Introduction

The family Rhodobacteraceae, is one of the morphologically, physiologically and ecologically diverse subgroups of Alphaproteobacteria. They are characterised with phototrophy, methylotrophy, organic sulfur metabolism, carbon monoxide oxidation, presence of poly-β-hydroxybutyrate (PHB) granules, and the production of secondary metabolites (Pujalte et al. 2014). Members of Rhodobacteraceae inhabit a wide range of ecological niches including water, sediments, sea ice etc. (Lai et al. 2013). In recent years, many novel genera belonging to the family Rhodobacteraceae have been described such as Albirhodobacter (Nupur et al. 2013), Aliiroseovarius (Park et al. 2015b), Cereibacter (Suresh et al. 2015), Frigidibacter (Li and Zhou 2015), Halovulum (Sun et al. 2015), Nioella (Rajasabapathy et al. 2015), Pontivivens (Park et al. 2015c), Pseudohalocynthiibacter (Won et al. 2015), Pseudooceanicola (Lai et al. 2015), Pseudooctadecabacter (Billerbeck et al. 2015), Pseudoseohaeicola (Park et al. 2015a) and Thiobacimonas (Li et al. 2015). At the time of writing this manuscript nearly 121 genera have been reported under the Rhodobacteraceae family.

Here we describe a pink-pigmented bacterial strain designated MCCB 386T, isolated from the sediment collected from an Arctic fjord, Kongsfjorden, Svalbard. Through polyphasic taxonomic approach, which included determination of its phenotypic and chemotaxonomic characteristics along with genomic analysis, we confirmed that, the strain MCCB 386T represents a novel genus and species under Rhodobacteraceae family for which the name Roseitranquillus sediminis gen. nov., sp. nov. is proposed. The genomic analysis was performed to reveal the biosynthetic potential of the strain MCCB 386T for the production of novel secondary metabolites.

Materials and methods

Strain isolation

Sediment samples were collected from Kongsfjorden (78°57′31.2″N and 11°49′20.5″E), an Arctic fjord in Ny-Ålesund, Svalbard in June 2014 using a Van Veen grab sampler. The samples were shipped to National Centre for Aquatic Animal Health, India under cold conditions. Isolation of bacteria was done by spread plate method using Nutrient Agar (NA) media prepared in seawater (35 ppt) and incubated at 20 °C for 14 days. Gram straining was performed using standard methods. Motility was determined by microscopic examinations of wet mounts of strains and stab inoculation on a semisolid agar medium (0.3% agar) in a test tube using 24 h old culture and incubated at 24 °C. Cell morphology was observed under scanning electron microscope after cells were negatively stained with 1% (w/v) phosphotungstic acid. To test growth under anaerobic conditions, bacterial strains were cultured on nutrient broth with cysteine (0.01%, w/v) and overlaid with paraffin oil and incubated at 24°C for one month. The temperature range for growth was determined in nutrient broth by incubating the cultures at different temperatures ranging from 4 to 45°C.

Phenotypic characterisation and Chemotaxonomic characterisation

Growth at different salt concentrations (1–12% NaCl) and pH ranges (4.0–11.0 at an interval of 0.5) were investigated. The following phenotypic tests were carried out according to standard procedures using sterile seawater as basal medium: catalase and oxidase activities, DNase activity, urease, MOF, alkaline phosphatase, nitrate reduction, Voges-Proskauer test, methyl-red test, indole production, citrate utilisation, ONPG, acid production from carbohydrates and hydrolysis of compounds including starch, CM-cellulose, casein and gelatin were recorded. Degradation of chitin was examined on chitin agar with sterile seawater (Hsu and Lockwood 1975). Biochemical tests were performed using Biolog GN2 (Biolog, Inc., USA) microplate following the manufacturer’s protocol. Substrates were categorised as carbohydrates, amino acids, esters, fatty acids, alcohols, amines, amides, polymers and carboxylic acids. Analysis of fatty acids, respiratory quinones and polar lipids were carried out at DSMZ, Germany.

16 S rRNA gene sequence and phylogeny analysis

Genomic DNA (gDNA) of strain MCCB 386T was extracted using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, USA). PCR amplification of 16 S rRNA gene was carried out using universal primers 16S1 (GAGTTTGATCCTGGCTCA) and 16S2 (ACGGCTACCTTGTTACGACTT). Sequencing was performed on Genetic Analyzer 3500 (Applied Biosystems, Carlsbad, CA, USA). An almost-complete 16 S rRNA gene sequence (1439 nt) obtained was submitted to the GenBank database (Accession Number: MK417831). Pairwise similarity values between strain MCCB 386T and the closely related type strains were calculated using the EzTaxon-e server (Yoon et al. 2017). In addition, the taxonomic assignment of strain MCCB 386T was performed using the RDP naive Bayesian rRNA Classifier tool based on 80% confidence threshold (Wang et al. 2007).

