Introduction

Lung cancer is a primary reason for cancer mortality because of its early metastasis, rapid growth, and highly malignant nature (Fan and Wu 2022). Non-small cell lung cancer (NSCLC) constitutes around 80–85% of lung cancers and includes two primary subtypes: lung squamous carcinoma (LUSC) and adenocarcinoma (LUAD) (Suster and Mino-Kenudson 2020; Zhang et al. 2022a, b). In general, NSCLC management depends on its stage (Dohopolski et al. 2021). Cisplatin (DDP)-based compounds are applied for adjuvant chemotherapy and the treatment of advanced NSCLC (Kryczka et al. 2021). Despite apparent improvements in clinical outcomes for NSCLC patients, NSCLC is still an incurable illness for the majority of patients and its therapy remains confronted with two main barriers: metastasis and chemotherapy resistance (Miller and Hanna 2021; Xie et al. 2022). Therefore, the discovery of mechanisms affecting DDP sensitivity can be beneficial for NSCLC management.

Dysregulated transcription of long non-coding RNAs (lncRNAs) holds pivotal functions in drug resistance, metastasis, and proliferation of lung cancer (Sun et al. 2019). Of note, LINC00482 exhibit high expression in LUSC cell lines (Zhang et al. 2022a, b), suggesting that LINC00482 may assume a role in NSCLC progression. Moreover, LncMAP website analyses in our study predicted that LINC00482 might regulate CLASRP expression by orchestrating E2F transcription factor 1 (E2F1) to influence NSCLC progression. E2F1 is a typical and well-studied member of the E2F family which modulates S-phase cyclin and gene transcription needed for DNA repair, apoptosis, and DNA replication (Fouad et al. 2020). Mounting evidence implicates the involvement of E2F1 in chemoresistance, cell proliferation, clone formation, stemness, apoptosis, and migration in cancers (Lin et al. 2021; Lu et al. 2018). Moreover, a prior study unveiled that E2F1 activation led to DDP resistance in liver carcinoma (Wang et al. 2021). E2F1 modulates the lncRNA MCF2L antisense RNA 1/embryonic lethal vision-like protein 1/Cyclin D1 axis to enhance NSCLC cell resistance to gefitinib (Shan et al. 2022). In addition, CLASRP, a protein-encoding gene, can act as an alternative splicing regulator and modulate CLK kinases (Xu et al. 2019). CLASRP was reported as an independent prognostic factor for patients with head and neck cancer (Liang et al. 2019). Nevertheless, little is known regarding the function of CLASRP in NSCLC.

Thus, we hypothesized that LINC00482 might modulate DDP resistance in NSCLC through the E2F1/CLASRP axis. Herein, this research examined the actions and specific mechanisms of LINC00482 in resistance to DDP in NSCLC via the E2F1/CLASRP axis.

Materials and methods

Ethics statement

Patients and their families were informed about this study and signed the informed consent forms. The experiments involving clinical samples were ratified by the medical ethics committee of Affiliated Hospital of Guangdong Medical University and conformed to the Declaration of Helsinki. All operations involving animals complied with the international ethical conventions for laboratory animals and the relevant national regulations.

Clinical specimen collection

This study enrolled 90 patients (age: 43–75 years; the mean age: 56.21 ± 5.52 years) with NSCLC who received surgery in Affiliated Hospital of Guangdong Medical University between October 2021 and October 2022, of whom 59 were male and 31 were female. There were 52 cases of adenocarcinoma, 35 cases of squamous carcinoma, and 3 cases of adenosquamous carcinoma. All patients met the diagnostic criteria for NSCLC, were diagnosed by clinicopathological histology, and were in the tumor-node-metastasis (TNM) stage I-III. Additionally, none of patients were comorbid with other malignant tumors (such as gastric cancer and liver cancer) and serious chronic diseases (including hypertension, diabetes, and autoimmune diseases), had undergone anti-tumor treatments, developed serious cardiac, hepatic, or renal insufficiency and distant metastasis of tumors, and had a history of mental diseases or inability to communicate normally. Tissues from surgically removed cancerous and benign lesions were collected.

Cell culture and lentivirus transfection

NSCLC cell lines A549 and HCC44 and human normal lung epithelial BEAS-2B cells (iCell Bioscience, Shanghai, China) were cultivated with 1640 medium encompassing 100 U/mL of penicillin/streptomycin and 10% fetal bovine serum in an incubator (37 °C, 5% CO2).

Short hairpin RNA (shRNA) vectors were introduced in A549 and HCC44 cells by lentiviral infection. For lentivirus preparation, shRNA vectors, psPAX2 (BR036, FengHuiShengWu, Changsha, China), and pMD2.G (BR037, FengHuiShengWu) at a ratio of 4:3:2 were transfected in HEK293T cells using Lipofectamine 3000 (L3000015, Thermo Fisher Scientific, Wilmington, DE, USA). Briefly, 10 μg shRNA plasmids, 7.5 μg psPAX2, and 5 μg pMD2.G were transfected in HEK293T cells in a 100 mm culture dish. After transfection for 48 h, cells were subjected to centrifugation at 1000 g for 30 min. The virus supernatant was attained after filtration (0.45 μm) and transduced into cells using 8 μg/mL polyamine. Following 48-h transduction, cells were screened with puromycin and validated by real-time polymerase chain reaction (PCR) (Wang et al. 2022).

