Keywords

1 Introduction

Multicellular diploid organisms develop either from single diploid cells by asexual methods such as vegetative growth of totipotent cells or from haploid cells by sexual method by a process of fertilization of a female gonadal cell, the mature oocyte by a male gonadal cell, the sperm. The latter mechanism has been selected for mammals during evolution. In this process, the oocyte or the mother cell contributes the essential genomic information along with the mitochondria, while the sperm or the father cell contributes the variations in the genomic information to the next generation and thereby to the gene pool of the population. Along with this, two more major genetic contributions are also made during the process of fertilization. The first is by the transposable elements (TEs) and the second is by the noncoding RNAs present in the haploid cells. These two components of the genome are now known to contribute to both genetic and epigenetic aspects of the zygotic cell, which determines certain aspects of the subsequent steps of the embryonic development. Following embryonic development, the multicellular organism undergoes functional specialization and maturation to adulthood functions. Reproduction is one of the major functions of adulthood. Soon after attainment of adulthood or sexual maturity to reproduce itself, the organism slowly starts experiencing the aging process. Aging sets in slowly but surely. Aging is manifested in all types of cells, organs and organisms, which finally expresses into progressive and cumulative decline in all physiological functions of the cells and tissues. Prominent manifestations among them are the following: decrease in production of reproductive cells ultimately leading to cessation of reproductive ability; weakening of the bones and muscles; wrinkling of the skin; greying of the hairs; decreased physical ability for alertness, movement and capacity to work; decreased mental ability often leading to loss of memory and cognition; lowered immune system; lowered metabolism in almost all the organs; decreased level of confidence and overall loss of physiological balance and coordination among various organ systems of the body. Thus old age makes a person susceptible to many diseases. Often old patients feel less cared for medical treatments. The geriatric medicine is usually either less developed or less cared for in many countries. With all these difficulties, we still notice many old persons keep themselves alive with joyful personality, effective interaction with others and substantial human contribution to their family, immediate neighbourhood and the society at large. Until they remain useful to others, they get attention for their own life. However, many other elderly, due to poor conditions of their health, often become less fortunate in the later part of life. Generally, old age is prolonged for a considerable period of years, thereby adding problems due to lack of quality of life, healthcare issues and family as well as societal responsibilities towards the elderly. Thus a biological natural process of aging of a living organism ultimately gives rise to a multitude of challenges for scientists, clinicians, policy makers and organizations as well as the government. Many individuals and organizations are actively thinking to convert these challenges in the field of aging into opportunities for research on aging, drug-development for elderly and old age-associated diseases, making use of traditional medicine system for healthy aging, innovations in pharmaceutical industry, advancements in clinical practices in geriatric medicine and patient care in hospitals as well as winning the good will and blessings of the elderly populations of the world for the policy makers, organizations, government and society. As biologists, we need to understand the basic mechanism(s) of the aging process in mammals at cellular, biochemical and molecular levels. The present research article is an example of a piece of basic or fundamental research on one of the aspects of the aging process in the rat brain as an experimental model system.

In the mid-20th century, with the discovery of DNA as the genetic material (Watson and Crick 1953), one of the greatest challenges of biology had emerged as how to explain the decoding of information in the form of nucleotide sequence in DNA, a double helical nucleic acid macromolecule, to the stretch of amino acid sequences in proteins, presumed to perform a diversity of cellular functions in all organisms. This was answered following comprehensive experiments and collective insights about the role of a special class of ribonucleic acid molecule, called as ‘messenger RNA’ (mRNA). It is synthesized from DNA (transcription) and carries information to ribosomes for protein synthesis (translation). This proposed the concept of “central dogma of molecular biology” (DNA makes RNA makes protein) (Amiel 1965; Geiduschek and Haselkorn 1969). Subsequently, it was realized that a rather small fraction of mammalian genome was assigned for all proteins, the rest of the DNA especially the repetitive (~40 %), intergenic (~40 %) and intronic (~15 %) DNA was not represented in proteins. They were inadvertently called as “Junk DNA” with no function. With the sequencing of mammalian genomes during the last two decades (Ananda et al. 2014; Gibbs et al. 2004; Venter et al. 2001; Waterston et al. 2002) together with the advancements in the high-throughput genomic screening techniques such as microarrays for global gene expression analysis and next generation sequencing (NGS) (Capobianco 2014; Kawaji et al. 2014) and data acquired from ENCODE (Encyclopedia of DNA elements) (Birney et al. 2007; Siggens and Ekwall 2014) and FANTOM (Functional annotation of mammalian cDNAs) consortia (Carninci et al. 2005; Liang et al. 2015; Lizio et al. 2015), a whole new revelation was made. The ~98 % of the non-protein coding DNA or “dark matter” of the genome is now known to pervasively transcribe into multifunctional forms of non-protein coding RNA molecules, called as noncoding RNAs (ncRNAs), and only ~1.5–1.8 % consists of protein-coding sequences (Denas et al. 2015; Guttman et al. 2009; Iyer et al. 2015; Quek et al. 2015). Thus, instead of having only protein-coding genes with multiple transcription start sites, alternative promoter and enhancer elements, and variable 5ʹ and 3ʹ-upstream regions, maximum portion of mammalian genome coding for myriad of complex ncRNAs of intergenic and intronic origins define the complexity and flexibility of the genome with respect to its evolution (Liang et al. 2015; Marques and Ponting 2014). Until now, many of these ncRNAs have been functionally associated with almost all biological processes from development, lineage specification, differentiation (Ballarino et al. 2015; Cajigas et al. 2015; Gong et al. 2015; Shahryari et al. 2015), cellular reprogramming (Flynn and Chang 2014; Kim et al. 2015; Loewer et al. 2010) to cell proliferation, growth and cell death. Repetitive sequences, besides being prevalently associated with heterochromatin and telomeric organization (Arning et al. 2015; Chow et al. 2010; Lee 2011; Redon et al. 2013; Saksouk et al. 2014), X-chromosome inactivation (dosage compensation), translational regulation, neocentromere formation and generation of small regulatory RNAs (Faulkner et al. 2009; Hoffman et al. 2014; Kapusta et al. 2013), have also emerged as an important source of noncoding RNAs in the mammalian genome (Singh and Rath 2012), however, still their functional relevance in the genome is largely unknown (Faulkner et al. 2009). The revised “central dogma of molecular biology” now includes the ncRNAs as regulatory molecules (Fig. 1) (Wahlestedt 2013).