The 16 S rRNA gene sequences of closely related type strains were retrieved from the NCBI database and aligned with strain MCCB 386T using Clustal W (Larkin et al. 2007). Phylogenetic trees based on the neighbour-joining (NJ), maximum-likelihood (ML) and maximum-parsimony (MP) algorithms were reconstructed using the software package MEGA version X (Stecher et al. 2020). The genetic distances were calculated by Kimura’s two-parameter model (Kimura 2020) form the NJ and ML trees. Bootstrap analysis of the trees topologies were performed by using 1000 replicates (Felsenstein 1985).

Whole Genome sequencing and Genomic analysis

The whole genome of strain MCCB 386T was sequenced using pair-end sequencing on Illumina HIseq 2500. The quality of genome was analysed using FastQC tool (https://www.bioinformatics.babraham.ac.uk/projects/fastqc). The assembly was performed using Velvet v. 1.2.10 (Zerbino and Birney 2008) and the quality of the assembled genome was evaluated using combination of QUAST version 5.0.0 (Gurevich et al. 2013) and the DFAST web server. Gene search and annotation were performed using the Prokka package v 1.14.5 (Seemann 2014) and RAST server (Overbeek 2005). For analysis of genome relatedness, the whole genome sequences of closely related species like Rhodovulum adriaticum DSM 2781T, Rhodovulum marinum DSM 18,063T, Rhodovulum strictum DSM 11,289T, Rhodovulum steppense DSM 21,153T, Rhodovulum sulfidophilum DSM 1374T, Tranquillimonas alkanivorans DSM 19,547T, Dinoroseobacter shibae DSM 16,493T, Roseivivax marinus DSM 27,511T and Tropicimonas isoalkanivorans DSM 19,548T were retrieved from the GenBank database. The in silico DNA-DNA hybridisation (dDDH) was calculated with the formula 2 model on the Genome-to-Genome Distance Calculator (GGDC 2.1) web tool (http://ggdc.dsmz.de/distcalc2.php) (Auch et al. 2010; Meier-Kolthoff et al. 2013) and the Average Nucleotide Identity (ANI) based on BLAST (OrthoANIb) was calculated and heatmap generated using OAT software (Lee et al. 2016). Tetra-nucleotide signatures correlation indexes (Tetra) were calculated using JSpecies (Richter and Rosselló-Móra 2009) and Jspecies WS (http://jspecies.ribohost.com/jspeciesws/#Analyse) (Richter et al. 2016). CompareM tool (https://github.com/dparks1134/CompareM) was used for calculating the Average Amino acid Identity (AAI) (Konstantinidis and Tiedje 2005). POCP (Qin et al. 2014) was calculated using GET_HOMOLOGUES tool version 3.3.4 (Contreras-Moreira and Vinuesa 2013). Heatmaps visualising the dDDH values (%), Tetra, AAI and POCP were rendered in R programme version 4.0.2 (packages ‘ggplot2’ (Wickham 2016) and ‘pheatmap’ (Kolde 2015). The potential for the production of secondary metabolites by MCCB 386T was analysed using antiSMASH 5.0 (Blin et al. 2019).

Phylogenomic analysis

The Genome Taxonomy Database toolkit (GTDB-Tk) V 1.4.1) (Chaumeil et al. 2019), release 05-RS95 (https://github.com/Ecogenomics/GTDB-Tk) (Parks et al. 2020), was used to identify the 120 conserved single-copy genes in strain MCCB 386T and phylogenetically related Rhodobacteraceae. These multiple alignment of concatenated single-copy gene sequences built in GTDB-Tk was used to construct a phylogenetic tree in IQ-Tree (Nguyen et al. 2015) and the best-fit model LG + F + R4 as selected by the ModelFinder (Kalyaanamoorthy et al. 2017) in IQ-Tree. Node support was tested using the ultrafast bootstrapping (Hoang et al. 2018) based on 1000 trials. The resulting Newick tree was imported into MEGA X (Stecher et al. 2020) for visualisation.

