bacteria. Microbiol Res 169:213–220. https://doi.org/10.1016/j.micres.2013.06.004
De Man WL, Vaneeckhaute E, De Brier N, Wouters AGB, Martens JA, Breynaert E, Delcour JA (2021) 1H diffusion-ordered nuclear magnetic resonance spectroscopic analysis of water-extractable arabinoxylan in wheat (Triticum aestivum L.) flour. J Agric Food Chem 69(13):3912–3922. https://doi.org/10.1021/acs.jafc.1c00180
de Souza Moreira LR, de Carvalho CM, de Siqueira PH, Silva LP, Ricart CA, Martins PA, Queiroz RM, Filho EX (2013) Two β-xylanases from Aspergillus terreus: characterization and influence of phenolic compounds on xylanase activity. Fungal Genet Biol 60:46–52. https://doi.org/10.1016/j.fgb.2013.07.006
dos Santos CR, de Giuseppe PO, de Souza FHM, Zanphorlin LM, Domingues MN, Pirolla RAS, Honorato RV, Tonoli CCC, de Morais MAB, de Matos Martins VP, Fonseca LM, Büchli F, de Oliveira PSL, Gozzo FC, Murakami MT (2018) The mechanism by which a distinguishing arabinofuranosidase can cope with internal di-substitutions in arabinoxylans. Biotechnol Biofuels 11:223. https://doi.org/10.1186/s13068-018-1212-y
Drula E, Garron ML, Dogan S, Lombard V, Henrissat B, Terrapon N (2022) The carbohydrate-active enzyme database: functions and literature. Nucleic Acids Res 50:D571–D577. https://doi.org/10.1093/nar/gkab1045
Dutta N, Usman M, Luo G, Zhang S (2022) An insight into valorization of lignocellulosic biomass by optimization with the combination of hydrothermal (HT) and biological techniques: a review. Sustain Chem 3(1):35–55. https://doi.org/10.3390/suschem3010003
Fahlen J, Salmen L (2003) Cross-sectional structure of the secondary wall of wood fibers as affected by processing. J Mater Sci 38:119–126. https://doi.org/10.1023/A:1021174118468
Himmel (2008) Biomass recalcitrance; deconstructing the plant cell wall for bioenergy. Wiley-Blackwell, New Jersey
Humphrey W, Dalke A, Schulten K (1996) VMD - visual molecular dynamics. J Molec Graphics 14:33–38. https://doi.org/10.1016/0263-7855(96)00018-5
Kane SD, French CE (2018) Characterisation of novel biomass degradation enzymes from the genome of Cellulomonas fimi. Enzyme Microb Technol 113:9–17. https://doi.org/10.1016/j.enzmictec.2018.02.004
Kaur AP, Nocek BP, Xu X, Lowden MJ, Leyva JF, Stogios PJ, Cui H, Di Leo R, Powlowski J, Tsang A, Savchenko A (2015) Functional and structural diversity in GH62 α-L-arabinofuranosidases from the thermophilic fungus Scytalidium thermophilum. Microb Biotechnol 8(3):419–433. https://doi.org/10.1111/1751-7915.12168
Khanna S, Gauri (1993) Regulation, purification, and properties of xylanase from Cellulomonas fimi. Enzyme Microb Technol 15(11):990-995. https://doi.org/10.1016/0141-0229(93)90177-4
Kormelink FJM, Voragen AGJ (1993) Degradation of different [(glucurono)arabino]xylans by a combination of purified xylan-degrading enzymes. Appl Microbiol Biotechnol 38:688–695
Lagaert S, Pollet A, Courtin CM, Volckaert G (2014) β-Xylosidases and α-L-arabinofuranosidases: accessory enzymes for arabinoxylan degradation. Biotechnol Adv 32(2):316–332. https://doi.org/10.1016/j.biotechadv.2013.11.005
Long L, Sun L, Lin Q, Ding S, St John FJ (2020) Characterization and functional analysis of two novel thermotolerant α-L-arabinofuranosidases belonging to glycoside hydrolase family 51 from Thielavia terrestris and family 62 from Eupenicillium parvum. Appl Microbiol Biotechnol 104(20):8719–8733. https://doi.org/10.1007/s00253-020-10867-7
Maehara T, Fujimoto Z, Ichinose H, Michikawa M, Harazono K, Kaneko S (2014) Crystal structure and characterization of the glycoside hydrolase family 62 α-L-arabinofuranosidase from Streptomyces coelicolor. J Biol Chem 289(11):7962–7972
Malgas S, Pletschke BI (2019) The effect of an oligosaccharide reducing-end xylanase, BhRex8A, on the synergistic degradation of xylan backbones by an optimised xylanolytic enzyme cocktail. Enzyme Microb Technol 122:74–81. https://doi.org/10.1016/j.enzmictec.2018.12.010
Miller GL, Blum R, Glennon WE, Burton AL (1960) Measurement of carboxymethylcellulase activity. Anal Biochem 2:127–132. https://doi.org/10.1016/0003-2697(60)90004-X