Fig. 1
figure 1

Schematic representation of the revised “central dogma of molecular biology” depicting the flow of genetic information in eukaryotes and various roles of lncRNAs along with proteins in regulating the steps. The generalized view of the flow of genetic information includes: DNA is the source of all genetic information and from DNA the information is decoded in the form of messenger RNA (mRNA) and then to protein through the ribosomal machinery. The earlier assumption was that proteins perform all functions in a cell for sustenance of life. This concept has been revised with the discovery of various regulatory noncoding RNAs including microRNAs (miRNAs) acting on the mRNAs and long noncoding RNAs (lncRNAs). LncRNAs together with various proteins are involved in maintenance and epigenetic modification of chromatin, transcriptional and post-transcriptional gene regulation, translational initiation, protein metabolism and transport and many others. This gives a whole new concept of exploring the genome and cellular functions in a new dimension (Mattick and Rinn 2015)

Full size image

Noncoding RNAs, based on their expression and function, are divided into two major categories: (a) housekeeping or structural ncRNAs, that include well-characterized infrastructural RNAs such as ribosomal RNAs, transfer RNAs, and small nuclear/spliceosomal RNAs; and (b) regulatory ncRNAs, which comprise of various types of small noncoding RNAs (sncRNAs) such as microRNAs or miRNAs (~19–22 nt.), PIWI-interacting RNAs or piRNAs (~30–32 nt.), small nucleolar RNAs or snoRNAs, promoter-associated small RNAs or PASRs (Hu et al. 2012) and transcription initiation RNAs or tiRNAs (Zaramela et al. 2014), among others, and a wide range of thousands of long noncoding RNAs (lncRNAs). SncRNAs comprise of substantially characterized and highly conserved fraction of transcripts, primarily implicated in functions such as post-transcriptional modulation of mRNA stability and degradation (Olive et al. 2015; Philippe et al. 2015), dosage compensation of X chromosome (Song et al. 2009) and chromatin organization (Chen et al. 2014). Besides this, recently many of them have been studied for their involvement in aging and age-related diseases in C. elegans (lin-14, mir-71, mi-238 and mi-246) (Boehm and Slack 2005; de Lencastre et al. 2010) and animal (mouse, human) models (miR-21, miR-130a and miR-494) (Serna et al. 2012) (Table 1). LncRNAs, on the other hand, are ≥200 to several thousand nt. in size (e.g., XACT, ~250 kb; Xist, ~17 kb) (Mattick and Rinn 2015; Ponting et al. 2009; St Laurent et al. 2015). Also, some recently discovered class of heterogeneous, polyadenylated and 5ʹ-methyl-capped, regulatory RNAs that are spatio-temporally expressed in sense, antisense, overlapping and bi-directional manners from the intronic, intergenic, repeat sequence-rich regions of mammalian genome (Guttman et al. 2009; Porro et al. 2014; Kurokawa 2011; Milligan and Lipovich 2014; Mortimer et al. 2014; Pnueli et al. 2015; St Laurent et al. 2015; Vucicevic et al. 2015). Although most of the lncRNAs are pervasively transcribed in the genome, they show poor sequence conservation and are highly unstable or present in few copies per cell. However, the dynamics, developmental and tissue/cell type-specific expression patterns of lncRNAs are regulated by transcriptional factors (e.g., Oct-4, Nanog, p53 etc.) and epigenetic modifications of histones and DNA methylation, this together with conservation of their promoter sequences strongly propose for their biological function and evolutionary significance (Ponting et al. 2009; Wang and Chang 2011). Their intrinsic tendency to form various secondary structures for functional aspects, is a prerequisite for RNA-protein/RNA-chromatin interactions, this provides them with sensory, guiding, scaffolding and allosteric capacities (Flintoft 2013; Gonzalez-Buendia et al. 2015; Mortimer et al. 2014; Somarowthu et al. 2015). Their biological functions include sex-dependent dosage compensation, gene imprinting (McHugh et al. 2015; Mercer and Mattick 2013; Rinn 2014), chromatin modification and heterochromatinization (Bao et al. 2015; Khalil et al. 2009; Marchese and Huarte 2014; Mercer and Mattick 2013; Wang et al. 2015), epigenetic regulation of gene expression, post-transcriptional modulation of gene expression, via regulation of alternative splicing, RNA editing, RNA transport (Singh 2012), maintenance of nuclear structure, translational regulation by modulating RNA stability and degradation (Legnini et al. 2014) (Huarte et al. 2010), nuclear-cytoplasmic protein trafficking (Hu et al. 2014; Willingham et al. 2005) and many others (Fig. 1). The altered expression of lncRNAs, therefore, has been linked to the progression and prognosis of various cardiovascular and neurological diseases and disorders along with development of various types of cancers (Akula et al. 2014; Sigdel et al. 2015; Xue et al. 2015; Yang et al. 2014). Recently, many lncRNAs have been found to regulate the onset of cellular senescence or various genes/gene networks/processes directly associated with the progression of aging and age-related disorders (Table 2), however, direct implication of repeat sequence containing lncRNA in the aging process has not yet been fully explored. We have recently reviewed the possible link between various lncRNAs, associated with chromatin modulation, telomeric maintenance, p53-mediated cell cycle regulation, with the onset and pathophysiology of aging and age-related neurological, cardiovascular and immunological diseases/disorders (Kour and Rath 2016c).

Table 1 Examples of different miRNAs involved in aging and age-related diseases
Full size table
Table 2 Examples of long noncoding RNAs associated with aging and age-related diseases
Full size table

In mammals, the higher order sensory-regulatory, cognitive and behavioral functions are performed by the complex, dynamic and intricate networks of neurons and glial cells in the brain or central nervous system (CNS). Brain is structurally and functionally heterogeneous in nature but with high levels of coordination among its different functional regions. This has been attributed to various cell types and developmental stage-specific gene expression patterns and their epigenetic regulatory mechanisms such as chromatin remodelling via differential histone modifications and DNA-methylation marks that drive, control and coordinate the gene expression patterns (Graff and Mansuy 2008; Weichenhan and Plass 2013). In a recent study, many cell/tissue/region-specific and spatio-temporally expressed long noncoding RNAs, which bind and recruit epigenetic regulatory enzyme complexes and other transcriptional factors, have been characterized to be essential for plethora of brain functions (Goff et al. 2015; Guennewig and Cooper 2014; Khalil et al. 2009; Lasalle et al. 2013; Mercer et al. 2008) such as brain development (Feng et al. 2006; Lin et al. 2014a; Lv et al. 2013), differentiation (Lin et al. 2014a; Mercer et al. 2010; Ramos et al. 2015), myelination (Lin et al. 2014b), synaptic transmission, strength and plasticity (Bernard et al. 2010), learning and memory, neurogenesis (Aprea et al. 2013; Ng et al. 2013). They are also dysregulated in many neurological diseases (Clark and Blackshaw 2014; Johnson 2012; Roberts et al. 2014b; Ziats and Rennert 2013). However, involvement of lncRNAs in brain aging and age-associated neurological diseases needs further investigation.

