Abstract
The current study aimed to investigate the sequence variations of HPV 51 and 59 in normal cervical cells and premalignant/malignant lesions of the cervix to know the common variants of HPV 51 and HPV 59 circulating in Iran. To do this, eighty-five samples that were infected by HPV 51 or HPV 59 were investigated using hemi-PCR to amplify the E6 gene followed by sequencing. Our findings indicated that lineages A and B were detected in 80.4% and 19.6% of HPV 51-positive cases, respectively. Among samples infected with HPV 59, 32.2% belonged to lineage A and 67.8% were classified with lineage B. In conclusion, our results showed that lineage A of HPV 51 and lineage B of HPV 59 are more prevalent and distributed in Iran.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Human papillomavirus (HPV) is the most common sexually transmitted infection in the world [1]. HPV can cause several cancers, including cancer of the cervix, vulva, vagina, penis, anus, or head and neck [2,3,4,5,6]. HPV has more than 400 distinct HPV types, among which almost 50 types can infect the mucosa of anogenital areas [7]. Nevertheless, 14 HPV types, including HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68 are considered to be high-risk (HR)-HPV types which can persistent and consequently lead to the development of above-mentioned cancers, particularly cervical cancer [8,9,10,11]. The ten most common HPV types are HPV 16, 18, 45, 33, 31, 58, 52, 35, 59, and 56 in cervical cancer with frequency of 55.4%, 16.1%, 4.7%, 4.1%, 3.8%, 3%, 2.8%, 1.9%, 1.2%, and 0.9%, respectively, worldwide [12]. The ten most frequent HPV types among Iranian women with cervical intraepithelial neoplasia 2–3 (CIN 2–3) were reported to be HPV 16 (48%), 18 (10%), 31 (7%), 45 (5%), 39 (4%), 33 (3%), 58 (3%), 35 (2%), 51 (2%), and 52 (2%) [13].
When the DNA sequence of the L1 gene is different more than 10% from each other, it is designated to be a distinct HPV type. Within a given type, the difference of 1–10% and 0.5–1% through the complete genome was called lineage and sublineage, respectively. HPV 51 has two lineages, including A and B, and six distinctive sublineages comprising A1, A2, A3, A4, B1, and B2. HPV 59 consists of two lineages A and B that Lineage A grouped into three different sublineages A1, A2, and A3 [14].
Studies suggest that the distinct lineages and sublineages of HPVs are different geographical distributions and may be associated with ethnicity. Indeed, the geographic associations for the different lineages and sublineages of HPV 16, 18, and 58 are well-documented [10, 15,16,17,18,19]. However, geographic associations for other HPV types such as HPV 51 and 59 are not well-documented. In this regard, further studies are mandatory in the world to elucidate whether there is an association between the distinctive lineages and sublineages of these HPV types and ethnicity or not.
While the distribution of HPV types is well-recognized [13], few studies carried out to investigate the lineages and sublineages of HR-HPV types in Iran including HPV 16, 18, 31, 45, 39, 56 [18, 20,21,22,23] and HPV 52/58 (unpublished data). The characterization of lineage and sublineage of HR-HPV types is helpful for future studies on different aspects, including epidemiology, evolution, pathogenicity, and biology. In line with these, this study carried out a nucleotide sequence analysis to find the circulating HPV 51 and HPV 59 lineages and sublineages in Iran.
Materials and methods
Study population
To characterize the lineages and sublineages of HPV 51 and HPV 59, a study was conducted from 2018 to 2020. One-hundred and forty-two formalin-fixed paraffin-embedded (FFPE) samples (98 invasive cervical cancer and 44 cervical intraepithelial neoplasia including 27 CIN 1 and 17 CIN 2–3 samples) were obtained from Immam-Khomeini Hospital in Tehran. One-hundred and thirty-five ThinPrep Pap Test samples were HPV positive as a pooled of 12 high-risk HPVs (31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) and were detected using Cobas assay were included. Forty-four HPV 51- and twenty-two HPV 59-positive ThinPrep Pap Test samples (previously genotyped among 1000 samples by INNO-LiPA® HPV Genotyping assay) were also collected from referral laboratories in Tehran.
The informed consent that was approved by the local ethical committee of Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1400.284) was signed by all participants of this study. The demographic data were obtained from their medical records.