Results

Strain identification and taxonomic identification

A pink pigmented colony of strain MCCB 386T was isolated from the sediment samples collected from an Arctic fjord Kongsfjorden (78°57′31.2″N and 11°49′20.5″E), in Ny-Ålesund, Svalbard. Pairwise comparison of the 16 S rRNA gene sequence with the GenBank database using the BLASTN program (Altschul et al. 1990) revealed that the new isolate MCCB 386T was closely related to species within the Rhodobacteraceae family, showing sequence similarities with genera such as Psychromarinibacter halotolerans YBW34T (95.88%), Tranquillimonas (92.72–94.81%), Rhodovulum (93.03–95.44%), Roseivivax (94.05–94.23%) and Tropicimonas (92.90–94.20%). The 16 S rRNA gene sequences based neighbour-joining phylogenetic tree showed that the strain MCCB 386T formed a distinct lineage among the most closely related genera of the family Rhodobacteraceae (Fig. 1). Phylogenetic analysis based on the NJ method (Fig. 1) showed that strain MCCB 386T joined Tranquillimonas alkanivorans A34T with a quite low bootstrap resampling value of 44%. While ML and MP trees (Fig. S1 and Fig. S2) showed that strain MCCB 386T formed a distinct lineage within the clade of family Rhodobacteraceae, without joining any genera in this family. The taxonomic analysis using the RDP (Ribosomal Data Project) Classifier tool (Maidak 2000) also indicated that strain MCCB 386T should be classified as an unclassified member under the family Rhodobacteraceae. Hence, the strain MCCB 386T cannot be assigned to any of the validly published taxa at both the species and genus levels.

Fig. 1
figure 1

Neighbour-joining phylogenetic tree showing the relationships between strain MCCB 386T and representatives of the family Rhodobacteraceae based on 16 S rRNA gene sequences similarity. Bootstrap values were derived from 1000 replicates. Halomonas saccharevitans AJ275T was used as an outgroup. GenBank accession numbers are given in parentheses. Bar, 0.020 substitutions per nucleotide position

Full size image

Physiological and chemotaxonomic characteristics

MCCB 386T is a Gram-negative, aerobic, non-motile, both oxidase and catalase positive, rod-shaped bacterium and producing pink colour colony on Nutrient agar (NA) medium. Scanning electron microscopy of the culture showed that cells of the strain MCCB 386T are short, straight rods and measured approximately 0.64–0.65 μm in diameter and 1.17–1.22 μm in length (Fig. 2). Comparison of physiological and biochemical characteristics between MCCB 386T and closely related reference genera were given in Table 1. Growth occurs at 4–37 °C (optimum 27 °C), pH 6–8 (optimum pH 7) and NaCl 1–8% (w/v) (optimum 3.5%). Tests for catalase, oxidase, nitrate reduction, ONPG, alkaline phosphatase are positive. Tests for DNase activity, indole production, citrate utilisation, hydrolysis of starch, CM-cellulose, casein, gelatin, chitin, MOF, and urease were negative. The strain was observed to utilises D-arabitol, D-cellobiose, D-fucose, D-galactose, D-mannitol, D-mannose, D-melibiose, turanose, α-D-glucose, L-threonine, L-glutamic acid, L-proline, L-pyroglutamic acid, Tween 40, Tween 80, putrescine, dextrin, α-cyclodextrin, D-saccharic acid, mono-methyl-succinate, α-hydroxy butyric acid and γ-amino butyric acid under aerobic conditions at pH 7 and 27 °C in GN2 Biolog Microplate whereas rest are negative. It shows negative reactions for Voges-Proskauer reaction. Detailed physiological characteristics of strain MCCB 386T are summarised in Table S2 and Table S3.

Fig. 2
figure 2

Scanning Electron Microscopic Image of MCCB 386T grown in Nutrient Broth at 27 °C for 7 days

Full size image
Table 1 Differential characteristics of strain MCCB 386T and the type strains of closely related genera in the family Rhodobacteraceae Taxa: 1-MCCB 386T (data from this study); 2 - Psychromarinibacter halotolerans YBW34T (Qiao et al. 2017); 3-Tranquillimonas alkanivorans A34T (Harwati et al. 2008); 4-Rhodovulum adriaticum strain DSM 2781T (Neutzling et al. 1984); 5-Roseivivax marinus strain ZL136T (Dai et al. 2014) ; 6- Tropicimonas isoalkanivorans B51T (Harwati et al. 2009), optimum values are given in brackets, positive reaction (+); negative reaction (-); AL-unidentified aminolipid; GL-unidentified glycolipid; L-unidentified lipid; PC-phosphatidylcholine; PE-phosphatidylethanolamine; PG-phosphatidylglycerol; PL-unidentified phospholipid; SL- sulpholipid; ND-Not Detected
Full size table