In our laboratory, a novel 1339 bp long, repeat sequence containing cDNA, named as LINC-RBE (long intergenic noncoding RNA-rat brain expressed; Accession no. GQ463152) has been isolated by screening of a rat testis λgt11 cDNA library by using a 227 bp rat genomic simple repeat DNA (Accession No. X97459) as a probe (Bajaj 2002; Dey 2000; Dey and Rath 2005). Bioinformatically, LINC-RBE (cDNA) was characterized as a trans-spliced non-protein coding transcript from the rat chromosome 5 and 3, with ~11.7 % of different types of repeat sequences (GA, CA and SINE B2/B4) (Mishra 2009). Through expression analysis by RT-PCR and Northern blotting, LINC-RBE was found to be strongly expressed in multiple rat tissues and when used as a probe, detected various large cellular RNAs in the size range of 10–0.2 kb as well as small RNAs of 20–30 nt., which is in accordance with the in silico based sequence homology of LINC-RBE (cDNA) with eight rat-specific piRNAs, therefore, suggesting their possible processing from the larger transcript(s) and playing role as precursor transcripts in the generation of the small regulatory RNAs. Thus, LINC-RBE represented a class of repeat sequence containing lncRNAs from the rat genome with unknown function. In the present study, analysis of LINC-RBE expression in different neurobiologically distinct compartments of the brain and their age-dependent functional significance was studied in 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats. Through RT-PCR and RNA in situ hybridization, LINC-RBE was reported to be expressed distinctly and differentially as a sense transcript in the cortex, hippocampus and cerebellum regions of the rat brain. LINC-RBE expression increased from young to adult and decreased from adult to old. Therefore, it suggests that repeat-rich lincRNAs could be crucially linked to various complex functions of the brain during maturation from young to adult phases of life, and they are also profoundly altered in the brain during aging from adulthood to old age (Kour 2015).

2 Materials and Methods

2.1 Bioinformatic Analyses

The genomic organization of LINC-RBE cDNA, its chromosomal location, sequence conservation among different vertebrates and homology with other RNA sequences was analyzed by using ESEMBL, UCSC genome browser (http://genome.ucsc.edu/cgibin/hg Blat) and BLAST (http://www.Ncbi.nlm.nih.gov/BLAST) search engines. Its coding potential was found through ORF finder (www.ncbi.nlm.nih.gov/gorf/gorf.htm) and Codon Potential Calculator (CPU) (http://cpc.cbi.pku.edu.cn/docs/terms.jsp), respectively. The functional regulatory elements (putative promoter region, transcriptional factor binding sites, polyA signal, presence of untranslated region or UTR element and possible miRNA target site) in the 2000 bp up/downstream genomic region of LINC-RBE was scanned by using PromoScan (www.bimas.cit.nih.gov/molbio/proscan), GENSCAN (http://genes.mit.edu/GENSCAN.html), RegRNA2.0 (http://regrna2.mbc.nctu.edu.tw/), and Promo3 (http://alggen.lsi.upc.es/cgi-bin/promo_v3), respectively.

2.2 Semi-quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR)

Most of the molecular biology methods were performed as per the instructions given in the Sambrook’s molecular cloning laboratory manual (Sambrook 2001). The 4 weeks (young), 16 weeks (adult) and 70 weeks (old) male rats were anesthetized with 80 mg/kg Ketamine and 20 mg/kg Xylazine injection (as approved by the Institutional Animal Ethics Committee) and the whole brains were collected. Total RNA was isolated from the brains of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) Wistar rats (Rattus norvegicus) by following the Trizol-method as recommended by the manufacturer (Sigma-Aldrich). Prior to cDNA synthesis, 10 μg of total RNA was treated with RNase-free DNase I (Sigma-Aldrich) to remove the DNA contamination and then purified by phenol-chloroform extraction method. The cDNA was synthesized by reverse transcription from 1.0 μg of DNase-treated RNA in a 25 μl reaction mixture containing 500 ng of oligo-(dT) primer, 0.5 mM dNTPs, 1× M-MLV RT-reaction buffer, 20 U RNasin and 100 U of M-MLV Reverse Transcriptase at 37 °C for 1 h. For the amplification of LINC-RBE and GAPDH (a positive internal control) cDNAs, PCR was carried out by using 2.5–5.0 μl of cDNA in a 25 µl PCR-reaction mixture containing 1× Taq-buffer with 2 mM MgCl2, dNTPs (0.2 mM), Taq DNA polymerase (1 U) and 25 pmol of primer pair specific for LINC-RBE (RBE Fwd: 5ʹCCCAAAATGAGCAAGTAAGGAA3ʹ and RBE Rev: 5ʹTGTCAACAGAAGCCCTTTTTCA3ʹ) and GAPDH mRNA (GAPDHFwd: 5′ACCACAGTCCATGCCATCAC3′; GAPDH Rev: 5′ TCCACCACCCTGTTGCT GTA3ʹ). The amplification conditions used were as follows: initial denaturation at 95 °C for 4 min; followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 54 °C (LINC-RBE) or 60 °C (GAPDH) for 45 s and extension at 72 °C for 45 s and a final extension at 72 °C for 10 min.

2.3 Strand-Specific Expression by RT-PCR

For strand-specific RT-PCR, cDNA was synthesized from 1 µg DNase I-treated total RNA at 50 °C for 1 h by using 0.7–0.9 µM of either sense- or antisense strand-specific primer in a 25 µl reaction mixture containing dNTPs (1 mM), RNase-inhibitor (40 U), 1× M-MLV RT-buffer, M-MLV reverse transcriptase (200 U). The synthesized cDNA was PCR-amplified by using LINC-RBE specific primer pairs for total of 35 cycles under conditions as follows: denaturation at 94 °C for 45 s, primer annealing at 54 °C for 45 s and extension at 72 °C for 45 s. The amplification from the oligo-(dT) primer synthesized cDNA was used as a positive control.

2.4 RNA In Situ Hybridization in Rat Brain Tissue

2.4.1 Gelatin-Coated Slide Preparation

The glass slides, pre-cleaned with 0.2 % HCl and DEPC-treated H2O, were incubated with gelatin solution (0.5 % gelatin and 0.05 % chromium potassium sulphate) in a coupling jar for 1–2 min. The excess gelatin was drained out and the slides were dried at 42 °C for 2–3 h and stored at RT for future use.

2.4.2 Tissue Perfusion, Paraffin Wax Embedding and Tissue Sectioning

The brain tissues from 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats were incubated in 4 % formaldehyde solution for overnight for further fixation and later on dehydrated with a series of increasing ethanol concentrations: 30 % for 30 min., 50 % for 30 min, 70 % for overnight, 95 % for 1 h and absolute ethanol for 1 h at 4 °C. The dehydrated tissue was incubated in xylene and paraffin wax (pre-melted at 60 °C) solution (1:1) at 60 °C for 30 min and subsequently immersed in pre-melted paraffin wax for 3 h at 60 °C. Then ~6–10 µm thick sagittal sections of the wax-moulded tissue were cut by using microtome and the sections were mounted on 0.5 % gelatine-coated slides.