Cell transfection

Depending on transfection, cells were assigned into control, negative control (NC) shRNA, LINC00482 shRNA#1, LINC00482 shRNA#2, LINC00482 shRNA#3, overexpression (oe)–NC, oe-LINC00482, oe-NC + NC shRNA, oe-LINC00482 + NC shRNA, oe-LINC00482 + E2F1 shRNA, LINC00482 shRNA + oe-CLASRP, LINC00482 shRNA + oe-NC, and LINC00482 shRNA + oe-CLASRP groups. All target plasmids were bought from WZ Biosciences (Shandong, China). Cell density was adjusted based on cell growth rate, and cells were spread in 6-well plates to allow cells reaching 70–80% confluence on the second day and transfected using Lipofectamine 3000. Target plasmids (4 μg) and Lipofectamine 3000 (10 μL) were respectively diluted with Opti-minimal essential medium (MEM) (250 μL; Gibco, Grand Island, NY, USA), left to stand at ambient temperature for 5 min, and then mixed. Following 20-min standing, the mixed solution was supplemented to the wells transfection. After 8 h, the medium was refreshed. As a control, the cells in the control group were treated with PBS. After 12–16 h of cell recovery, cells were treated with corresponding concentrations of DDP for 48 h and collected (Tan et al. 2022). The LINC00482 shRNA sequences were shown below: LINC00482 shRNA#1: CCCAATAAGGTCCCATTCTGA; LINC00482 shRNA#2: CAAGGACATTCCTGTGGTTCT; and LINC00482 shRNA#3: CTAAGTATAGTCAGCAGTGAT.

Reverse transcription-quantitative PCR (RT-qPCR)

A reverse transcription kit (RR047A, Takara, Shiga, Japan) was applied to reverse transcribe the total RNA, which was extracted from cells or tissue samples using TRIzol (15596026, Invitrogen, San Diego, CA, USA), into cDNA. The system was 20 μL and the reaction conditions were 15 min at 37 °C and 5 s at 85 °C. Samples (three replicates per sample) were loaded using 2 × SYBR Green PCR Mastermix (SR1110, Solarbio, Beijing, China) and subjected to RT-qPCR reactions in a real-time fluorescence quantitative PCR instrument (ABI7500, Applied Biosystems, Foster City, CA, USA). The reaction system contains SYBR Mix (9 μL), positive primers (0.5 μL), negative primers (0.5 μL), cDNA (2 μL), and RNase Free dH2O (8 μL). The reaction conditions were set to 95 °C for 10 min, 95 °C for 15 s, and 60 °C for 1 min for 40 consecutive cycles. Primers (Table 1) were synthesized by Sangon (Shanghai, China). Cycle threshold (Ct) values of wells were recorded, and product relative expression was calculated using the 2−ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a normalizer (Ayuk et al. 2016).

Table 1 Primers for RT-qPCR
Full size table

Intracellular and nuclear RNAs were extracted. Specifically, cells received twice washes with pre-chilled phosphate-buffered saline (PBS), and the cell precipitates were gently resuspended in hypotonic solution, treated for 10 s with NP40, and centrifuged for 10 min at 3000 rpm and 4 °C. The supernatants, which are the cytoplasmic contents, were added with equivalent volume of chloroform and centrifuged for 10 min at 4 °C. The supernatants were transferred to new clean tubes and mixed with equivalent volume of ethanol, and the intracellular RNAs were extracted per the instructions. The intracellular precipitates were resuspended, rinsed once with pre-chilled PBS, and centrifuged for 10 min at 4 °C to discard the supernatants. Afterward, TRIzol (1 mL) was added for nuclear RNA extraction. U6 small nuclear RNA and GAPDH served as the normalizers for nuclear and cytoplasmic RNAs, respectively (Zhang et al. 2018).