The fatty acid profile of strain MCCB 386T is listed in Table 2. The predominant constituents in the cellular fatty acid profile of MCCB 386T were C18:1ω7c (54.0%) and 11-methyl C18:1ω7c (22.6%). Fatty acid profile of MCCB 386T was found similar to those of closely related type strains. Moreover, 11-methyl C18:1ω7c was detected in MCCB 386T in higher proportion (22.6%), which distinguishes MCCB 386T from other genera despites sharing C18:1ω7c as their predominant cellular fatty acid. The presence of cis-11 octadecenoic acid (i.e. C18 : 1ω7c) as the principal fatty acid is a characteristic feature of taxa within the Alphaproteobacteria (Martínez-Checa et al. 2005).

Table 2 Cellular fatty acid content (% of total) of strain MCCB 386T and the reference strains are detailed in the table. Strains: 1-MCCB 386T (data from this study); 2-Psychromarinibacter halotolerans YBW34T (Qiao et al. 2017); 3-Tranquillimonas alkanivorans A34T (Harwati et al. 2008); 4-Rhodovulum adriaticum strain DSM 2781T (Neutzling et al. 1984, Imhoff 1991); 5-Roseivivax marinus strain ZL136T (Dai et al. 2014); 6-Tropicimonas isoalkanivorans B51T(Harwati et al. 2009). Values are percentages of total fatty acids; Major fatty acid (<10%) are highlighted in bold, TR (<1%); “-“ indicates not detected/not reported
Full size table

The major polar lipids comprised of phosphatidylcholine (PC), diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), phosphoglycolipid (PGL), one unidentified aminolipid, two glycolipids and two unidentified lipids (Supplementary Fig. S3). The respiratory quinones found in MCCB 386T were ubiquinone-9 (0.2%), ubiquinone-10 (97.3%) and ubiquinone-11 (2.5%). The presence of ubiquinone-10 as the dominant respiratory lipoquinone is characteristic of the member of the class Alphaproteobacteria (Yokota et al. 1992; Lechner et al. 1995; Busse et al. 1999).

Genome characterisation

The genome sequencing generated forward 1.52 Gb and reverse 1.52 Gb of clean data (approximately 570-fold genome depth coverage). The genome completeness of the strain MCCB 386T was 99.12% with 0.15% contamination. The whole genome assemblies of strain MCCB 386T contain 3,732,706-bp with 37 contigs contained 3696 genes, of which 1615 encode hypothetical gene, 3629 protein-coding genes, 67 RNAs (one complete 16 S rRNA operon, one 5 S rRNAs, one 23 S rRNA, 47 tRNAs and 17 misc RNAs) predicted by Prokka v1.14.5 summarised in Table S1. The full-length 16 S rRNA gene extracted from genome was completely consistent with the sequence obtained by conventional Sanger sequencing. These values correspond to 985 protein-coding genes per Mb and a coding density of 90.6%.

The phylogenomic analysis based on 120 conserved single copy marker genes of strain MCCB 386T and the closest species with standing in nomenclature are presented in Fig. 3, where it confirmed that strain MCCB 386T is most closely related to members of the genus Tranquillimonas and its independent position within genus Rhodovulum and other closest genera. The genomic DNA G+C content of strain MCCB 386T was 68.1 mol%, which is slightly lower than that of Tranquillimonas alkanivorans DSM 19,547T (69.1 mol%) but higher than other closely related species (Table 1).

Fig. 3
figure 3

Phylogenomic tree inferred from the concatenation of 120 single-copy, phylogenetically informative bacterial marker genes showing the phylogenetic position of strain MCCB 386T. The tree was reconstructed using the Genome Taxonomy Database toolkit (Parks et al. 2018), release 05-RS95. The significance levels of interior branch points obtained in maximum-likelihood analysis were determined by bootstrap analysis (1000 data re-samplings). Halomomas saccharevitans CGMCC 1.6493T was used as a outgroup. Bar, 0.2 substitutions per amino acid position

