Introduction

As sessile organisms, plants are exposed to adverse conditions frequently, such as drought, high or low temperatures, and high salinity, which can influence the growth and development of plants. During evolution, plants have developed sophisticated mechanisms to adapt to stress. TFs can bind to promoters cis-acting elements or interact with other proteins to regulate (activate or repress) the expression of specific stress-related genes. AP2/ERF transcription factors are among the largest plant TF families. AP2/ERF TFs are divided into three subfamilies according to the number of domains and their binding motifs: AP2 (containing two AP2 domains), ERF/DREB (having one AP2 domain), and RAV (with an AP2 and a B3 domain) (Mizoi et al. 2012). For example, the RAV (ABI3/VP1) transcription factor has two distinct DNA-binding domains with an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which can bind to CAACA and CACCTG sequence elements, respectively, therefore unique (Swaminathan et al. 2008).

Previous studies have found that proteins with AP2 and B3 domains are involved in plant stress responses and play a vital role in plant growth and hormone signal transduction (Park et al 2001; Swaminathan et al. 2008; Zhang et al. 2005; Gao et al. 2020). In Arabidopsis, AtRAV1 suppresses flowering and hypocotyl elongation, and its overexpression of AtRAV1 inhibits lateral roots and leaf growth (Hu et al. 2004). Similarly, soybean GmRAV overexpression showed a dwarfing phenotype, lower photosynthetic rate, shorter root length, and delayed flowering time (Lu et al. 2014; Zhao et al. 2008). The cotton RAV1 overexpression in Arabidopsis confers plants with high salinity resistance and drought sensitivity compared to wild type (Li et al. 2015). AtRAV1 and AtRAV2 overexpression enhance drought tolerance in transgenic cotton (Mittal et al. 2014). In addition, in Arabidopsis, RAV TF modulates drought and salt stress response independent of ABA (Fu et al. 2014), AtTEM1 and AtTEM2 (TF with B3 domain) inhibit the production of two florigenic molecules and gibberellin production, delaying flowering (Matias-Hernandez et al. 2014; Osnato et al. 2012). Another research also displayed that TEM overexpressing plants in Arabidopsis were hypersensitive, whereas the tem1tem2 double mutants were more tolerant to salinity (Osnato et al. 2021). Furthermore, in transgenic tomatoes, overexpressing the Arabidopsis CBF1 gene, tomato RAV interacted with AtCBF1 to regulate the expression of PR genes conferring bacterial wilt tolerance (Li et al. 2011). Although previous researches showed that the expression of RAV genes from other species in tobacco affects tobacco growth (Lu et al. 2014; Zhao et al. 2008), their role in tobacco is not known.

Tobacco is an economic crop, also used as an essential model in gene experiments. However, its growth and development were influenced largely by environment factors, such as drought stress. Previous studies have found that when tobacco suffered from drought stress, numerous physiological and molecular adaptations to drought were observed including abscisic acid and amino acid accumulation, stomatal closure, reactive oxygen species (ROS) homeostasis, and regulation the expression of drought-responsive gene (Lim et al. 2015; Jha et al. 2022; Xie et al. 2022). Studying the molecular mechanisms of stress adaptation and tolerances as well as mining regulatory genes is essential for tobacco. In this study, the NtRAV4 TF encoding a RAV DNA-binding protein was identified in tobacco. By overexpression and knockout of NtRAV4 in Nicotiana tabacum, we found that NtRAV4 plays a negative role in drought tolerance by regulating the tobacco's antioxidant capacity and defence system. Our findings will improve the understanding of the molecular mechanisms underlying transcriptional regulation in response to abiotic stress.