Lineage and sublineage analysis of HPV 51 and HPV 59
DNA was extracted from ThinPrep Pap Test samples by the High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions. DNA from FFPE specimens was isolated using phenol–chloroform assay according to a previously published procedure [24].
One-hundred and forty-two FFPE samples were screened to detect the HPV genome using nested-PCR with MY09/MY11 and GP5+/GP6+ primer pairs targeting a 150 bp amplicon of L1 gene. All HPV-positive samples were directed to nucleotide sequencing by BigDye® Terminator v3.1 Cycle Sequencing Kit and a 3130 Genetic Analyzer Automated Sequencer as specified by Applied Biosystems manuals (Foster City, CA). Using Bioedit software, all sequences were edited and blasted in http://www.ncbi.nlm.nih.gov/blast/) to find HPV genotypes. All 135 ThinPrep Pap Test specimens which were positive as the pooled of 12 high-risk HPVs using Cobas assay were tested to detect HPV 51 and HPV 59 genome using hemi-nested PCR with sequence-specific primers of E6 gene as described below.
The complete E6 gene of HPV 51 (nucleotide [nt] 97-552) and partial sequence of Long Control Region (LCR) and E7 gene of HPV 51 was amplified by semi-nested PCR with the following primer pairs: GGTGTAACCGAAAAGGGTT (51E6-F1), CCGAAAAGGGTTATGACCGA (51E6-F2), and AGCTGTCAAATTGCTCGTAG (51E6-R) to obtain a 622 bp amplicon. The complete E6 gene of HPV 59 (nucleotide [nt] 55-537) also was tested by semi-nested PCR using following primer pairs: AAGACCGAAAACGGTGCATA (59E6-F), AATTGCTCGTAGCACACAAGG (59E6-R1), and AGTGTTGCTTTTGGTCCATGC (59E6-R2) to amplify a 561 bp fragment. The PCR reaction for both HPV 51 and 59 was performed in a 50 μl reaction mixture including 2 mM MgCl2, 50 μM of each dNTP, 10 pmol of each primer, 1.5 U of Taq DNA polymerase, and 100 ng of DNA template. The thermal cycling steps were as follows for the first and second rounds: 35 cycles of 95 °C for 30 s, 55 °C for 50 s, and 72 °C for 50 s and 35 cycles of 95 °C for 20 s, 55 °C for 40 s and 72 °C for 40 s, respectively. In every set of PCR runs, a reaction mixture lacking template DNA was included as a negative control. All the PCR products were direct to sequence by bidirectional direct sequencing as mentioned above.
To characterize HPV 51 and HPV 59 lineages and sublineages, the sequences of all studied samples were aligned to reference sequences HPV 51 and HPV 59, respectively. Reference sequences of HPV 51 including M62877 (A1), KF436870 (A2), KF436873 (A3), KF436875 (A4), KF436883 (B1), and KF436886 (B2) and reference sequences of HPV 59 were X77858 (A1), KC470261 (A2), KC470263 (A3), and KC470264 (B) [14]. The phylogenetic tree was built using the maximum likelihood method by Mega software version 11. The reliability of the phylogenetic tree was measured by the calculation of bootstrap with 1000 replicates.
Statistical analysis
The statistical analysis was achieved using Fisher’s exact test (Epi Info 7, Statistical Analysis System Software) and when the P-value was less than 0.05, it was considered to be statistically significant.
Results
Among 142 FFPE specimens, HPV 51 and 59 were detected in 1 (0.7%) and 4 (2.8%) of samples, respectively. Also, among 135 ThinPrep Pap Test specimens that were screened for these two types, HPV 51 and 59 were found in 6 (4.4%) and 8 (5.9%) samples, respectively. To determine the lineages and sublineages, in total, 51 HPV 51-infected specimens [CIN 2–3 (HSIL)/ICC = 9, CIN 1 (LSIL) = 8, and normal = 34 samples] and 34 HPV 59-positive samples [CIN 2–3 (HSIL)/ICC = 7 CIN 1 (LSIL) = 4, and normal = 23 samples] were included in this study.