Western blotting

On ice, cells and prepared tissue homogenates were lysed with Radio-Immunoprecipitation assay (RIPA) protein lysis solution (P0013B, Beyotime, Shanghai, China) for 10 min. Bicinchoninic acid quantification kits (P0012S, Beyotime) was applied for protein quantifications. Proteins were boiled for 10 min with 10 μL loading buffer at 95 °C and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis at the 100 V lane. Then, proteins were transferred to nitrocellulose membranes with 30 mA current for 120 min, and the membranes were sealed with 5% bovine serum albumin/Tris-buffered saline with Tween 20 (TBST) at ambient temperature for 60 min. Subsequently, the membranes were probed with primary antibodies of anti-E2F1 (#3742, 1:100, Cell Signaling Technology [CST], Beverly, MA, USA), anti-CLASRP (sc-514890, 1:500, Santa Cruz Biotechnology, Dallas, TX, USA), anti-GAPDH (#5174, 1:5000, CST) overnight at 4 °C. The membranes received 1 × TBST solution washes (3 times × 5 min) on a shaker at ambient temperature, 2-h hybridization with horseradish peroxidase-labeled secondary antibodies of goat anti-rabbit immunoglobulin G (IgG) H&L (ab6721, 1:5000, Abcam, Cambridge, UK) and goat anti-mouse IgG (ab6789, 1:5000, Abcam) at ambient temperature, and TBST washes (3 times × 20 min). The luminescence reaction was conducted with an enhanced chemiluminescence kit. Then, protein blots were observed, followed by image analyses. Band grayscale values were analyzed with Image J software, and the relative expression of target proteins was denoted as the grayscale value of target bands/the grayscale value of internal reference.

Cell counting kit (CCK)-8 assay

Following digestion and resuspension, transfected cells were adjusted to 1 × 105 cells/mL and seeded and cultivated overnight in 96-well plates (100 μL/well). The cells were treated as per the directions of CCK-8 kits (C0037, Beyotime), and their cell viability was assessed by CCK-8 method at the 24th, 48th, 72nd, and 96th h after seeding, respectively. For each assessment, the cells were supplemented with 10 μL CCK-8 assay solution and incubated for 4 h in an incubator. The absorbance at 450 nm was examined using a microplate reader, followed by plotting of growth curves.

Clone formation assay

Logarithmically growing cells were prepared into single-cell suspensions, counted, seeded in culture dishes (1,000 cells per 60 mm dish), and cultured in a CO2 incubator. The medium was renewed every 3 d. Following 14 d of culture, the medium was discarded, and cells received 15-min methanol fixation and 15-min crystal violet staining. Then, the colonies of more than 50 cells were counted under a microscope.

Flow cytometry

Apoptosis of DDP-stimulated cells was assessed using Annexin V/propidium iodide (PI) apoptosis assay kits (CA1020, Solarbio). Cells were blown apart after digestion using ethylene diamine tetraacetic acid-free trypsin and collected into centrifuge tubes for centrifugation. The supernatants were discarded, and cells received twice PBS washes, drying, and resuspension in 1 × binding buffer. Cell suspension (100 μL) was transferred to a flow tube (5 mL), mixed and incubated for 5 min with Annexin V/fluorescein isothiocyanate (FITC) (5 μL) at ambient temperature in dark, and supplemented with PI solution (5 μL) and PBS (400 μL). After reaction termination, apoptosis rates were determined immediately using FACSCanto II flow cytometer (BD Bioscience, Franklin Lakes, New Jersey, USA).

Dual-luciferase reporter assay

NC shRNA and LNC00482 shRNA were co-transfected with CLASRP-2 Kb luciferase reporter plasmids into A549 cells to test the influence of LINC00482 on the CLASRP promoter activity, respectively. Forty-eight h after transfection, cells were lysed, and the assay was conducted using a luciferase reporter gene assay kit (RG005, Beyotime) with a dual-luciferase reporter gene assay system (Promega, Madison, WI, USA). The activation degree of target reporter genes was assessed by the ratio of relative light unit between Firefly/Renilla (internal reference) luciferases.

The presence of binding sites of E2F1 protein to CLASRP DNA was predicted via the JASPAR website. Recombinant luciferase reporter gene vectors with mutated binding sites were constructed and co-transfected with oe-E2F1/oe-NC into A549 cells, followed by dual-luciferase reporter assays to verify the specific binding sites of E2F1 protein to CLASRP DNA. The specific steps were the same as above.

Chromatin immunoprecipitation (ChIP) assay

A549 cells received 10-min formaldehyde fixation to produce DNA–protein crosslinks and were fragmented through 15 cycles of 10-s sonication at an interval of 10 s, and 10-min centrifugation at 12,000 g and 4 °C. The supernatants were separated into two tubes (10 μg chromatin per immunoprecipitation) and incubated overnight with normal mouse IgG antibodies (5 μg, ab172730, 1:100, Abcam) and rabbit E2F1 antibodies (5 μg, #3742, 1:100, CST), respectively, at 4 °C for full binding. DNA–protein complexes were precipitated with Protein Agarose/Sepharose and centrifuged for 5 min at 12,000 g, and the supernatants were discarded. The non-specific complexes received washes and overnight de-crosslinking at 65 °C, followed by DNA fragment extraction, purification, and recovery with phenol/chloroform for RT-qPCR.

After LINC00482 silencing, samples containing purified DNA fragments were finally attained for ChIP assays (same steps as above) to examine changes in E2F1 enrichment at the CLASRP promoter, followed by RT-qPCR.