Materials and methods

Plant materials and stress treatment

NC89 tobacco seeds were planted in soilless media (Pindstrup substrate) and cultured at 28 °C for 16 h / 8 h light and dark cycle in a controlled environment. At approximately 4-week tobacco seedlings were treated in 200 mM mannitol solution and incubated for 72 h to simulate drought stress. For hormone treatment, seedlings were sprayed with 100 µmol ABA and methyl jasmonate (MeJA), and data on three seedling replicates of the same leaf position were collected separately at 0, 1, 3, 6, 9, 12, 24, 48, and 72 h after treatment administration. Samples from root, stem, lugs, middle leaf, upper leaf, flower, and seed were obtained from NC89 tobacco plants of following anthesis in the field. Samples were immediately frozen in liquid nitrogen and stored at -80 °C until use.

Promoter analysis

The promoter sequence of NtRAV4 (1500 bp upstream of ATG) was retrieved from the restricted Tobacco Genome Database, China, and cis-acting elements of the promoter is predicted by online software PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/).

RNA extraction, reverse transcription and quantitative reverse transcription (qRT) PCR

Total RNA was extracted using the Plant Total RNA Isolation Kit (Foregene Co., Ltd, Chengdu, China) and then reverse transcribed into cDNA using a HiScript II Q RT SuperMix for qPCR Kit (Vazyme, Nanjing, China) for further qRT-PCR analysis. The qRT-PCR mix included 1 µL cDNA, 5 µL MonAmp™ SYBR® Green qPCR Mix (Monad, Wuhan, China), 0.2 µL forward primer, 0.2 µL reverse primer, and 3.6 µL Nuclease-Free Water. The reaction was carried out in a 96-well plate, qRT-PCR instrument (Eppendorf, Hamburg, Germany). The PCR procedure was 95 °C for 30 s, 40 cycles (95 °C for 10 s, 60 °C for 10 s, 72 °C for 30 s), and dissolution curve (use the instrument default acquisition program). The qRT-PCR analysis was performed using gene-specific primers for NtRAV4, ROS-related (NtSOD, NtPOD, NtCAT), and stress-responsive genes (NtP5CS, NtOAT, NtNCED3, NtLEA5, and NtLTP1). The mRNA levels were normalised to those of the L25. The specific primers used are shown in Supplementary Table S1, and gene expression was calculated using the 2 –ΔΔCt method (Livak and Schmittgen 2001).

Subcellular localisation

The full-length cDNA of NtRAV4 in tobacco leaves was amplified with specific primers (NtRAV4-Sub-F/R), according to the sequence data in the tobacco Genome Database of NtRAV4 (GenBank accession: XM_016589940), and the amplified PCR products were connected to the pBWA (V) HS-ccdb-GLosgfp vector to produce the pBWA (V) HS-NtRAV4-GFP vector fused with the green fluorescent protein (GFP) reporter gene. NtRAV4 was linked to nuclear localisation signal protein (NLS) and cloned into the pBWA (V) HS-ccdb-GLosgfp vector to produce the pBWA (V) HS-NtRAV4-NLS fusion protein as a nuclear labelling vector. The positive clones were confirmed by sequencing and then transferred into Agrobacterium tumefaciens (EHA105) by electrotransformation. The 30-day-old quality seedlings were selected, injected from the leaf lower epidermis, cultured in low light for 2 days, and observed and imaged under a laser confocal microscope (Nikon C2-ER, Tokyo, Japan) with the corresponding empty carrier as a control.

Transactivational and binding activity analysis

The coding sequence (CDS) of NtRAV4 was subcloned into the GAL4 DNA-binding domain at the EcoRI/BamHI site of the pGBKT7 vector. Transfecting pGBKT7-NtRAV4 (plasmid), pGBKT7-p53 (positive control), and pGBKT7 (negative control) into AH109 cells independently. The yeast cells were selected in SD-Trp/-Leu (DDO), SD-Trp/-Leu/-His + X-α-Gal (TDO/X), SD-Trp/-Leu/-His/-Ade + X-α-Gal (QDO/X) culture medium after transformation. The yeast cells were selected for 3 days and then cultured with 20 g·mL−1 X-α-Gal in blue. The transcriptional activity of NtRAV4 was verified based on its growth status and α-galactosidase activity.