2.4.3 Preparation of RNA Probe by In Vitro Transcription

The cDNA for the noncoding RNA was subcloned with either T7 or T3 RNA polymerase promoter region flanking at the 5ʹ-end or 3ʹ-end. The pBluescript KS(+) construct (1 ng) containing such DNA template was PCR-amplified in a 25 µl PCR-reaction consisting of 1 × Taq buffer, MgCl2 (2 mM), dNTPs (0.2 mM), Taq DNA polymerase (1U) and 25 pmol of strand-specific primer pair for LINC-RBE (sense primer pair: RBE-T7Fwd: 5ʹTAATACGACTCACTATAGGCGGCCCAAAATGAG3ʹ; RBE-T7Rev: 5ʹATGCAATTCT TTGTGTT 3ʹ) and antisense primer pair (RBE-T3Fwd: 5ʹAATTAACCCTCACTAAAGGA TGCAATTCTTTGTGTT3ʹ; RBE-T3Rev: 5ʹCGGCCCAAAATGAG3ʹ), with forward primer containing either T7 or T3 promoter sequence at their 5ʹ-end, to amplify the cDNA from both orientations. The PCR conditions used were: 30 cycles of denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s and extension at 72 °C for 1 min, 30 s. Finally, 500 ng of purified PCR-amplified DNA was used for in vitro transcription of the RNA probes at 37 °C for 1 h in a reaction mixture (50 µl) containing T3/T7 transcription buffer (1×), DTT (2 mM), rNTP mixture (1 mM each of ATP, GTP, CTP; 0.65 mM of UTP and 0.35 mM of UTP-Digoxygenin (dig), RNase inhibitor (40 U) and 40 U of T7/T3 RNA polymerase. The integrity of the RNA product was checked by electrophoresis in a 1.2 % TBE-agarose gel.

2.4.4 Hydrolysis of RNA Probe

The optimal length (~500 bp) of the dig-labelled RNA probes was obtained by hydrolysis method as given by Cox et al. (1984) with few modifications (Cox et al. 1984). Briefly, the in vitro synthesized RNA probe was incubated with two volumes of carbonate buffer (pH 10.2) at 65 °C for optimum time period ‘t’, calculated using the formula, t = (Lo − Lf)/k (Lo)(Lf), where t = time in minutes; Lf = final probe size; Lo = initial probe size and k = 0.11. The hydrolysis reaction was stopped by adding equal volume of neutralizing solution (sodium acetate, pH 5.0), the RNA probe was precipitated with 2.5 volumes of ethanol and one tenth volume of 3 M sodium acetate (pH 5.2) and diluted into a 50 % deionized formamide and 4× SSC solution.

2.4.5 RNA In Situ Hybridization

For RNA in situ hybridization, paraffin-embedded tissue sections were dewaxed, hydrated and permeabilized with 5 μg/ml RNase-free Proteinase K solution in 1× PBS-Triton X-100 for 30 min. at 37 °C. After stopping the reaction with 100 mM glycine solution, the sections were post-fixed in 4 % paraformaldehyde for 10 min. at 4 °C, rinsed twice with DEPC-treated 1× PBS and acetylated twice with 0.1 M tri-ethanolamine (TEA) buffer (pH 8.0) containing 0.25 % (v/v) acetic anhydride for 5 min each. The sections were pre-hybridized in a buffer containing 50 % deionized paraformaldehyde, 4× SSC, 1× Denhardt’s solution at 50 °C and after 2 h, the solution was replaced with hybridization buffer (50 % deionized paraformaldehyde, 4× SSC, 1× Denhardt’s solution, 1 mg/ml denatured herring sperm DNA, 10 % dextran sulphate) containing 30 ng of either sense or antisense digoxygenin-labelled RNA probes and 1 mg/ml tRNA, which was pre-incubated at 65 °C for 5 min. The sections were incubated at 50 °C overnight in a moist chamber. After hybridization, the sections were successively washed in 2× SSC, 1× SSC and 0.1× SSC, treated with 20 µg/ml RNase A to remove any single stranded RNA probe and incubated with blocking solution (100 mM Tris.HCl, pH 7.5, 100 mM NaCl, 2 % BSA and 0.1 % Triton X-100) for 30 min at RT. The dig-labelled hybridized probe was detected by incubating the sections in a blocking solution containing 1:1000 dilution of sheep anti-digoxigenin-alkaline phosphatase-Fab fragment antibody (Roche) for 2 h in a humid chamber followed by development of color due to the alkaline phosphatase activity with the NBT/BCIP substrate solution. The sections were stored at RT for overnight and images were captured under bright field microscope (Nikon-TiS) at 50× and 600× optical magnifications.

2.5 Quantification and Statistical Analysis

For comparison of the RNA expression patterns in the brains of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats, the number of in situ hybridization (ISH)-positive cells were counted and normalized with the number of haematoxylin and eosin-stained cells counted from total of nine different areas of the cortex, three from cerebellum and one each from CA1, CA2, CA3 and dentate gyrus of hippocampus. Similarly, by keeping the base value of black and white to 0 and 1, the mean intensity of ISH-positive cells were quantified by using the Nikon NIS-AR software and the percentage mean intensity of expression relative to its expression in the adult was calculated. The significance of RNA expression was determined by using ANOVA at 5 % significance level and the comparison of the significance between different age-groups was carried out with Turkey test. Each experiment was repeated three times.

3 Results

In order to explore biological function of repetitive DNA present in mammalian genome, we had earlier isolated a novel genomic simple repeat DNA sequence (Accession No. X97459) from the Wistar rat (Rattus norvegicus) genome, which showed triplex (H-DNA) structure in vitro; RNA-homology with many eukaryotic mRNAs mostly in the 5′-untranslated region (5′-UTR) and 3′-UTR due to presence of simple repeat sequences in the mRNAs and expression of endogenous, large-sized, complementary RNA in the rat brain suggesting constitutive expression of long noncoding RNAs from the repetitive DNA of the rat genome under in vivo conditions (Dey 2000; Dey and Rath 2005). This was one of the initial examples of long noncoding RNA expression in mammalian tissue. In order to clone RNAs with repeat sequences, the X97459 genomic simple repeat DNA was used as a probe to screen cDNA library from the rat and human testis and several repeat sequence containing cDNAs were isolated (Bajaj 2002; Dey 2000). Upon DNA sequencing, bioinformatic analyses and RNA expression studies, these cDNAs represented some long noncoding RNAs from the rat genome (Mishra 2009). LINC-RBE is one such repeat sequence containing lncRNA and was originally deposited in the NCBI Genbank as pRT5.5 (Accession no. GQ463152). This was later renamed as LINC-RBE. Here we describe sequence analysis and differential expression patterns of LINC-RBE in the rat brain by RT-PCR and in different parts of the rat brain by in situ RNA hybridization in the young (4 weeks), adult (16 weeks) and old (70 weeks) rats, which has been recently reported (Kour and Rath 2015). The results are discussed in the light of an example of the lincRNAs, differentially expressed in the cortex, hippocampus (subregions: CA1, CA2, CA3 and dentate gyrus) and cerebellum regions of the mammalian brain in an age-dependent manner and its possible functional significance during maturation and aging of the brain. This example argues in favour of the possible role of lncRNAs in maturation and aging of mammalian brain.