RNA immunoprecipitation (RIP) assay

The binding of LINC00482 to E2F1 was assessed using RIP kits (Millipore, Billerica, MA, USA). Cells received lysing (5 min in an ice bath) with an equal volume of RIPA lysis solution (P0013B, Beyotime) and centrifugation (10 min, 14,000 g, 4 °C), after which the supernatants were removed. Cell extracts and antibodies were co-precipitated via incubation: magnetic beads (50 μL) received washes and resuspension in RIP wash buffer (100 μL) and incubation with antibodies (1 μg) for binding. Magnetic bead-antibody complexes received washes and resuspension in RIP wash buffer (900 μL) before overnight incubation with cell extracts (100 μL) at 4 °C. The sample was placed on a magnetic holder to collect magnetic bead-protein complexes which were digested using proteinase K to retrieve RNA for PCR. The antibodies used for RIP included E2F1 antibodies (#3742, 1:100, CST) which were mixed with the sample at room temperature for 30 min and IgG antibodies (ab172730, 1:100, Abcam).

Fluorescence in situ hybridization (FISH)

The subcellular localization of LINC00482 in NSCLC cell lines was identified using the FISH Kit for RNA (R0306S, Beyotime). Briefly, NSCLC cells were seeded in 6-well plates. When cell confluence reached about 80%, cells received fixation, permeabilization, and pre-hybridization before cells were immersed in hybridization solution containing probes, sealed, and placed in a shaker at 45–65 °C in dark for overnight hybridization. Subsequent to 4',6-Diamidino-2-Phenylindole staining, cells were sealed with anti-fluorescent bursting agent, observed under a fluorescent microscope (Olympus, Tokyo, Japan), and imaged.

Tumor-bearing mouse assay

BALB/c nude mice (weighing 16 ± 2 g, aged 4–5 weeks, Vital River Laboratories, Beijing, China) were reared in an environment with constant temperature (25–27 °C) and humidity (45%-50%). Nude mice were randomly allocated into four groups (NC shRNA + dimethyl sulfoxide [DMSO], NC shRNA + DDP, LINC00482 shRNA + DMSO, and LINC00482 shRNA + DDP; six mice/group) (Wang et al. 2022). Briefly, nude mice were subcutaneously injected with 50 μL stably transfected A549 cell suspension (1 × 107 cells/mL) into the back and injected with 4 mg/kg DDP or DMSO via tail vein after 7 days (Tan et al. 2022). The tumor growth was closely observed. The longest (a) and shortest (b) diameters of tumors were measured every 7 days, and tumor volumes were calculated to plot the growth curve with the formula: (a × b2)/2 (Kun-Peng et al. 2017). Nude mice were euthanized after 28 days. The tumors were peeled off, weighed, and photographed, and tumor tissues were harvested for assays.

Immunohistochemical staining

Tumor tissues received 4% paraformaldehyde fixation, paraffin embedding, and sectioning, and the sections were subjected to immunohistochemical staining (Tan et al. 2022). Following xylene dewaxing and ethanol dehydration at different concentrations, sections were antigenically repaired with 0.01 M sodium citrate solution, incubated for 10 min with 3% H2O2, and sealed for 30 min with goat serum at room temperature. Sections underwent incubation with anti-Ki67 antibodies (ab15580, 1:1000, Abcam) (overnight, 4 °C) and with goat anti-rabbit IgG H&L (ab6721, 1:1000, Abcam) (1 h, room temperature), followed by diaminobenzidine and hematoxylin staining and neutral gum sealing. Observations and photographs were conducted using a microscope (Olympus), and positive expression was analyzed using Image J.

Statistical analyses

All data were statistically analyzed using Graphpad 8.0. The measurement data were displayed in the form of mean ± standard error of mean. Comparisons between two groups were analyzed via the paired or unpaired t-test, and comparisons among multiple groups were analyzed using one-way analysis of variance with Tukey's tests for post hoc multiple comparisons. P < 0.05 illustrated that the difference was statistically significant.

Results

LINC00482 expression was high in NSCLC tissues and cells

With reference to previous work (Zhang et al. 2022a, b)), the analyses of the lncRNA microarray in the Gene Expression Omnibus database identified 11 differentially expressed lncRNAs in lung cancer (LINC00482, C10orf55, AC130462.2, AC104785.1, AP005899.1, AC138035.1, AL021154.1, AC10422.4, MIR3945HG, AC008734.1, and LINC02408), of which LINC00482 was used as the study target. RT-qPCR data exhibited that LINC00482 expression was dramatically higher in 90 NSCLC tissues versus that in adjacent tissues (Fig. 1A, P < 0.05). In addition, LINC00482 expression was not correlated with gender, age, and pathological type but was correlated with tumor diameter, TNM staging, and lymph node metastasis in patients with NSCLC (Table 2, P < 0.05). Specifically, patients with tumor diameter ≥ 3 cm, stage III NSCLC, and lymph node metastasis had higher LINC00482 expression. RT-qPCR also displayed that both A549 and HCC44 cells had apparently higher LINC00482 expression than BEAS2B cells (Fig. 1B, P < 0.05). In conclusion, LINC00482 was overexpressed in NSCLC tissues and cells.