Generation and identification of transgenic plants

According to the NovoRec® PCR, one-step directional cloning kit, the overexpression vector was constructed, and the positive overexpression vector was transferred into the competent cells of Agrobacterium GV3101. Then, tobacco was transformed by leaf disc method, kanamycin resistance was screened, well-developed wild-type and transgenic strains were selected, DNA was extracted, and primers were designed for PCR positive identification.

The ntrav4 mutants were generated using the CRISPR/Cas9 system in the tobacco background. The 22 bp targeting sequences (including 3 bp PAM sequences) (AGGACATGTTGTGAAGATGGGG) were used to construct the CRISPR/Cas9 genome editing vector. The CRISPR/Cas9 plasmids were introduced into Agrobacterium tumefaciens strain EHA105. The generation and identification of mutants were conducted as described previously (Li et al. 2017). Genomic DNA was extracted and primer pairs flanking the designed target site were used for PCR amplification. And, the PCR products were sequenced to confirm the homozygous mutants.

Drought treatment

For drought treatment, approximately 9-week-old tobacco seedlings were cultured as described above. The seedling irrigation was cut for 12 days until the soil moisture content to approximately 8% with normal irrigation for the control seedlings. After 12 days of moisture stress, parts of the tobacco seedlings were collected for analysis, and other parts of the seedlings were watered to observe the phenotype, and detect the stomatal characteristics, gene expression level using the first young leaf from the top of the seedlings, enzyme activity, hormone concentration and malondialdehyde (MDA), O2•− and H2O2 concentrations using the 2rd leaf counted from top to bottom of the seedlings, as well as proline content using the 3rd leaf counted from top to bottom of the seedlings.

Stomatal measurement

Ten 1 cm2 square leaf discs were cut from the back of 3rd tobacco leaves from top to bottom, and the leaf discs were placed in 4% glutaraldehyde PBS buffer, dehydrated by ethanol, and freeze-dried. The pores were observed and imaged using scanning electron microscopy, and the stomatal pore diameter and density were measured using Photoshop software.

Physiological measurements and histochemical staining

Ion leakage (EL) was detected according to the method by previous study (Dahro et al. 2016). Proline, MDA content, ROS level (O2•− and H2O2), and antioxidant enzyme activities including superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) as well as AsA-GSH cycle substances contents including ascorbic acid (AsA), glutathione (GSH), ascorbate peroxidase (APX) and glutathione reductase (GR) were determined using an enzyme activity test kit (Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). The accumulation of O2•− and H2O2 in the first leaves was detected by histochemical staining with NBT and DAB (Yang et al. 2014).

Hormone measurement

The indole acetic acid (IAA), abscisic acid (ABA), gibberellin (GA3), and zeatin riboside (ZR) contents in plants were determined by enzyme-linked immunosorbent assays (Nanjing Jian Cheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions.

Statistical analysis

The SPSS software (version 23.0; IBM Analytics, NY, USA) was used for data analysis, and the Student's t-test was used to evaluate the significance of differences. All data were obtained from at least three biological replicates with standard deviation (SD).

Results

Expression pattern analysis of NtRAV4 in tobacco

Based on the genome sequence of N. tabacum, 1500 bp promoter of NtRAV4 was obtained, and cis-regulatory elements were predicted using the PlantCARE software. The results showed that the cis-acting elements included low-temperature response element (LTR), MeJA-responsive element (CGTCA-motif), MYB binding site involved in drought inducibility (MBS), light-responsive elements (SP1 and MRE), stress-responsive elements (TC-rich repeats), and abscisic acid-responsive elements (G-box, ABRE) (Fig. 1a). Based on this prediction, qRT-PCR was used to detect the expression level of NtRAV4 in different tissues under abiotic stress, and in hormonal treatments. Tissue-specific expression analysis displayed that NtRAV4 was expressed in all examined tissues, the stems and lugs had the highest expression level, and the lowest expression level was in the flowers (Fig. 1b). And, the expression levels of NtRAV4 firstly increased after drought-induced stress, ABA, and MeJA treatments,  then decreased, and reached a peak at different points with different degrees (Fig. 1c–e).