Full size image

The in silico DDH values between strain MCCB 386T and Rhodovulum adriaticum DSM 2781T, Rhodovulum marinum DSM 18,063T, Rhodovulum strictum DSM 11,289T, Rhodovulum steppense DSM 21,153T, Rhodovulum sulfidophilum DSM 1374T, Tranquillimonas alkanivorans DSM 19,547T, Dinoroseobacter shibae DSM 16,493T, Roseivivax marinus DSM 27,511T and Tropicimonas isoalkanivorans DSM 19,548T were 18.8%, 19.1%, 19.3%, 18.7%, 18.9%, 19.7%, 19.4%, 19.8%, and 23.3% respectively (Fig. 4a) which are lower than 70% cut-off used for delineating species (Chun et al. 2018). Ortho Average nucleotide Identity (orthoANI) between strain MCCB 386T and Rhodovulum adriaticum DSM 2781T, Rhodovulum marinum DSM 18,063T, Rhodovulum strictum DSM 11,289T, Rhodovulum steppense DSM 21,153T, Rhodovulum sulfidophilum DSM 1374T, Tranquillimonas alkanivorans DSM 19,547T, Dinoroseobacter shibae DSM 16,493T, Roseivivax marinus DSM 27,511T and Tropicimonas isoalkanivorans DSM 19,548T were 72.41%, 72.83%, 72.88%, 73.11%, 73.09%, 74.34%, 72.22%, 73.09% and 72.47% respectively, which were below the threshold value of 95% (Chun et al. 2018), thus confirming that MCCB 386T is distinct from these phylogenetically close bacterial taxa (Fig. 4b). Further Tetra value range from 0.69 to 0.95 (Fig. 4c) is well below the accepted cut-off values of 0.989 for species delineation (Teeling et al. 2004; Richter and Rosselló-Móra 2009). The AAI values ranging from 65.14 to 68.21% with the reference genomes (Fig. 4d) which is below the threshold value of 80–85% proposed for classification of a novel genus (Konstantinidis and Tiedje 2005; Luo et al. 2014) while the POCP values for MCCB 386T ranged from 51.13 to 56.26% (Fig. 4e). Based on physiological, chemotaxonomic, phylogenetic, and genotypic data we conclude that MCCB 386T represents a novel genus and species of the family Rhodobacteraceae for which the name Roseitranquillus sediminis gen. nov., sp. nov. is proposed. The type strain MCCB 386T (=JCM 33,538T = KACC 21,531T) is isolated from the sediment sample collected Kongsfjorden, Ny-Ålesund, Svalbard, Arctic.

Fig. 4
figure 4figure 4figure 4

Heat maps indicating the genetic relatedness between MCCB 386T and closely related taxa displayed as a cladogram (a) digital DNA–DNA hybridization (dDDH), (b) OrthoANI (c) Tetra, (d) average amino acid identity (AAI) and (e) Percentage of conserved protein (POCP)

Full size image
Secondary metabolite gene cluster analysis

The secondary metabolite gene cluster analysis of MCCB 386T showed eight putative biosynthetic gene clusters (BGCs) (Fig. S4). These clusters were predicted to encode terpenes (2), RiPP like (ribosomally synthesized and post translationally modified peptides) such as lassopeptides and lantipeptides (1), RRE containing Lassopeptide (1), haserlactone (2) redox co-factor (1) and ectoin (1). Two biosynthetic gene cluster (BGCs) (cluster 5 terpene and cluster 8 ectoin) code for the metabolic compound that exhibit relative similarity to already known clusters (16–80%), all other six clusters showed very less relative similarity (0–8% relative similarity) to any existing clusters, which indicates the possibility that MCCB 386T may encode for novel chemical scaffold.

Discussion

Through genomic and phenotypic approach, we have characterised a novel bacterial species MCCB 386T representing a novel genus under the family Rhodobacteraceae isolated from the sediments collected from an Arctic Fjord. The DNA G+C content of strain MCCB 386T was calculated from the draft genome and found to be 68.1 mol%. Phylogenomic approaches such as dDDH, ANI and Tetra are often used for microbial taxonomy and give more brevity for species identification compared to 16 S rRNA gene sequence similarity. Recently, additional parameters such as AAI (Konstantinidis and Tiedje 2005) and the POCP (Qin et al. 2014) were proposed to delineate organisms at the genus level. Bacterial strains below 70% threshold value for dDDH, 95% for ANI and 0.989 for Tetra were considered as different species (Teeling et al. 2004; Richter and Rosselló-Móra 2009). The in silico DDH values between strain MCCB 386T and closely related strains well below the cut-off (70%) used for delineating species.