Fig. 1
figure 1

NSCLC tissues and cells have upregulated LINC00482 expression. Note: A: RT-qPCR detection of LINC00482 expression in human NSCLC and adjacent tissues (n = 90). B: RT-qPCR detection of LINC00482 expression in human NSCLC cell lines A549 and HCC44 (n = 3). The measurement data were displayed as mean ± standard error of mean. Comparisons among multiple groups were performed using one-way analysis of variance. * indicates P < 0.05 compared with adjacent tissues; # indicates P < 0.05 compared with BEAS2B cells. NSCLC, non-small cell lung cancer

Full size image
Table 2 Relationship between LINC00482 expression and clinical profiles of patients with non-small cell lung cancer
Full size table

LINC00482 inhibited NSCLC cell sensitivity to DDP

To clarify the influence of LINC00482 on NSCLC cell sensitivity to DDP, A549 and HCC44 cells were infected with LINC00482 shRNA lentiviruses and treated with different concentrations of DDP (the cells treated with PBS were named as the control group). RT-qPCR results manifested that LINC00482 shRNA#1, #2, and #3 markedly lowered LINC00482 expression in cells (Fig. 2A, P < 0.05). CCK-8 assay data displayed that LINC00482 shRNA#1, #2, and #3 conspicuously reduced A549 and HCC44 cell viability, with the most evident decrease upon LINC00482 shRNA#3. The half-inhibitory concentration (IC50) of DDP for A549 and HCC44 cells was 6.87 and 7.38 μg/mL, respectively (Fig. 2B-D, P < 0.05). Clone formation assay and flow cytometry data documented that LINC00482 shRNA#1, #2, and #3 appreciably reduced clonogenicity and elevated apoptosis of A549 cells (Fig. 2E-H, P < 0.05). The above experimental results also revealed that the variable transfection efficiency of different LINC00482 shRNAs in different cells resulted in the differences in gene and protein expression levels, ultimately affecting the biological functions of cells. LINC00482 shRNA#3 showed the most significant changes. Therefore, subsequent cell rescue experiments and in vitro and in vivo assays were conducted upon the transfection with LINC00482 shRNA#3, which was uniformly expressed as LINC00482 shRNA below.

Fig. 2
figure 2

Silencing of LINC00482 enhances the sensitivity of NSCLC cells to DDP. Note: A549 and HCC44 cells were infected with LINC00482 shRNAs and treated with different concentrations of DDP. A: RT-qPCR to examine the infection efficiency of LINC00482 shRNAs in in A549 and HCC44 cells. B-C: CCK-8 assays to detect the proliferation of A549 (B) and HCC44 (C) cells after 48 h of stimulation with DDP. D: Half inhibition concentration (IC50) of DDP in A549 and HCC44 cells. E–F: Clone formation assay to assess the clonogenicity of A549 cells. G-H: Flow cytometry to evaluate apoptosis in A549 cells. The measurement data were displayed as mean ± standard error of mean. Comparisons among multiple groups were performed using one-way analysis of variance with Tukey's multiple comparison tests for post-hoc tests. * indicates P < 0.05 compared with the NC shRNA group, N = 3. NSCLC, non-small cell lung cancer; DDP, cisplatin

Full size image

To further verify the effects of LINC00482 on NSCLC cell sensitivity to DDP, NSCLC cells were transfected with oe-LINC00482, followed by transfection efficiency determination using RT-qPCR. As reflected in Supplementary Fig. 1A (P < 0.05), the oe-LINC00482 group had obviously increased expression of LINC00482 compared with the oe-NC group. CCK-8 assay revealed that oe-LINC00482 transfection significantly improved the viability of NSCLC cells treated with DDP and also increased the half-inhibitory concentration (IC50) of DDP for A549 and HCC44 cells (Supplementary Fig. 1B-C, P < 0.05). Finally, the biological function test of A549 cells showed that oe-LINC00482 transfection enhanced the proliferation and repressed the apoptosis of NSCLC cells (Supplementary Fig. 1D-E, P < 0.05).

In summary, LINC00482 knockdown enhanced cell sensitivity to DDP in NSCLC, which could be reversed by LINC00482 overexpression.

LINC00482 promoted CLASRP expression through recruitment of E2F1

The location of lncRNA in cells is closely associated with its function. Firstly, the location of LINC00482 in A549 cells was examined with RNA-FISH, which manifested that LINC00482 was mainly distributed in the nucleus of A549 cells (Fig. 3A). Further extraction of the different components of A549 cells identified that LINC00482 expression was higher in the nucleus than in the cytoplasm (Fig. 3B, P < 0.05), suggesting that it may function mainly by affecting gene transcription. Next, through the LncMAP website, LINC00482 was predicted to participate in NSCLC development by altering CLASRP expression via E2F1. The dual-luciferase reporter assay presented that LINC00482 shRNA notably reduced the CLASRP promoter activity (Fig. 3C. P < 0.05), indicating that LINC00482 positively regulated CLASRP expression in A549 cells.