Fig. 1
figure 1

Expression profiles of NtRAV4 in tobacco. a Cis-elements analysis of NtRAV4 promoter. b Expression of the NtRAV4 genes in seven different tissues at various tobacco developmental stages. c–e Relative gene expression levels of NtRAV4 in tobacco leaves under drought, ABA, and MeJA treatments. Relative expression level refers to normalization with ribosomal L25. Data represent the mean ± SD of three replicates

Full size image

Subcellular localisation and trans-activation activity analysis of NtRAV4 Protein

The NtRAV4 protein cellular distribution was detected using the Agrobacterium-mediated transient expression method labelled with green fluorescent protein (GFP) in tobacco epidermal cells. Fluorescence microscopic imaging showed that in the transformed control vector leaves, GFP was uniformly distributed throughout the epidermal cells. Furthermore, after transient expression of NtRAV4-GFP fusion proteins in tobacco epidermal cells, the GFP signals were merged with the nucleus-anchored localisation signal marker (NLS) (Fig. 2), suggesting that NtRAV4 was localised in the nucleus.

Fig. 2
figure 2

Subcellular localisation analysis of NtRAV4. NtRAV4-GFP fusion protein was transiently expressed in tobacco epidermal cells. The images were observed by a laser confocal microscope (scale = 20 μm)

Full size image

Transcriptional activity is an essential feature of the transcription factors. A yeast two-hybrid system was used to analyse the transcriptional activity of NtRAV4. The results showed that PGBKT7-P53, PGBKT7, and PGBKT7-NtRAV4 could grow plaques on DDO, which indicated that the plasmid was successfully transferred into yeast cells and is not toxic to the yeast cells. However, only PGBKT7-P53 developed plaques and turned blue on QDO/X. The pGBKT7 and pGBKT7-NtRAV4 did not develop plaques, suggesting that they could not activate the transcription of a downstream reporter gene and could not interact with X-α-Gal to turn plaque blue. Therefore, pGBKT7- NtRAV4 had no self-activation effect (Fig. 3).

Fig. 3
figure 3

Transcriptional activity analysis of NtRAV4 in yeast. PGBKT7- NtRAV4, PGBKT7-P53, and PGBKT7 were independently transfected into AH109 cells. The transformed yeast cells were cultured on DDO, TDO/X, QDO/X selective medium for 3 days, and then cultured into blue colour with 20 g mL-1 X-α-Gal

Full size image

Generation and identification of transgenic plants

NtRAV4 overexpression vector was constructed by homologous recombination method and transformed into tobacco by Agrobacterium tumefaciens. The successful transformation of NtRAV4 was confirmed in nine tobacco plants using PCR (Fig. 4a). The relative expression of NtRAV4 gene in each positive plant was detected by qRT-PCR. The OE-6 and OE-9 lines with relative higher expression levels were selected for the follow-up experiments (Fig. 4b).

Fig. 4
figure 4

Molecular characterization NtRAV4 transgenic lines. a Positive identification of overexpression. M, 2000 bp DNA marker; + , positive control; -, negative control; 1–10, transgenic lines. b The expression level of NtRAV4 gene in transgenic and WT plants. The expression level of wild-type NtRAV4 gene of tobacco variety WT was normalized to one. c Analysis of the ntrav4 mutants and sequencing detection peak. d The resulting proteins sequences of the ntrav4 mutant. *, termination codon

Full size image

To further confirm NtRAV4 function, we employed the CRISPR/Cas9 system to generate mutants. After identification by sequencing, two independent homozygous mutants, ntrav4-2 and ntrav4-5, were obtained in tobacco. The ntrav4-2 mutant plants contained a 2 bp (CT) deletion of NtRAV4, and the ntrav4-5 mutant plants contained a 1 bp (T) insertion of NtRAV4 (Fig. 4c), which led to the appearance of termination codon in advance (Fig. 4d). The progeny of these homozygous mutants were used in the subsequent experiments. It is worth mentioning that compared to NtRAV4 protein with both AP2 and B3 domains in WT, the ntrav4 mutant protein lacked the unique B3 domain of RAV transcription factor (Table 1), which comprises seven beta-strands and two short alpha-helices (Yamasaki et al. 2013). Lack of B3 domain may lead to the corresponding function changes in mutant plants.