Lineage analysis of HPV 51 showed that both the A and B lineages were found in our samples. The A lineage was detected in 41 out of 51 HPV 51-infected samples (80.4%) and the remaining samples were infected with the B lineage (19.6%). Among samples that were infected with the A lineage, all four different sublineages were detected as follows: the lineage A1 in 53.7%, A2 in 12.2%, A3 in 2.4%, and A4 in 31.7% (Fig. 1 and Table 1). Among samples that were infected with B lineage, sublineage B2 was dominant (70%) and in 30% of them, lineage B1 was detected. In total, the frequency of distinct sublineages was 43.2% (A1), 8.9% (A2), 1.9% (A3), 25.5% (A4), 5.9% (B1), and 13.7% (B2) (Table 1). Our results indicated sublineages A1 and A4 were dominant in Iran.
Sequence analysis of all samples showed that the nucleotide substitutions against the prototype sequence (M62877) were observed in 29 samples. These substitutions were happened in 10 positions including C71A/G, A72T, and T74A of LCR; C102T, T150C, T240C, A311G, and C395T of E6 gene; A584C and G656A of E7 gene (Table 1). Of seven nucleotide changes in E6/E7 genes, four changes at the positions A311G, C395T (E6 gene), A584C, and G656A (E7 gene) were non-synonymous and led to amino acid changes at positions of K72R and S100L of E6 protein and K9Q and E33K of E7 protein, respectively. The amino acid substitution at position S100L of E6 protein was more prevalent than other amino acid changes as it was found in 20 out of 51 (39.2%) samples, followed by E33K (15.7%), K72R (5.9%), and K9Q (5.9%).
Looking at the HPV 51 variants found in this study, seven different nucleotide substitution patterns were detected as follow: No change (43.2%), C71A/T74A (3.9%), C71G/T74A (5.9%), C71G/A72T/G656A (1.9%), C71G/C395T (25.5%), C71A/C102T/T150C/T240C/A311G/A584C (5.9%), and C71G/C102T/T240C/C395T/G656A (13.7%) (Table 1).
Stratification of sequences by histology/cytology status showed that although the A lineage was more prevalent among the CIN 2–3 (HSIL)/ICC group, a statistically significant difference was not observed (P = 0.74). About age groups, no statistically significant differences were found between the two studied groups (P = 0.99) (Table 2).
Concerning the lineage investigation of HPV 59, our findings indicated that 32.2% of samples (11 out of 34 specimens) belonged to the A lineage and 67.8% of samples (23 out of 34 samples) were classified with the B lineage. All of the samples that were infected with the A lineage belonged to the A1 sublineage (Table 3, Fig. 2).
Eight nucleotide substitutions against prototype sequence (X77858) were found in this study at positions of T102C, G171T, T213C, G252C, C306T, A348G, T402C, and A403G. Among these, only the change of A to G at position 403 led to amino acid substitution at K117E of E6 protein and the other changes were silent mutations. As revealed in Table 3, seven distinct nucleotide substitution patterns were found in this study as follows: no change (32.2%), T102C/C306T/T402C (27%), T102C/G171T/C306T/T402C (27%), T102C/G252C/C306T/T402C (2.9%), T102C/T213C/C306T/T402C (2.9%), T102C/C306T/A348G/T402C (2.9%), and T102C/C306T/T402C/A403G (5.9%).
Stratification by histology/cytology status showed that the A lineage was more common in the normal group while the B lineage was more prevalent in the CIN 1 (LSIL) group. However, no statistically significant differences were observed (P = 0.90). Regarding age groups, no statistically significant difference was also found between the two groups (P = 0.78).
Discussion
In this study was found that 80.4% and 19.6% of HPV 51-infected samples belonged to the A and B lineages, respectively. All sublineages of A1, A2, A3, A4, B1, and B2 were detected in our samples. However, sublineages A1 (43.21%) and A4 (25.5%) were more prevalent than other sublineages (Fig. 1 and Table 1). This finding is almost in agreement with several previous studies. The result of one study from North America was shown that the A lineage is dominant and the B lineage was detected in fewer samples. Among distinct sublineages, A1 was common (73.4%) followed by A2 (20.1%), A3 (4.9%), and B (1.6%) [25]. A study from Costa Rica showed that both the lineage A (68.9%) and B (31.1%) distributed in this country and common sublineages were as follows: A1 (58%), A2 (8.7%), A4 (2.2%), and B1 (31.1%) [26]. A study from China reported that only the A lineage was detected and the B lineage was not present in China. Sublineage A4 was dominant (54.5%) and two sublineages of A1 and A2 were found in 9% and 36.5% of specimens, respectively [27]. In another study from Southwest China, sublineages A1, A2, and A4 were shown in 15%, 50%, and 35% of samples [28]. Conversely, the B lineage and sublineages of B2 were predominant in African countries [26]. Thoroughly, the results of these studies have revealed that common sublineages in the world were as follows: A1 in North America, A1 and B1 in Costa Rica, A2 and A4 in China, A1 and A4 in Iran, and B2 in Africa (Fig. 3). This diverse geographical distribution of distinct HPV 51 lineages and sublineages in the world, can reflect the coevolution of them with host ethnicity.