3.1 Sequence Characterization of LINC-RBE in the Rat Genome

The sequence analysis of any given transcript in relation to its genomic location, homology to other functional RNAs, evolution and conservation over time among different species, presence of putative regulatory elements in its up/downstream genomic region provide sufficient basic information necessary for analyzing its biological function in an organism. Similarly, we tried to find out the functional sequence characteristics of LINC-RBE in rat genome.

By using rat Mar. 2012 (RGSC 5.0/rn5) assembly on UCSC Genome browser, we found that the 5ʹ1–1213 nt. (~92 %) region of LINC-RBE (cDNA) sequence is homologous to the intergenic region of rat chromosome 5 (Chr.5 q33) and the remaining 1213–1334 3ʹ nt. (8 %) region is homologous to the intergenic region of rat chromosome 3 (Chr.3 q36), therefore, suggesting it to be a trans-spliced intergenic transcript. Also, Chr.5 q33 region, upstream of LINC-RBE (genomic DNA), contains transcription sites for various piRNAs (Girard et al. 2006; Lau et al. 2006), eight of which (DQ73550, DQ628056, DQ752533, DQ747205, DQ619691, DQ751276, DQ748367 and DQ613867) were found to be generated from within the LINC-RBE (cDNA) sequence (Fig. 2a; Table 3). Although the sequence comparison study of 5ʹ1–1213 nt. region of LINC-RBE (cDNA) in UCSC genome browser showed LINC-RBE to be less evolutionarily constrained and moderately conserved among 13 different vertebrate species (Chodroff et al. 2010; Johnsson et al. 2014; Ponjavic and Ponting 2007), the presence of various tandem conserved regions in its upstream region at chromosome 5 and its highly conserved syntenic similarity with the piRNA clusters in the mouse chromosome 4 intergenic region argues for its possible function as a piRNA-precursor long noncoding RNA (Fig. 2b) (Kour and Rath 2015). One of these highly conserved regions, lod = 19, showed homology to four mouse (Mus musculus) piRNAs (DQ687281, DQ725370, DQ699388 and DQ726299) and one rat (Rattus norvegicus) (DQ618908) piRNA (Fig. 2a).

Fig. 2
figure 2

Sequence analysis of LINC-RBE (cDNA). a Sequence homology of 1339 bp LINC-RBE (cDNA) (5′-1217 bp region) to the rat chromosome 5 (q33.3) and various rat and mouse piRNAs (already described in the rat genome database) transcribed from this region. b Conservation studies using UCSC Genome browser showed LINC-RBE (cDNA) to be moderately conserved among vertebrates with one highly conserved syntenic region in the intergenic region of mouse chromosome 4. c The coding potential of LINC-RBE (cDNA), analyzed by using ORF Finder tool, showed putative ORF of less than 300 codons but the predicted peptides did not show any homology with known peptides in the protein database. d Similarly, the coding potential of LINC-RBE (cDNA) by using codon potential calculator showed very low coding score and ORF coverage. Thus, LINC-RBE is a long noncoding transcript [from Fig. 1a and 1b of Kour and Rath (2015) with permission]

Full size image
Table 3 Rat piRNAs homologous to LINC-RBE sequence
Full size table

Furthermore, the scanning of 2000 bp up/downstream sequence of LINC-RBE (cDNA) on the chromosome 5 by using RegRNA2.0 and Genomatix Genome analyzer found binding sites for many important transcriptional factors involved in cell growth, proliferation and development, such as Activator Protein-1 (AP-1), SRY (sex determining region Y)-box 9 (Sox9), Retinoic Acid Receptor (RAR-alpha: RXR-alpha), Glucocorticoid Receptor (GR) and many others (Fig. 3b); 14 binding sites of the RNA binding protein, Musashi, which is a characteristic translational activator of certain temporally expressed mRNAs in Xenopus oocyte and a known context-dependent translational regulator in proliferating mammalian cells through its modulation of cytoplasmic polyadenylation (Rutledge et al. 2014; Sutherland et al. 2013) (Fig. 3c); two polyadenylation signals (Fig. 3b), one within (5ʹ AAATAAATCCAAACTCCAAATTGCCTTT3ʹ) and one ~903 bp downstream of LINC-RBE (genomic DNA) sequence (5ʹ AATAATCATCTGATGGTTTCATGTTACCTTTGT TT TC3ʹ); and one target site of the miRNA, rno-mir466-b within LINC-RBE (genomic DNA) (Fig. 3d). Thus, it suggests the multi-factorial regulation of LINC-RBE expression in the rat genome. Besides, a putative promoter region (250 bp) containing the regulatory binding sites for the transcription factors: Nuclear Factor kappa B (NF-κB), Serum Response Factor (SRF), Octamer-binding transcription factor (Oct factors) and Transcription Factor IID (TFIID) at 1250 bp downstream of LINC-RBE (genomic DNA) and −26 to −276 bp from the putative transcriptional start site (TSS) (+1) at chromosome 5 was also found by using PromoterScan (Fig. 3a). However, through Codon Potential Calculator (CPC) (Grote et al. 2005) and NCBI Open Reading Frame (ORF) finder tools, we found that LINC-RBE has a characteristic feature of a non-protein coding transcript with a low coding potential score of −1.11689 (lod score 31.92) and ORF coverage of 21.73 % (lod score value = 31.92) (Fig. 2c). The predicted small ORFs (128, 292, 132, 138 codon size) showed considerably small sequence homology with any known peptides in the protein database, thus, falling short of the criteria for a polypeptide to be considered as a functional protein (Fig. 2d). Overall, bioinformatic studies have confirmed that LINC-RBE is an intergenic lncRNA, which despite being less evolutionarily conserved, could possibly be regulated by various factors and might act as a precursor RNA for various piRNAs in rat cells and tissues.