Table 1 Knockout of ntrav4 mutants’ domain
Full size table

ntrav4 mutants enhanced drought stress tolerance and affected osmotic tolerance

To determine whether NtRAV4 is involved in the regulation of drought stress response. Six true leaves of WT and transgenic lines were subjected to natural drought for 12 days with normal seedling watering as a control. There were no significant morphological and RWC differences between the WT and transgenic lines before drought stress. After drought stress for 12 days, ntrav4 mutant plants enhanced stress response capacity by reducing water loss in tobacco, and showed reduced withering and chlorotic phenotyping, and higher RWC (Fig. 5a, b).

Fig. 5
figure 5

Characterization of tobacco transgenic lines and WT under normal watered conditions and drought stress. a Morphology of transgenic lines and WT plants growth situation. b The relative water content of leaves was measured at 25 °C. c Electrolyte leakage (EL). d Proline content. e MDA content. f Chlorophyll a content. g Chlorophyll b content. h Total Chlorophyll content. Values represent mean ± SE of three independent replicates. Significant differences (*p < 0.05, **p < 0.01)

Full size image

We also measured the EL, MDA, and proline content. EL is a significant indicator of the cell membrane permeability. A higher EL value indicates more electrolyte leakage and a higher cell membrane damage. MDA is the final metabolic product of membrane lipid peroxidation. MDA content reflects the extent to which plants suffer adversity. On the other hand, under adverse conditions, plant cells make regular efforts to accumulate osmotic adjustment substances to reduce osmotic stress. Proline, an osmotic adjustment substance, plays a regulatory role in regulating cytoplasmic osmotic balance. ntrav4 mutant plants displayed lower EL and MDA content but higher proline content than WT plants and OE lines under drought treatment(Fig. 5c–e), indicating that WT plants and OE lines had more severe damage than ntrav4 plants.

The contents of chlorophyll a, chlorophyll b and total chlorophyll in tobacco leaves under drought stress were also measured (Fig. 5f–h). The results showed that under normal conditions, the contents of chlorophyll a, chlorophyll b and total chlorophyll in leaves of ntrav4 mutant plants were significantly higher than those of WT and OE lines. After drought treatment, the contents of chlorophyll a, chlorophyll b and total chlorophyll in leaves of all lines decreased, however, the contents in ntrav4 mutant plants were significantly higher than in WT and OE lines, which showed that NtRAV4 knockout plants could keep higher chlorophyll content and better photosynthesis capacity under drought stress condition.

ntrav4 mutants affected stomatal characteristics in tobacco

As more than 95% of water loss in plants occurs via transpiration (Schroeder et al. 2001), stomata are the primary organization for gas exchange and transpiration. Water loss was investigated by observing stomatal closure. Under standard seedling irrigation, no significant differences were recorded between the WT and transgenic lines about stomatal aperture and density. However, drought stress resulted in reduced, stomatal apertures and density of WT and transgenic lines when compared with standard seedling irrigation conditions (Fig. 6a–c). And, the ntrav4 plants showed more reduced stomatal aperture and density than WT and OE plants under drought stress, which resulted in that the stomatal opening ratio decreased more obviously in ntrav4 plants after drought treatment (Fig. 6d–e). These results indicated that ntrav4 plants enhanced tobacco drought tolerance by reducing water loss through stomatal closure, thereby reducing stomatal aperture and density.