In the present study, the difference in distinct lineages among the three studied groups did not reach a statistically significant level and the A lineage was prevalent in all three groups (Table 2). Interestingly, in Costa Rica where both lineages of A and B are co-circulating, was shown the B lineage may have more chance to progress cervical intraepithelial lesion 3 (CIN 3) in comparison to the A lineage [29].
Our results indicated that in 45.1% of samples amino acid changes happened.
The change of Serine to Leucine at position 100 (S100L) of E6 protein was the most common substitution. In agreement with our results, the amino acid change of S100L was reported as the most prevalent substitution. This substitution is designated to both the sublineages A4 and B2 which are more distributed in China and Africa, respectively [28].
About the lineage analysis of HPV 59, our results showed that 32.2 and 67.8% of samples belonged to lineages A and B, respectively. All of the samples that were infected with A lineage were the A1 sublineage (Table 3, Fig. 2). In North America, the lineages of A and B were found in 12% and 88% of samples, respectively [25]. In China, the lineages A and B were reported in 53.8% and 46.2% of samples, respectively. Different sublineages were detected as follows: A1 in 30.8%, A3 in 23%, and B in 46.2% of specimens [27]. The B lineage was common in Africa and the A lineage was prominent in Costa Rica [30] (Fig. 4).
Regarding the fact that no association was observed between HPV 51 or HPV 59 variants with pathological stages, it is more likely that the low sample size does not allow for observed major differences (Table 4).
Conclusion
Our results showed that the A lineage, sublineages of A1 and A4, of HPV 51 are more prevalent and distributed in Iran. Concerning HPV 59, both lineages A and B were detected in our samples. However, further studies with larger sample sizes are mandatory to estimate the pathogenicity risk of HPV 51 and 59 variants in Iran. The integration status of these types into the host genome can be examined in the future. It is highly recommended that the characterization of HLA molecules in different HPV 51 and 59 variants be considered in future studies.
Data availability
The sequences were deposited into the GenBank database [Home—Nucleotide—NCBI (nih.gov)] with the following accession numbers OQ401161-OQ401245.
References
Forman D et al (2012) Global burden of human papillomavirus and related diseases. Vaccine 30(Suppl 5):F12–F23
de Martel C et al (2017) Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int J Cancer 141(4):664–670
Szymonowicz KA, Chen J (2020) Biological and clinical aspects of HPV-related cancers. Cancer Biol Med 17(4):864–878
Álvarez-Argüelles ME et al (2013) Human papillomavirus infection in a male population attending a sexually transmitted infection service. PLoS ONE 8(1):e54375
Yu YB et al (2019) The relationship between human papillomavirus and penile cancer over the past decade: a systematic review and meta-analysis. Asian J Androl 21(4):375–380
Preti M et al (2020) Role of human papillomavirus infection in the etiology of vulvar cancer in Italian women. Infect Agent Cancer 15:20
Doorbar J et al (2015) Human papillomavirus molecular biology and disease association. Rev Med Virol 25:2–23
Bouvard V et al (2009) A review of human carcinogens–part B: biological agents. Lancet Oncol 10(4):321–322
Munoz N et al (2006) Chapter 1: HPV in the etiology of human cancer. Vaccine 24(Suppl 3):S1–S10
Arroyo SL et al (2012) Human Papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain. Virol J 9:258
de Villiers EM et al (2004) Classification of papillomaviruses. Virology 324(1):17–27
Zhai L, Tumban E (2016) Gardasil-9: a global survey of projected efficacy. Antiviral Res 130:101–109