Fig. 3
figure 3

Presence of various regulatory elements in the up/downstream genomic region of LINC-RBE. a Schematic representation showing presence of the putative promoter region, consisting of binding sites for the transcription factors: NF-κB, Oct-2, NF-S, TFIID, at 1250 bp downstream of LINC-RBE (genomic DNA) in the rat chromosome 5. b–d Schematic representation of presence of various regulatory elements such as polyadenylation signals (b), transcriptional factor binding sites (b), UTR-elements (c), and possible miRNA target sites (d) in the 2000 bp up/downstream region of LINC-RBE (genomic DNA) in the rat chromosome 5 were analyzed by using RegRNA 2.0, Genomatix Genome analyzer and Promo 3.0, respectively [from Fig. 1c of Kour and Rath (2015) with permission]

Full size image

3.2 Transcriptional Strand-Specificity of LINC-RBE in Adult Rat Brain

The different modes of transcription of various lncRNAs, such as sense, antisense, overlapping and bidirectional, in the mammalian genome could provide information about their biological role. Therefore, we assessed the transcriptional strand-specificity of LINC-RBE in the adult rat brain to gain insight into their possible role by using strand-specific sense or antisense primer during the reverse transcription step of RT-PCR (Fig. 4a). We found that in case of LINC-RBE, an amplicon of 545 bp was obtained from the reaction containing cDNA synthesized by using the antisense LINC-RBE specific-primer (RBE-Fwd), whereas no amplification was obtained in case of the sense-specific primer (RBE-Rev) (Kour and Rath 2015). Therefore, based on the complementarity of RBE-Fwd primer to the reverse (minus) strand of chromosome 5, we inferred that LINC-RBE is transcribed as a sense-transcript from the intergenic region of rat chromosome 5. The amplification from the oligo-(dT) primer synthesized cDNA suggested that LINC-RBE is a polyadenylated lincRNA.

Fig. 4
figure 4

Age-dependant expression of LINC-RBE in the rat brain by RT-PCR. a Strand-specificity of transcription of LINC-RBE in the adult (16 weeks) rat brain was determined by using strand-specific sense (RBE-Fwd) or antisense (RBE-Rev) primer during cDNA synthesis step of RT-PCR. b Expression of LINC-RBE in the brain of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats was studied by RT-PCR. GAPDH mRNA was used as an internal control. c, d LINC-RBE expression was normalized to that of GAPDH mRNA. −RT Negative control; M 100 bp DNA-ladder; LC loading control (545 bp DNA-amplicon); *** p < 0.001 (n = 4). [from Fig. 2 of Kour and Rath (2015) with permission]

Full size image

3.3 Analysis of LINC-RBE Expression by RT-PCR in Rat Brain During Aging

In mammals, through extensive high-throughput RNA sequence analysis, it has been shown that the brain has the highest transcriptome complexity in comparison to all other organs (Soumillon et al. 2013). Diverse groups of lncRNAs with different neurobiological functions such as brain development, differentiation, myelination etc. have been described in literature, however, association of lncRNAs with the process of aging and age-related brain diseases and disorders such as Alzheimer, Parkinson etc. have recently become evident. Since LINC-RBE was strongly expressed in the adult rat brain, we, therefore, investigated its likely involvement during maturation and aging of the brain by studying its expression pattern in the brains of 4 weeks (young), 16 weeks (adult), and 70 weeks (old) rats by RT-PCR (Fig. 4b, c). The expression of GAPDH mRNA was taken as an internal control and used for normalization of LINC-RBE expression. We found that the expression of LINC-RBE, measured as integrated density value (IDV), significantly (~2× fold) increased from young to adult (p = 0.0075) and then decreased (~1.7× fold) with aging from adult to old (p = 0.017) in the rat brain (Fig. 4c) (Kour and Rath 2015). Thus, the age-dependent differential expression patterns of LINC-RBE in the rat brain suggest its possible involvement in functions related to maturation and aging of the brain.

3.4 Expression and Localization of LINC-RBE by RNA In Situ Hybridization in Rat Brain During Aging

Recently, numerous studies have shown that many functionally characterized lncRNAs follow distinct cell type-, tissue- and developmental stage-specific expression patterns in mammalian brain, which define and relate to their biological roles. The age-dependent expression of LINC-RBE in rat brain has, therefore, led us to further elaborate on its possible function based on its cell type and sub-cellular expression pattern in different functionally specialized neuroanatomical regions of rat brain during aging. This was performed by RNA in situ hybridization in paraffin-embedded brain sections of immature (4 weeks), adult (16 weeks) and old (70 weeks) rats by using digoxygenin-labelled sense- and antisense LINC-RBE-specific riboprobes. The LINC-RBE was found to be differentially expressed with respect to cell types, cell number and intensity of expression, specifically in the pyramidal and granule cells of the forebrain (cortex and hippocampus) and granule and Purkinje cells of cerebellum regions of the brain in an age-dependent manner (Figs. 5, 6 and 7).

Fig. 5
figure 5

Age-dependent expression of LINC-RBE in the cortex of the rat brain by RNA in situ hybridization. a Differential expression pattern of LINC-RBE in paraffin-embedded sections (10 µm thick) of the cortex of the brain of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats by in situ RNA hybridization by using digoxygenin-labelled sense- and antisense strand-specific RNA probes as well as no probe negative control. Age-dependent differential expression pattern of LINC-RBE in the pyramidal and granule cells of different cortical layers of the rat brain with respect to the three age-groups are shown. Bar Scale, 100 and 5 µm. b Number of cells positive for LINC-RBE expression normalized to the number of cells stained by Haematoxylin/Eosin in the cortex of the brain. c Alterations in the intensity of expression of LINC-RBE in the cortex of the brain of young and old relative to that of the adult rats. *** p < 0.001; ** p < 0.01 (n = 3). [from Fig. 3 of Kour and Rath (2015) with permission]

Full size image
Fig. 6
figure 6

Age-dependent expression of LINC-RBE in the hippocampus of the rat brain by RNA in situ hybridization. a Differential expression pattern of LINC-RBE in paraffin-embedded sections (10 µm thick) of the hippocampus of the brain of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats by in situ RNA hybridization by using digoxygenin-labelled sense- and antisense strand-specific RNA probes as well as no probe negative control. Bar Scale, 100 µm. b–e Expression of LINC-RBE in the granule cells of the dentate gyrus (b), and pyramidal cells of CA1 (c), CA2 (d), CA3 (e) sub-regions of the hippocampus. Bar Scale, 5 µm. (f) Number of cells positive for LINC-RBE expression normalized to the number of cells stained by Haematoxylin/Eosin in the hippocampal sub-regions of the brain. (g) Alterations in the intensity of LINC-RBE expression in the hippocampal sub-regions of the brain of young and old relative to that of the adult rats. *** p < 0.001; ** p < 0.01; p < 0.05 (n = 3). [from Fig. 4 of Kour and Rath (2015) with permission]

Full size image
Fig. 7
figure 7

Age-dependent expression of LINC-RBE in the cerebellum of the rat brain by RNA in situ hybridization. a Differential expression pattern of LINC-RBE in the granule (G) and Purkinje (P) cells of the cerebellum in paraffin-embedded sections (10 µm thick) of the brain of 4 weeks (young), 16 weeks (adult) and 70 weeks (old) rats by in situ RNA hybridization by using digoxigenin-labelled sense- and antisense strand-specific RNA probes as well as no probe negative control. Bar Scale, 100 and 5 µm. b Number of cells positive for LINC-RBE expression normalized to the number of cells stained by Haematoxylin/Eosin in the cerebellum of the brain. c Alterations in the expression of LINC-RBE in the cerebellum of the young and old relative to the adult rats. *** p < 0.001 (n = 3). [from Fig. 5 of Kour and Rath (2015) with permission]