Mroueh M, Aruanno M, Borne R, de Philip P, Fierobe HP, Tardif C, Pages S (2019) The xyl-doc gene cluster of Ruminiclostridium cellulolyticum encodes GH43- and GH62-α-L-arabinofuranosidases with complementary modes of action. Biotechnol Biofuels 12:144. https://doi.org/10.1186/s13068-019-1483-y
NCBI Resource Coordinators (2016) Database resources of the National Center for Biotechnology Information. Nucleic Acids Res 44(D1):D7–D19. https://doi.org/10.1093/nar/gkv1290
Ontañon O, Bedo S, Ghio S, Garrido M, Topalian J, Jahola D, Fehér A, Valacco P, Campos E, Fehér C (2021) Optimization of xylanases production by two Cellulomonas strains and their use for biomass deconstruction. Appl Microbiol Biotechnol 105:4577–4588. https://doi.org/10.1007/s00253-021-11305-y
Pauly M, Keegstra K (2008) Cell-wall carbohydrates and their modification as a resource for biofuels. Plant J 54(4):559–568. https://doi.org/10.1111/j.1365-313X.2008.03463.x
Perlin AS (1951) Isolation and composition of the soluble pentosans of wheat flours. Cereal Chem 28:370–381
Phuengmaung P, Kunishige Y, Sukhumsirichart W, Sakamoto T (2018) Identification and characterization of GH62 bacterial α-L-arabinofuranosidase from thermotolerant Streptomyces sp. SWU10 that preferentially degrades branched L-arabinofuranoses in wheat arabinoxylan. Enzyme Microb Technol 112:22–28. https://doi.org/10.1016/j.enzmictec.2018.01.009
Piccinni FE, Ontañon OM, Ghio S, Sauka DH, Talia PM, Rivarola ML, Valacco MP, Campos E (2019) Secretome profile of Cellulomonas sp. B6 growing on lignocellulosic substrates. J Appl Microbiol 126(3):811–825. https://doi.org/10.1111/jam.14176
Pitkanen L, Virkki L, Tenkanen M, Tuomainen P (2009) Comprehensive multidetector HPSEC study on solution properties of cereal arabinoxylans in aqueous and DMSO solutions. Biomacromol 10(7):1962–1969. https://doi.org/10.1021/bm9003767
Poria V, Saini JK, Singh S, Nain L, Kuhad RC (2020) Arabinofuranosidases: characteristics, microbial production and potential in waste valorization and industrial applications. Bioresour Technol 304:123019. https://doi.org/10.1016/j.biortech.2020.123019
Poutanen K, Puls J (1989) The xylanolytic enzyme system of Trichoderma reesei. In: Lewis G, Paice M (eds) Plant cell wall polymers, biogenesis and biodegradation. American Chemical Society, Washington DC, pp 630–640
Qaseem MF, Shaheen H, Wu A (2021) Cell wall hemicellulose for sustainable industrial utilization. Renew Sust Energy Rev 144 (110996). https://doi.org/10.1016/j.rser.2021.110996
Rogowski A, Briggs J, Mortimer J, Tryfona T, Terrapon N, Lowe E, Baslé A, Morland C, Day A, Zheng H, Rogers T, Thompson P, Hawkins A, Yadav M, Henrissat B, Martens E, Dupree P, Gilbert H, Bolam D (2015) Glycan complexity dictates microbial resource allocation in the large intestine. Nat Commun 6:7481. https://doi.org/10.1038/ncomms8481
Saha BC (2000) α-L-arabinofuranosidases: biochemistry, molecular biology and application in biotechnology. Biotechnol Adv 18:403–423. https://doi.org/10.1016/s0734-9750(00)00044-6
Saha BC (2003) Hemicellulose bioconversion. J Ind Microbiol Biotechnol 30(5):279–291. https://doi.org/10.1007/s10295-003-0049-x
Saulnier L, Sado PE, Branlard G, Charmet G, Guillon F (2007) Wheat arabinoxylans: exploiting variation in amount and composition to develop enhanced varieties. J Cereal Sci 46:261–281. https://doi.org/10.1016/j.jcs.2007.06.014
Siguier B, Haon M, Nahoum V, Marcellin M, Burlet-Schiltz O, Coutinho PM, Henrissat B, Mourey L, O’Donohue MJ, Berrin JG, Tranier S, Dumon C (2014) First structural insights into α-L-arabinofuranosidases from the two GH62 glycoside hydrolase subfamilies. J Biol Chem 289(8):5261–5273. https://doi.org/10.1074/jbc.M113.528133
Smith PJ, Wang HT, York WS, Peña MJ, Urbanowicz BR (2017) Designer biomass for next-generation biorefineries: leveraging recent insights into xylan structure and biosynthesis. Biotechnol Biofuels 10:286. https://doi.org/10.1186/s13068-017-0973-z
Tonozuka T, Tanaka Y, Okuyama S, Miyazaki T, Nishikawa A, Yoshida M (2017) Structure of the catalytic domain of α-L-arabinofuranosidase from Coprinopsis cinerea, CcAbf62A, provides insights into structure-function relationships in glycoside hydrolase family 62. Appl Biochem Biotechnol 181:511–525. https://doi.org/10.1007/s12010-016-2227-0