Fig. 3
figure 3

LINC00482 recruits E2F1 to promote CLASRP expression. Note: A: RNA-FISH to detect LINC00482 location in A549 cells at a scale of 25 μm. B: RT-qPCR to assess LINC00482 expression in the cytoplasm and nucleus of A549 cells. C: Dual-luciferase reporter assay to analyze the effect of LINC00482 on CLASRP promoter activity in A549 cells after 48-h transfection. D: RIP assay to verify the binding of LINC00482 to E2F1. E: Dual-luciferase reporter assay to analyze the effect of E2F1 on CLASRP promoter activity in A549 cells after 48-h co-transfection. F: ChIP assay to examine the binding of E2F1 to CLASRP. G: ChIP assay to examine the regulatory effect of LINC00482 on the binding of E2F1 to CLASRP. H: RT-qPCR to assess the transfection efficiency. I: Western blotting to measure CLASRP protein expression. The measurement data were displayed as mean ± standard error of mean. Comparisons between the two groups were performed using unpaired t-test, and comparisons among multiple groups were analyzed using one-way analysis of variance with Tukey's multiple comparison tests for post-hoc tests. * indicates P < 0.05 compared with the NC shRNA or IgG group; # indicates P < 0.05 compared with the oe-NC group; & indicates P < 0.05 compared with the oe-NC + NC shRNA group; % indicates P < 0.05 compared with the oe-LINC00482 + NC shRNA group, N = 3

Full size image

Next, the mechanism that LINC00482 positively regulated CLASRP expression by E2F1 was further tested. RIP assay data confirmed that E2F1 bound more LINC00482 than IgG (Fig. 3D, P < 0.05), indicating that E2F1 protein specifically bound LINC00482. The most likely binding sites of E2F1 protein to CLASRP DNA were analyzed with the JASPAR website (Table 3). The dual-luciferase reporter assay demonstrated that oe-E2F1 transfection enhanced the luciferase activity of CLASRP and did not influence the luciferase activity of CLASRP when the binding sites were mutated (Fig. 3E, P < 0.05), suggesting that the mutated sites were the specific sites where E2F1 protein bound to CLASRP DNA. ChIP assay results manifested that the amplification products obtained with the primers of CLASRP DNA binding sites were signally higher in the E2F1 group than in the IgG group (Fig. 3F, P < 0.05), indicating that the sites of CLASRP DNA (ttttgcctc) were indeed the sites binding to E2F1. The ChIP assay after LINC00482 silencing in A549 cells manifested that LINC00482 silencing apparently reduced E2F1 enrichment in the CLASRP promoter (Fig. 3G, P < 0.05), indicating that only in the presence of LINC00482, E2F1 could bind to the CLASRP promoter to upregulate CLASRP. Subsequently, A549 cells were transfected with oe-LINC00482 and/or E2F1 shRNA. RT-qPCR data revealed excellent transfection efficiencies (Fig. 3H, P < 0.05). Western blotting demonstrated that oe-LINC00482 treatment considerably upregulated CLASRP expression, while further E2F1 shRNA treatment evidently diminished CLASRP expression in the presence of oe-LINC00482 (Fig. 3I, P < 0.05). Summarily, LINC00482 recruited and bound to E2F1 to enhance CLASRP expression in NSCLC cells.

Table 3 Binding sites of E2F1 to CLASRP promoter by JASPAR website
Full size table

LINC00482 mediated CLASRP expression in A549 and HCC44 cells

Firstly, The Cancer Genome Atlas (TCGA) database predicted the expression of CLASRP in LUAD, which revealed the upregulation of SFRS16 (CLASRP) in LUAD (Fig. 4A). Meanwhile, to confirm that CLASRP was regulated by LINC00482, LINC00482 was silenced in A549 and HCC44 cells. Results from RT-qPCR and western blotting exhibited that silenced LINC00482 dramatically diminished CLASRP levels in cells (Fig. 4B-D, P < 0.05).