OrthoANI values among closely related species ranged from 72.00 to 90.11% (Fig. 4b). When strain MCCB 386T was compared with these closely related species, values ranged from 72.22% with Dinoroseobacter shibae DSM 16,493T to 74.07% with Tranquillimonas alkanivorans 19,547T. Stephan et al. (2014) recently proposed ANIb based delineation among genera of the family Enterobacteriaceae which is ranged from 75 to 80%. Several other studies for novel genus delineation such as description of the new genus Endobacterium (Menéndez et al. 2020) and Georhizobium (Cao et al. 2020) were also supported by the results of ANIb calculation, with values lower than 76%. The ANI values obtained for MCCB 386T within the closest genera of the family Rhodobactereceaea were found to be lower than 76%, which support the affiliation of this strain to a new genus within Rhodobactereceaea family.

Furthermore AAI analysis between strain MCCB 386T and related strains were below the threshold value proposed for classification of a novel genus, thus confirming the distinctive taxonomic status of MCCB 386T. However, the POCP value for MCCB 386T ranged from 51.13 to 56.26% which is slightly above the cut-off (50%) prescribed for genus delineation. However, POCP is affected by genome size and hence cannot be used for the species undergoing extreme genome reduction (Hayashi Sant’Anna et al. 2019). Henceforth, applying this threshold for delineating genera within the family Rhodobacteraceae (Wirth and Whitman 2018), Methylococcaceae (Orata et al. 2018) and Neisseriaceae (Li et al. 2017) are contested, thus suggesting a necessity to describe appropriate POCP cut-off values for various families (Suresh et al. 2019).

Analysis of Biosynthetic Gene clusters (BGCs) revealed the potential of this strain for the production of novel secondary metabolites which warrants further study, including the purification and characterisation of the bioactive lead compounds. This study emphasises the importance of polar microbial diversity and their bioprospecting potential for the discovery of novel secondary metabolites. We recently reported novel actinomycetes from arctic environments with the potential to produce secondary metabolites (Dhaneesha et al. 2017, 2021).

In summary, based on physiological, chemotaxonomy, phylogenetic, and genotypic data we conclude that MCCB 386T represents a novel genus and species of the family Rhodobacteraceae for which the name Roseitranquillus sediminis gen. nov., sp. nov. is proposed, which having potential for production of novel secondary metabolites.

Description of Roseitranquillus gen. nov.

Roseitranquillus (Ro.se.i.tran.quil′lus. L. masc. adj. roseus rose-coloured, pink; L. masc. adj. tranquillus quiet, calm, still; N.L. masc. n. Roseitranquillus a pink-coloured non-motile organism).

Cells are Gram-negative, aerobic, non-motile, short bacilli and non-spore forming. The organism is positive for catalase and oxidase activities. Respiratory lipoquinones Q-10 is the major ubiquinone (97.3%) and C18:1ω7c (54.0%), 11-methyl C18:1ω7c (22.6%) are the main fatty acids. The major polar lipids are phosphatidylcholine, diphosphatidylglycerol, phosphatidylglycerol, phosphoglycolipid, one unidentified aminolipid, two glycolipids and two unidentified lipids. Phylogenetically, 16 S rRNA gene sequence analysis classifies strain MCCB 386T to the family Rhodobacteraceae of the class Alphaproteobacteria. The type species of the genus is Roseitranquillus sediminis.

Description of Roseitranquillus sediminis sp. nov.

Roseitranquillus sediminis (se.di′mi.nis. L. gen. n. sediminis of a sediment).

In addition to the characteristics that define the genus, the following characteristics are observed. Cells are 0.64–0.65 μm width and 1.17–1.22 μm in length. Colonies on nutrient agar are pink in colour, circular, convex, smooth and opaque with entire margins. Growth occurs at an optimum concentration 3.5% NaCl (w/v) and at a temperature of 27 °C. Nitrate is reduced to nitrite. Growth under anaerobic conditions is not observed. The genomic DNA G+C content is 68.1 mol%.

The type strain MCCB 386T was isolated from the sediment collected from Kongsfjorden, Ny-Ålesund, Svalbard was deposited in the Japan Collection of Microorganisms (=JCM 33,538T) and Korean Agricultural Culture Collection (=KACC 21,531T). The GenBank/EMBL/DDBJ accession numbers for the draft genome and 16 S rRNA gene sequences of strain MCCB 386T are JAFFOB000000000 and MK41783, respectively.