Full size image

In brain cortex, LINC-RBE showed varied cell type-specific expression profile with a punctate expression in the granule cells of young and granule/pyramidal cells of old rats, but, a distinct and strong expression pattern was observed in adult rats, which was confined mainly to outer pyramidal and granule molecular cortical cell layers. The relative percentage mean intensity of expression of LINC-RBE, calculated with respect to adult, showed a significant decrease from adult to young and old (F = 93.844, p < 0.001) (Fig. 5a, b), however, this decrease did not correlate with any possible decrease in the number of cells expressing LINC-RBE with increasing age (Fig. 5c) (Kour and Rath 2015). Similarly, in the hippocampus, expression and localization of LINC-RBE showed a high variability in relative intensity in pyramidal cells of CA1, CA2, CA3 regions and granule cells of dentate gyrus among young, adult and old rats (Fig. 6). During brain aging, LINC-RBE expression in hippocampus showed a significant increase of 24 % and 13.1 % in pyramidal cells of CA2 (F = 38.105, p < 0.001) (Fig. 6d, f) and CA3 (F = 7.318, p = 0.025) (Fig. 6e, f) regions, and 18.2 % in granule cells of supra-pyramidal blade of dentate gyrus (F = 28.462, p < 0.001) (Fig. 6b, f), respectively from young to adult, and a decrease of 19.41 % in CA2 (p = 0.001); 11.82 % in CA3 (p = 0.046) and 14.5 % in the dentate gyrus (p = 0.003) regions from adult to old rats. The CA1 region showed no profound change in LINC-RBE expression during brain aging (Fig. 6c, f). Besides this, the number of LINC-RBE positive cells showed a significant variation in CA2 and dentate gyrus, whereas CA1 and CA3 regions showed no change with increasing age (Fig. 6g). The LINC-RBE positive cell population was ~30–35 % in the hippocampal CA2 regions of young and old relative to ~45 % of cells in the adult (F = 8.173, p = 0.019). On the contrary, in suprapyramidal blade of dentate gyrus, LINC-RBE expressing cells showed ~threefold reduction from young and adult to old brains, thus, suggesting the dynamic expression of LINC-RBE with respect to maturation and aging in the rat hippocampal sub-regions (Fig. 6g). Furthermore, LINC-RBE expression was also observed in the Purkinje and granule cells of the cerebellum in young, adult and old rats. Similar to cortical region, the expression of LINC-RBE initially showed a significant increase of ~21 % from young to adult and then a decrease of ~8 % from adult to old in granule cells (F = 158.151, p < 0.001) (Fig. 7a, b). There were ~45 % of LINC-RBE positive cells in adult cerebellum as compared to ~35 % in young and old rats during aging (F = 55.787, p < 0.001) (Fig. 7a, c) (Kour and Rath 2015). Thus, the differential cell type and region-specific expression pattern of LINC-RBE in the three transcriptomically and functionally complex regions of the rat brain, i.e., cortex, hippocampus and cerebellum, with increasing age might suggest its potential functional significance in age-related cognitive processes and neurological diseases.

4 Discussion

Evolutionary conservation of newly discovered protein-coding genes are generally based on their nucleotide or amino acid sequences, which provide invaluable means to understand and evaluate their relatedness, functional significance and probable lineage-specific phenotypes. However, although lncRNAs are abundantly expressed and functionally diverse, these criteria do not explain their selection process during evolution and functional relevance among various species in depth (Chodroff et al. 2010; Guo et al. 2014; Johnsson et al. 2014). Refraining from the conventional concept of linking conservation of sequence to function, there are examples of many functionally characterized mammalian lncRNAs such as Myocardial Infarction Associated Transcript (MIAT), HOX transcript antisense RNA (HOTAIR), X inactive-specific transcript (XIST), Embryonic ventral forebrain-2 (Evf-2) and Antisense Igf2r RNA (Air) with poor sequence conservation among species (Diederichs 2014; Johnsson et al. 2014; Roberts et al. 2014a; Wood et al. 2013). Further, despite showing rapid evolution with accumulating mutation and lacking sequence ortholouge, many lncRNAs show syntenic locus conservation among different species with highly conserved regulatory regions and show specific sub-cellular, cell/tissue and developmental expression patterns in mammals, which as a whole, argues for their function (Diederichs 2014; Mercer et al. 2008; Ponting et al. 2009).

Similarly, by homology studies we found modest sequence conservation of LINC-RBE among 13 different vertebrates with the presence of a highly conserved syntenic locus in mouse chromosomes 4. The presence of various small conserved regions in the up/downstream region of LINC-RBE in chromosome 5 are the sites for synthesis for different piRNAs in the rat and mouse genome, further asserting its function as a precursor lncRNA that may be processed by RNA processing mechanisms to produce many small noncoding regulatory RNAs (piRNAs). In accordance with presence of up/downstream conserved spots, through sequence analysis, we found presence of binding sites for various cell growth/differentiation-specific regulatory transcriptional factors such as RAR-alpha:RXR-alpha, Oct-1, PARP, GR and AP-1, NF-κB and SOX9 in the 2000 bp up/downstream region of LINC-RBE (genomic DNA) in rat chromosome 5. Taken together, our results may suggest the multifactorial regulation of expression and functional relevance of LINC-RBE in the rat genome. Involvement of LINC-RBE in regulation of aging process or its related diseases is emphasized due to the presence of binding sites for major age-related transcriptional factors, GR and NF-κB, (Adler et al. 2007; Rapicavoli et al. 2013), in the up/downstream sequence of LINC-RBE (genomic DNA).

Mammalian genome expresses a huge number of different lncRNAs that are transcribed in sense/antisense orientation with respect to protein-coding genes (Wood et al. 2013). One such example is the long intergenic noncoding RNA repeat-rich sense-antisense transcript (LINC-RSAS) from the chromosome 17, which is expressed in both sense and antisense orientations in the rat brain (Kour and Rath 2016a). Similarly, transcriptional orientation studied for LINC-RBE from the rat chromosome 5 showed its expression in sense orientation in the brain. In mammals, many lncRNAs with variable biological roles showed distinct tissue/organ and developmental stage-specific expression, which specified their tissue-specific function. LINC-RBE was found to be expressed in multiple rat tissues (Mishra 2009) and its expression was high in the adult rat brain. We, therefore, studied its expression in the rat brain during aging.

Aging is defined as a global intrinsic biological phenomenon of continuous and cumulative deterioration of neurological, immunological and physiological as well as cellular and molecular functions in an organism with increasing age (Robert et al. 2010). Alteration of many biological pathways/processes/mechanisms as well as cellular protein levels are proposed to be involved in its onset and progression. Aging is considered to be a major risk factor in the patho-physiology of various diseases and disorders (Robert et al. 2010; Sinha et al. 2014). Recently, through advanced RNA sequencing techniques, vast number of functionally diverse regulatory RNAs, sncRNAs and lncRNAs, have been reported, which could provide another way to explore and discourse the complexity of aging process and its related diseases (Kour and Rath 2016c).