Fig. 4
figure 4

LINC00482 promotes CLASRP expression. Note: A: Analysis of CLASRP expression in normal and lung cancer samples from TCGA database. B: RT-qPCR detection of CLASRP mRNA levels in A549 and HCC44 cells after infection of LINC00482 shRNA. C-D: Protein band plots (C) and statistical plots (D) of CLASRP protein in A549 and HCC44 cells after infection of LINC00482 shRNA by western blotting. The measurement data were displayed as mean ± standard error of mean. Comparisons between the two groups were performed using unpaired t-test. * indicates P < 0.05 compared with the NC shRNA group, N = 3

Full size image

LINC00482 silencing downregulated CLASRP expression to sensitize NSCLC cells to DDP

To probe the influence of the LINC00482/E2F1/CLASRP axis on NSCLC cell sensitivity to DDP, A549 cells were transfected with LINC00482 shRNA and oe-CLASRP and stimulated with DDP. CCK-8 assay results manifested that oe-CLASRP transfection abrogated LINC00482 shRNA-induced reductions in A549 cell viability after different concentrations of DDP treatment (Fig. 5A, P < 0.05). Subsequently, data from western blotting displayed that LINC00482 shRNA treatment markedly decreased CLASRP expression in DDP-stimulated A549 cells, which was nullified by further oe-CLASRP treatment (Fig. 5B-C, P < 0.05). Clone formation assay and flow cytometry demonstrated that oe-CLASRP nullified the diminishment of clonogenicity and the enhancement of apoptosis in DDP-stimulated A549 cells caused by LINC00482 shRNA (Fig. 5D-G, P < 0.05). Conclusively, LINC00482 knockdown fostered cell sensitivity to DDP in NSCLC by downregulating CLASRP.

Fig. 5
figure 5

Silencing of LINC00482 promotes the sensitivity of NSCLC cells to DDP by downregulating CLASRP. Note: A549 cells were transfected with LINC00482 shRNA and oe-CLASRP and stimulated with DDP. A: CCK-8 assay to detect the viability of A549 cells upon stimulation with different concentrations of DDP. After transfection and 48-h stimulation with 6.87 μg/mL (IC50) DDP, B-C: western blotting to examine CLASRP protein expression in A549 cells; D-E: clone formation assay to assess the clone formation ability of A549 cells; F-G: flow cytometry assay to evaluate apoptosis in A549 cells. The measurement data were displayed as mean ± standard error of mean. Comparisons among multiple groups were performed using one-way analysis of variance with Tukey's multiple comparison tests for post-hoc tests. * indicates P < 0.05 compared with the NC shRNA + oe-NC group; # indicates P < 0.05 compared with the LINC00482 shRNA + oe-NC group, N = 3. NSCLC, non-small cell lung cancer; DDP, cisplatin

Full size image

LINC00482 silencing restricted tumorigenesis and facilitated sensitivity to DDP in NSCLC in vivo

Nude mice were injected with stably transfected A549 cells and DDP, followed by observation of tumor growth and acquisition of tumor tissues. Results exhibited that both DDP and LINC00482 shRNA remarkably reduced tumor size, volume, and weight in mice (Fig. 6A-C, P < 0.05). RT-qPCR and western blotting manifested that both DDP and LINC00482 shRNA conspicuously reduced LINC00482 and CLASRP expression in mouse tumor tissues (Fig. 6D-F, P < 0.05). Immunohistochemical staining illustrated that both DDP and LINC00482 shRNA significantly diminished Ki67 positive rate in mouse tumor tissues (Fig. 6G-H, P < 0.05). Notably, the combination of LINC00482 shRNA and DDP exerted more substantial effects on the aforementioned genes in mouse tumor tissues than DDP or LINC00482 shRNA alone (Fig. 6A-H, P < 0.05). In conclusion, LINC00482 knockdown restrained the growth and enhanced the sensitivity to DDP in NSCLC in vivo.

Fig. 6
figure 6

Silencing of LINC00482 inhibits tumor growth and enhances the sensitivity to DDP in nude mice. Note: A-C: Statistical plots of size (A), volume (B), and weight (C) of tumors in nude mice. D: RT-qPCR for LINC00482 and CLASRP levels in tumor tissues. E–F: Western blotting for protein band plots (E) and statistical plots (F) of CLASRP protein in tumor tissues. G-H: Immunohistochemical staining for images (G) and statistical plots (H) of Ki67 positive rate in tumor tissues, scale bar = 50 μm. The measurement data were displayed as mean ± standard error of mean. Comparisons among multiple groups were performed using one-way analysis of variance with Tukey's multiple comparison tests for post-hoc tests. * indicates P < 0.05 compared with the NC shRNA + DMSO group; # indicates P < 0.05 compared with the NC shRNA + DDP group, N = 3. NSCLC, non-small cell lung cancer; DDP, cisplatin

Full size image

Discussion

DDP was approved as an anti-tumor drug in 1978 and today remains a vital and potent treatment for a variety of cancers, including NSCLC and small cell lung cancer (Zhang et al. 2021). Its anticancer effects are related to its capacity to cross-link DNA purine bases, which interferes with DNA repair mechanisms, results in DNA damage, and induces cancer cell apoptosis (Dasari and Tchounwou 2014). However, DDP faces two intrinsic challenges the drug resistance and side effects, which limit its adoption and efficacy (Ghosh 2019). Cancer cells can develop resistance to DDP-induced damage, which generates genetic and epigenetic variations that cause resistance generation and activation of inherent resistance mechanisms of cancer cells (Lugones et al. 2022). Additionally, drug resistance is the leading reason for disease progression and therapeutic failure in NSCLC (Xu et al. 2021). Therefore, investigation of the molecular mechanisms affecting DDP resistance is beneficial to enhancing the efficacy of DDP in NSCLC treatment. This research disclosed that LINC00482 silencing downregulated CLASRP via E2F1 to facilitate the sensitivity to DDP in NSCLC.