Fig. 6
figure 6

Characterization of stomatal characteristics of transgenic lines and WT plants in tobacco under normal watered conditions and drought stress. a Scanning electron microscope images of stomatal apertures of transgenic lines and WT plants. b Scanning electron microscope images of the stomatal density of transgenic lines and WT plants. The blue symbol " + " represents closed stomata and the red symbol "-" represents open stomata. c Stomatal apertures in transgenic lines and WT plants. d Stomatal density in transgenic lines and WT plants. e Stomatal opening ratio (%) in transgenic lines and WT plants. Values represent mean ± SE of three independent replicates. Significant differences (*p < 0.05, **p < 0.01)

Full size image

ntrav4 mutants affected antioxidant metabolism under drought stress

To analyse the transgenic plants' antioxidant capacity under standard and drought stress conditions, we detected NBT and DAB staining conditions and the quantitative accumulation of superoxide (O2•−) and hydrogen peroxide (H2O2). The results showed that seedling leaves were slightly and heavily stained under drought stress. The degree of WT and OE seedlings staining was significantly deeper (Fig. 7a, b), suggesting that reactive oxygen species (ROS) levels were higher in the leaves of WT and OE than in ntrav4 plants. Quantitative analyses of O2•− and H2O2 levels further validated these results (Fig. 7c, d). We examined the activities of ROS-scavenging enzymes, including SOD, POD, and CAT. The results showed that the activities of SOD, POD, and CAT antioxidant enzymes were significantly higher in ntrav4 plants than in WT and OE plants under drought treatment (Fig. 7e–g). AsA and GSH play an essential role in maintaining protein stability, integrity of the biomembrane system structure, and defence against membrane lipid peroxidation, which, together with APX and GR, constitute the AsA-GSH cycle, can effectively remove free radicals. The accumulation of AsA-GSH cycle antioxidants was also significantly higher in ntrav4 than in WT and OE plants (Fig. 7h–k). These results suggest that NtRAV4 negatively regulates drought tolerance in tobacco by regulating antioxidant capacity.

Fig. 7
figure 7

Biochemical analyses of WT and transgenic lines under normal conditions (control) and drought treatment. a, b, In vivo localisation of O2•− and H2O2 by nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) staining, respectively. c, d, Determination of O2•− production and H2O2 levels. e–g, Activities of antioxidant enzyme (SOD, POD and CAT); h–k, contents of AsA-GSH cycle, AsA, GSH, APX, and GR. Values represent mean ± SE of three independent replicates. Significant differences (*p < 0.05, **p < 0.01)

Full size image

ntrav4 mutants affected hormone levels under drought stress

Drought stress often causes changes in hormone levels. Therefore, the IAA, ABA, GA3, and ZR contents were measured. As shown in Fig. 8, the increases of IAA, ABA, GA3, and ZR levels were generally observed in ntrav4 compared to WT and OE plants under normal conditions. Among which, ABA and GA3 reached extremely significant levels. After drought treatment, the levels of these hormones significantly increased, the IAA, ABA, GA3, and ZR contents were higher in ntrav4 plants than in WT and OE plants under drought treatment.

Fig. 8
figure 8

Hormone (IAA, ABA, GA3, and ZR) contents in WT and transgenic lines under normal conditions (control) and drought treatment. The experiment was replicated three times (*p < 0.05, **p < 0.01)

Full size image

NtRAV4 regulates the expressions of stress-related genes under drought stress

To explain the function and molecular mechanisms of NtRAV4, we analyzed the stress-related metabolic pathway genes expression levels, including the antioxidant enzyme system, critical genes involved in proline synthesis, and key genes involved in ABA biosynthesis as well as other drought-related genes by qRT-PCR. The expression of these genes is strongly induced by drought stress. Consistent with the activity results of three antioxidant enzymes (SOD, POD, and CAT) in ntrav4 plants, the relative expression levels of NtSOD, NtPOD, and NtCAT were significantly higher than those in WT and OE plants under drought stress. Similarly, NtP5CS and NtOAT genes encoding critical enzymes in proline synthesis were upregulated under drought stress, particularly in mutant plants. Furthermore, the NtNCED3, a key regulatory gene upstream of the ABA metabolic pathway, in addition to NtLEA5 and NtLTP1, which are related to stress defence and drought tolerance, were significantly induced by drought treatments. In agreement herewith, the gene expression of ntrav4 mutant plants was significantly higher than that of WT and OE plants (Fig. 9).