Tsujibo H, Takada C, Wakamatsu Y, Kosaka M, Tsuji A, Miyamoto K, Inamori Y (2002) Cloning and expression of an α-L-arabinofuranosidase gene (stxIV) from Streptomyces thermoviolaceus OPC-520, and characterization of the enzyme. Biosci Biotechnol Biochem 66(2):434–438. https://doi.org/10.1271/bbb.66.434
Vincent P, Shareck F, Dupont C, Morosoli R, Kluepfel D (1997) New α-L-arabinofuranosidase produced by Streptomyces lividans: cloning and DNA sequence of the abfB gene and characterization of the enzyme. Biochem J 322:845–852. https://doi.org/10.1042/bj3220845
Wakarchuk WW, Brochu D, Foote S, Robotham A, Saxena H, Erak T, Kelly J (2016) Proteomic analysis of the secretome of Cellulomonas fimi ATCC 484 and Cellulomonas flavigena ATCC 482. PLoS ONE 11(3):e0151186. https://doi.org/10.1371/journal.pone.0151186
Walia A, Guleria S, Mehta P, Chauhan A, Parkash J (2017) Microbial xylanases and their industrial application in pulp and paper biobleaching: a review. 3 Biotech 7(1):11. https://doi.org/10.1007/s13205-016-0584-6
Wang W, Mai-Gisondi G, Stogios PJ, Kaur A, Xu X, Cui H, Turunen O, Savchenko A, Master ER (2014) Elucidation of the molecular basis for arabinoxylan-debranching activity of a thermostable family GH62 α-L-arabinofuranosidase from Streptomyces thermoviolaceus. Appl Environ Microbiol 80(17):5317–5329. https://doi.org/10.1128/AEM.00685-14
Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T (2018) SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res 46(1):296–303. https://doi.org/10.1093/nar/gky427
Wilkens C, Andersen S, Dumon C, Berrin JG, Svensson B (2017) GH62 arabinofuranosidases: structure, function and applications. Biotechnol Adv 35(6):792–804. https://doi.org/10.1016/j.biotechadv.2017.06.005
Wong K, Tan L, Saddler J (1988) Multiplicity of β-1,4-xylanase in microorganisms: functions and applications. Microbiol Rev 52(3):305–317. https://doi.org/10.1128/mr.52.3.305-317.1988
Zhao X, Zhang L, Liu D (2012) Biomass recalcitrance. Part I: the chemical compositions and physical structures affecting the enzymatic hydrolysis of lignocellulose. Biofuels Bioprod Bioref 6:465–482. https://doi.org/10.1002/bbb.1331
Acknowledgements
M. L., A. C., S. A. W., and E. C. acknowledge the National Research Council of Argentina (CONICET) as Research Career Scientists. M. G. and J. T. hold PhD fellowships from CONICET. M. G. was recipient of a Visiting Scholar Fulbright Grant (2021) for a 3-month visit to BRU Lab at CCRC (Univ. of Georgia, USA). B. R. U. and M. J. P. are supported by the Center for Bioenergy Innovation (CBI), a U.S. Department of Energy Bioenergy Research Center supported by the Office of Biological, Environmental Research in the DOE Office of Science. B. R. U. also received support from the Chemical Sciences, Geosciences and Biosciences Division, Office of Basic Energy Sciences, U.S. Department of Energy Grant (DESC0015662) at the Complex Carbohydrate Research Center.
Funding
This study was funded by Grants PICT2018-2983 and PICT2019-1474 (from the National Agency for Science and Technology Promotion from Argentina, ANPCyT) and Grant 20020130100476BA (from the University of Buenos Aires).
Author information
Authors and Affiliations
Contributions
M. M. G., E. C., M. J. P., and B. R. U. conceived and designed research and wrote the initial manuscript. M. M. G., F. E. P., M. L., M. J. P., J. T., and E. C. generated data and interpreted results. A. C. and S. A. W. discussed, analyzed, and interpreted data. All authors edited and commented on the manuscript. All authors reviewed and approved the final manuscript.
Corresponding author
Ethics declarations
Ethical approval
This article does not contain any studies with human participants or animals performed by any of the authors.
Conflict of interest
The authors declare no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Below is the link to the electronic supplementary material.
Rights and permissions
About this article
Cite this article
Garrido, M.M., Piccinni, F.E., Landoni, M. et al. Insights into the xylan degradation system of Cellulomonas sp. B6: biochemical characterization of rCsXyn10A and rCsAbf62A. Appl Microbiol Biotechnol 106, 5035–5049 (2022). https://doi.org/10.1007/s00253-022-12061-3
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00253-022-12061-3