Salavatiha Z et al (2021) A meta-analysis of human papillomavirus prevalence and types among Iranian women with normal cervical cytology, premalignant lesions, and cervical cancer. J Med Virol. https://doi.org/10.1002/jmv.26928
Burk RD, Harari A, Chen Z (2013) Human papillomavirus genome variants. Virology 445(1–2):232–243
Xi LF et al (2006) Human papillomavirus type 16 and 18 variants: race-related distribution and persistence. J Natl Cancer Inst 98(15):1045–1052
Burk RD et al (2003) Distribution of human papillomavirus types 16 and 18 variants in squamous cell carcinomas and adenocarcinomas of the cervix. Cancer Res 63(21):7215–7220
Freitas LB et al (2014) Human papillomavirus 16 non-European variants are preferentially associated with high-grade cervical lesions. PLoS ONE 9(7):e100746
Vaezi T et al (2017) Human papillomavirus type 16 lineage analysis based on E6 region in cervical samples of Iranian women. Infect Genet Evol 55:26–30
Chen Z et al (2017) Ancient evolution and dispersion of human papillomavirus 58 variants. J Virol 91(21):e01285-e1317
Salavatiha Z et al (2020) Lineage analysis of human papillomavirus type 18 based on E6 region in cervical samples of Iranian women. J Med Virol. https://doi.org/10.1002/jmv.26283
Hosseini N et al (2021) Lineage analysis of human papillomavirus types 31 and 45 in cervical samples of Iranian women. J Med Virol 93(6):3857–3864
Hosseini N et al (2021) Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women. Virol J 18(1):152
Jalali-Alhosseini P et al (2021) Lineage and sublineage analysis of human papillomavirus type 56 in cervical samples of Iranian women. J Med Virol 93(11):6412–6417
Jalilvand S et al (2012) Molecular epidemiology of human herpesvirus 8 variants in Kaposi’s sarcoma from Iranian patients. Virus Res 163(2):644–649
Xi LF et al (2014) Lineages of oncogenic human papillomavirus types other than type 16 and 18 and risk for cervical intraepithelial neoplasia. J Natl Cancer Inst 106(10):dju270
Chen Z et al (2018) Classification and evolution of human papillomavirus genome variants: alpha-5 (HPV26, 51, 69, 82), alpha-6 (HPV30, 53, 56, 66), alpha-11 (HPV34, 73), alpha-13 (HPV54) and alpha-3 (HPV61). Virology 516:86–101
Zhao J et al (2019) Phylogeny and polymorphism in the E6 and E7 of human papillomavirus: alpha-9 (HPV16, 31, 33, 52, 58), alpha-5 (HPV51), alpha-6 (HPV53, 66), alpha-7 (HPV18, 39, 59, 68) and alpha-10 (HPV6, 44) in women from Shanghai. Infect Agents Cancer 14(1):1–11
Xu J et al (2019) Genetic variability of human papillomavirus type 51 E6, E7, L1 and L2 genes in Southwest China. Gene 690:99–112
Schiffman M et al (2010) A population-based prospective study of carcinogenic human papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer Res 70(8):3159–3169
Chen Z et al (2013) Evolution and taxonomic classification of alphapapillomavirus 7 complete genomes: HPV18, HPV39, HPV45, HPV59, HPV68 and HPV70. PLoS ONE 8(8):e72565
Funding
This study has been funded and supported by the Tehran University of Medical Sciences (TUMS), Grant no. (1401-2-340-56210). It has also been part of a MSc thesis supported by Tehran University of Medical Sciences; Grant no. 240/779.
Author information
Authors and Affiliations
Contributions
SJ designed and directed the project; KS carried out experimental data; ZS performed the analysis and; SJ and ZS were involved in drafting the manuscript.
Corresponding author
Ethics declarations
Conflict of interest
The authors declare that they have no conflict of interest.
Ethical approval
Not Applicable.
Additional information
Edited by Juergen Richt.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.
About this article
Cite this article
Sharifian, K., Shoja, Z. & Jalilvand, S. Lineage and sublineage analysis of human papillomavirus types 51 and 59 in Iranian women. Virus Genes 60, 455–463 (2024). https://doi.org/10.1007/s11262-024-02089-0
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s11262-024-02089-0