Fig. 9
figure 9

Analysis of expression levels of ROS-related and stress-responsive genes in WT and transgenic lines by qRT-PCR under normal and drought stress conditions. Relative expression level refers to normalization with ribosomal L25. Values represent mean ± SE of three independent replicates. The experiment was replicated three times (*p < 0.05, **p < 0.01)

Full size image

Discussion

The RAV transcription factor is unique because it has AP2 and B3 DNA-binding domains (Kagaya et al. 1999). Previous studies have reported that TFs with B3 domain, such as FUS3, LEC2, and ABI3 function in seed development and ABA signal transduction pathway (Giraudat et al. 1992; Stone et al. 2006); TFs with AP2 domain play central roles in plant growth and development and response to stress and hormone signalling pathways. Also, some researches have shown that the foreign RAV gene could confer stress tolerance in tobacco (Lu et al. 2014; Zhao et al. 2008), but the biological functions and molecular mechanisms of NtRAV in tobacco have not yet been documented. This study identified a novel NtRAV4 TF, a member of RAV subfamily among AP2/ERF gene family, from N. tabacum. Subcellular localisation and self-activation activity analysis revealed that NtRAV4 is localised in the nucleus and has no self-activation effect.

Through the analysis of cis-elements suggested that NtRAV4 may be participate in abiotic stress responses in plants. The NtRAV4 promoter contains several droughts stress response-related cis-elements such as MBS (MYB binding site involved in drought inducibility), G-box, and ABRE elements (abscisic acid-responsive element), TC-rich repeats (stress-responsive element), and CGTCA-motif (MeJA-responsive element) (Fig. 1A). The upregulated NtRAV4 expression after drought, ABA, and MeJA treatments in tobacco suggested that NtRAV4 was involved in stress response in plants. Consequently, to explain the NtRAV4 function, the NtRAV4 overexpressed plants and CRISPR/Cas9—mediated knockout of NtRAV4 transgenic tobacco was obtained. Sequence and domain analysis results showed that the translation of ntrav4 mutant was terminated in advance and ntrav4 mutant protein lacked the B3 domain of RAV transcription factor. The deletion of B3 domain may cause the corresponding function change. Then the drought tolerance ability was evaluated by examining various physiological indicators and clarifying its regulated molecular mechanism. Subsequent experiments suggested that ntrav4 mutant plants confer drought tolerance in transgenic tobacco with higher RWC and lower water loss in leaves.

Plants can control water loss by reducing stomatal conductance and evapotranspiration. Transpiration is the principal pathway that leads to water loss. The stomatal operation state reflects the metabolism of plants to a certain extent. Therefore, the rapid adjustment of the stomatal aperture is an essential plant drought-tolerant characteristic (Jezek and Blatt 2017; Zoulias et al. 2018). The TF-mediated stomatal closure is essential for reducing water loss, this mechanism is crucial for plant survival under drought stress. Our results showed that ntrav4 mutant plants had better water retention capacity under drought stress than WT and OE plants due to stomatal closure and reduced stomatal aperture and density. Consistent with these results, NtERF172 or NtHSP70 overexpression enhances drought tolerance by decreasing stomatal apertures and transpiration rates with higher water use efficiency in tobacco (Song et al. 2021; Zhao et al. 2020). Other studies also illuminated that ABA signalling-induced stomatal closure triggered changes in guard cells, thus reducing transpiration in response to drought stress (Raghavendra et al. 2010; Lee et al. 2012; Yuan et al. 2021). In our research, after drought treatment, the content of ABA and the expression level of NtNCED3 and key regulatory genes of the ABA metabolic pathway increased significantly. These results suggest that NtRAV4 might be involved in ABA-mediated stomatal closure during drought stress.