Reportedly, some lncRNAs participate in DDP resistance in NSCLC via influence on signaling pathways, modulation of repair factors, and regulation of nearby genes, suggesting that targeting lncRNAs is a promising strategy to reverse chemotherapy resistance to DDP in NSCLC (Wang et al. 2018). For instance, lncRNA small nucleolar RNA host gene 1 facilitates DDP resistance, metastasis, and proliferation of NSCLC cells through the miR-330-5p/doublecortin-like kinase protein 1 axis (Ge et al. 2021). LncRNA Forkhead box D3 antisense RNA1 upregulates mouse double minute 2 level by decreasing miR-127-3p to enhance DDP resistance in NSCLC (Zeng et al. 2020). Knockdown of lncRNA TatD DNase domain containing 1 diminishes tripartite motif 66 level to enhance DDP sensitivity in NSCLC by augmenting miR-451 (Wang et al. 2019). Of note, LINC00482 acts as an oncogene in various cancers. For instance, LINC00482/hsa-miR-6756-3p/regulator of calcineurin 2 may exert vital functions in the progression of chronic pancreatitis to pancreatic ductal adenocarcinoma (Zhao et al. 2023). LINC00482 is related to the overall survival of patients with alpha-fetoprotein-negative hepatocellular carcinoma (Liu et al. 2021). LINC00482 is upregulated in bladder cancer tissues and cells and facilitates angiogenesis and inflammation in bladder cancer through upregulation of the forkhead box A1/matrix metalloproteinase15 axis (Wang et al. 2020). Moreover, Zhang et al. uncovered that LINC00482 expression was upregulated in LUSC cell lines and tissues (Zhang et al. 2022a, b). Concordantly, this research identified high LINC00482 expression in NSCLC tissues and cells. However, the influence of LINC00482 on DDP resistance in NSCLC has not been discovered. Interestingly, this research unveiled that LINC00482 knockdown reduced viability and clone formation and elevated apoptosis in DDP-stimulated NSCLC cells, thereby enhancing cell sensitivity to DDP in NSCLC. Further data from gain-of-function assays revealed that upregulated LINC00482 restrained NSCLC cell sensitivity to DDP. Tumor-bearing mouse assays validated that LINC00482 knockdown restrained tumor growth and enhanced DDP sensitivity in mice.

Next, the mechanism of LINC00482 on DDP resistance in NSCLC was predicted by website and bioinformatics analyses, indicating that the actions of LINC00482 in NSCLC may be achieved by modulating E2F1 to affect CLASRP levels. Through a series of experiments, we observed that LINC00482 was mainly localized in the cell nucleus and that LINC00482 recruited E2F1 to enhance CLASRP expression in NSCLC cells. As a member of the E2F family, which is associated with cell cycle, E2F1 is primarily engaged in a variety of cellular processes, like DNA repair, proliferation, cell differentiation, cell cycle progression, apoptosis, and DNA replication (Zou et al. 2020). Considerable evidence demonstrates that E2F1 as an oncogene can contribute to malignant behaviors in NSCLC cells (Li et al. 2021; Lv et al. 2021; Wang and Wang 2020). Of note, E2F1 may enhance DDP sensitivity in NSCLC cells via upregulation of solute carrier family 7 member 2 expression (Jiang et al. 2023). miR-26a depressed DDP resistance in human NSCLC by down-regulating the High mobility group A-mediated E2F1-protein kinase B pathway (Yang et al. 2016). These studies indicate that E2F1 is implicated in the sensitivity to DDP in NSCLC. A prior study unraveled that CLASRP was related to poor prognosis in patients with clear cell renal carcinoma (Yang et al. 2021). CLASRP exerts essential functions in cancer progression and is an independent prognostic factor for patients with head and neck cancer (Liang et al. 2019). However, no studies have explored the association between CLASRP and NSCLC. Our data identified that CLASRP expression was upregulated in LUAD and LUSC samples and that CLASRP overexpression counterweighed the facilitation of LINC00482 knockdown on DDP sensitivity in NSCLC.

Conclusions

In conclusion, this research first uncovered the roles of LINC00482 and CLASRP in NSCLC. LINC00482 knockdown facilitate the sensitivity to DDP in NSCLC by inactivating the E2F1/CLASRP axis. This research presents a novel view that treatment targeting LINC00482 knockdown may enhance the efficacy of DDP, which is beneficial for NSCLC management. However, a limitation of this research is that no further clinical trials were conducted. Therefore, the future challenge will be devoted to the research in clinical trials, which may provide novel targets for the clinical treatment and management of NSCLC.