Most abiotic stress signals can generate redundant ROS accumulation, especially O2•− and H2O2, bring about badly oxidative damage in plants (Skopelitis et al. 2006). Furthermore, ROS accumulation may cause biomembrane lipid peroxidation resulting in MDA accumulation and severe EL. Under drought stress, ntrav4 mutant plants had a significantly lower quantitative accumulation of O2•−and H2O2, MDA, and EL than WT plants. To eliminate ROS accumulation and reduce osmotic stress, plants form an antioxidase system composed of ROS-scavenging enzymes (such as SOD, POD, and CAT), and actively accumulated osmotic adjustment substances (such as proline) to regulate the cytoplasmic osmotic balance. Our research showed that the activities of enzymatic antioxidants and proline content were significantly higher in ntrav4 mutant plants than in WT plants under drought stress. Accordingly, the increased expression levels of NtSOD, NtPOD, and NtCAT in mutant plants resulted in a stronger ROS-scavenging capacity under drought stress. Coincidently, NtP5CS and NtOAT genes encoding vital enzymes involved in proline synthesis were upregulated after drought treatment. In addition, the expression level increased significantly in ntrav4 mutant plants than in WT and OE plants, regulating osmotic balance and protecting the plasma membrane (Bartels and Sunkar, 2005). In addition, NtLEA5 encodes a group of late embryogenesis abundant proteins, which maintains the proteins and membranes stability (Amara et al. 2012). The lipid transfer protein LTP1 is induced by ABA, drought, low temperature, and salt treatment (Hu et al. 2013). Under drought stress, the expression levels of the above genes in mutant plants were all upregulated, which indicated that tobacco drought tolerance was enhanced by inhibiting the expression of NtRAV4.

Under internal and external environmental pressures, plants may adopt a complicated mechanism to preferentially remove excess ROS (Dat et al. 2000). The ascorbic-glutathione cycle (AsA-GSH), an antioxidant defence system of plants, enables plants to scavenge active oxygen. The APX enzyme is involved in the H2O2 decomposition reaction in the AsA-GSH cycle, and the improvement of its activity indicates the progress of the active oxygen degradation rate (Shigeoka. et al. 2002). GR is the last rate-limiting enzyme in the AsA-GSH circulation pathway, necessary for AsA regeneration and antioxidant stress response (Yao et al. 2021). In our study, the activities of AsA, GSH, APX, and GR in vivo increased significantly to remove ROS in mutant plants after drought stress. These results indicate that mutant plants activate the ROS-scavenging system to reduce oxidative damage and enhance drought tolerance.

The present study found that ntrav4 mutant plants enhanced drought tolerance in transgenic tobacco by ABA-mediated stomatal closure to reduce water loss. In this study, we proposed a model of how NtRAV4 negatively regulates tobacco growth and development under drought stress (Fig. 10). (1) Silencing of NtRAV4 expression altered morpho physiology, regulating stomatal movement to prevent water loss. (2) ntrav4 mutant plants enhanced antioxidant enzyme activity to scavenge ROS accumulation to maintain the steady state of the ROS system. (3) NtRAV4 TF mediated the hormone levels and the drought-related genes expression and then conferred drought tolerance in plants. However, further research is needed to determine which downstream genes NtRAV4 directly regulates.

Fig. 10
figure 10

A mechanism diagram of NtRAV4 negatively regulating drought tolerance

Full size image

Conclusions

Our results suggested that NtRAV4 is a nucleus-localised protein, and transactivational and binding activity analysis results showed no self-activation effect. The promoter of NtRAV4 contains many abiotic stress-responsive cis-regulatory elements, and the gene expression of CRISPR/Cas9‑mediated knockout of the NtRAV4 increases in response to drought, ABA, and MeJA in tobacco. Silencing of NtRAV4 reduced water loss, increased antioxidant capacity, and enhanced drought tolerance by regulating ABA-mediated stomatal closure, increasing antioxidant enzyme activity, and upregulating stress-related genes.

Author contribution statement

YG, YY and JX designed the experiments. YG, XM and LQ performed the experiments. YG, JY, WD and ZX analyzed the data. YG and YY writing the original draft. YY and JX review and editing the paper. All authors have read and agreed to the published version of the manuscript.