Involvement of small noncoding RNAs in aging and age-related diseases such as cardiac malfunctions (mir-18, mir-19, mir-241, mir-214, mir-217, mir-146) (van Almen et al. 2011; van Balkom et al. 2013), neurological disorders (miR-34a, mir-29, mir-144, mir-107) have been studied extensively. However, function and age-related expression of lncRNAs are much less explored. Till date, only a few reports of modulation of long noncoding RNAs during cellular senescence are known, e.g., senescence-associated known long noncoding RNAs such as Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), MIAT, Taurine up-regulated gene 1 (TUG1) and novel lncRNAs such as XLOC025918, XLOC025931, XLOC023166 mediate proliferation defects and induce senescence phenotype in cultured human fibroblasts upon their down-regulation (Abdelmohsen et al. 2013). Many lncRNA such as H19, Antisense noncoding RNA in the INK4 locus (ANRIL), Air, Telomeric repeat-containing RNAs (TERRA), HOTAIR, Long intergenic non coding RN-p21 (lincRNA-p21) could possibly be implicated in aging process based on their regulatory role in heterochromatin and telomere maintenance, p53-mediated cell proliferation and apoptosis, a paramount factor during progression of aging and its related diseases (Kour and Rath 2016c). Similarly, LINC-RSAS, a repeat-rich 942 bp intergenic lncRNA has been found to be differentially expressed in sense-antisense orientations and age-dependent manner in the rat brain (Kour and Rath 2016a). However, still much is unclear regarding their direct implication and mechanism through which they regulate aging process. In our study, by using RT-PCR and in situ RNA hybridization, we found strong and differential expression of a novel lincRNA, LINC-RBE in the rat brain during aging. Its expression in the brain showed a marked increase from the young (4 weeks) to adult (16 weeks) followed by a subsequent and significant decrease from the adult to old (70 weeks) rats. This suggested the possible involvement of LINC-RBE in functions related to maturation and aging of the brain.

Mammalian brain is a heterogeneous, complex functional system, primarily consisting of various arrangements of interconnected neurons and glial cells in transcriptomically diverse compartments but with elaborate networks. The cortex has many functional areas associated with visual, auditory, motor functions and cognitive functions such as memory, language, emotions, creativity and judgement. Cortex contains neurons of various shapes, sizes, density and different arrangements of neural fibres organized into multiple molecular layers with variable functions. The layer V and VI consisting mainly of pyramidal neurons are highly developed in the cortical regions involved in motor functions and interconnect cortex to subcortical regions by giving rise to efferent cortical projections to brain stem, spinal cord, basal ganglia and thalamus. The hippocampus consists of varied arrangements of extremely larger pyramidal neurons into CA1, CA2 and CA3 regions, and smaller granule neurons in the dentate gyrus region. The changes in dendritic complexity, synapse number, transmission, plasticity and formation of new neurons or synapses via neurogenesis in the hippocampus throughout life plays an important role in learning, generation and storage of memory processes. The cerebellum accounts for 50 % of total neurons in the brain. Anatomically, cerebellar cortex comprises of innermost granular layer, middle Purkinje cell layer and outermost molecular layer consisting of axons of granule cells and the dendrites of Purkinje cells. Cerebellum is primarily involved in motor functions (voluntary movements, balance and posture) and in cognitive functions such as language. The cortex, hippocampus and cerebellum regions of brain function together in controlling various cognitive functions such as spatial learning and generation of episodic memory.

High-throughput sequencing and microarray techniques to evaluate organ level transcriptome along with inputs from Allen Brain Atlas have reported the cell type- and developmental stage-specific dynamic expression of vast number of sense and antisense transcripts from specific regions/compartments of mammalian brain, which via their innumerable associations with various proteins/complexes are involved in complex brain functions such as learning, memory formation, synaptic variations and plasticity, myelination, neuron development and differentiation (Carrieri et al. 2015; Goff et al. 2015; Kadakkuzha et al. 2015; Mercer et al. 2008). Of late, analysis of RNAseq dataset of mouse brain has reported region-specific expression of 2759 lncRNAs in the hippocampus and 2561 lncRNAs in the prefrontal cortex region, the two main regions involved in various cognitive functions and neuropsychiatric disorders, and together they account for 70 % of the total annotated lncRNAs in the mouse genome (Kadakkuzha et al. 2015).

Similarly, through RNA in situ hybridization based expression studies in brain of young, adult and old rats, we found dynamic, age-dependent expression profile of LINC-RBE in different neuroanatomical regions of the brain such as cortex; CA1, CA2, CA3, and dentate gyrus subregions of hippocampus and cerebellum, involved primarily in generation of episodic and spatial learning and memory. The strong, dynamic expression profile of LINC-RBE, in terms of both cell number and intensity, in adult compared to young and old rat brains in the complex brain regions involved in cognitive functions (learning and memory), i.e., cortex, hippocampus and cerebellum, might suggest the possible involvement of LINC-RBE in modulation of various brain functions including neurogenesis during maturation and lack of it during aging. Furthermore, progression of many neurological disorders and diseases with impaired cognitive functions (memory and learning) such as Alzheimer’s disease, autism, Huntington disease have been associated with onset of brain aging (Carrieri et al. 2015). Therefore, further evaluation of LINC-RBE function(s) in the hippocampal and cortical regions of the brain during aging or onset and prognosis of many age-related neurological diseases/disorders would highlight a way to study its relevance in various brain functions and neuro-pathological conditions. Since the varied transcriptome based functional compartmentalization of mammalian brain is the result of differential regional- and cell-specific, epigenetically chromatin-modulated gene expression patterns, transcription of LINC-RBE in the cortex, hippocampus and cerebellum regions might suggest either its chromatin association or chromatin-based regulation of gene expression in the brain during maturation and aging. It may also be involved in various RNA processing pathways in the brain during maturation and aging. In another study, the relevance of LINC-RBE in the function of hippocampus was investigated in primary hippocampal neurons from the adult rat in the presence of a vitamin A derivative, all-trans retinoic acid (atRA), a known regulator of brain development, adult neurogenesis, synaptic plasticity and memory formation. AtRA was found to significantly upregulate expression of LINC-RBE in the nucleus and cytoplasm of the neurons along with the dendrites in a time- and dose-dependent manner (Kour and Rath 2016b). The atRA-mediated induction of LINC-RBE expression was found to be inhibited by actinomycin D, hence, it was regulated at transcriptional level. The possible binding of atRA along with the retinoic acid receptor (RAR: RXR) to the two binding sites present in the putative promoter of LINC-RBE was proposed. Altogether, the decrease in LINC-RBE expression in the hippocampus during brain aging and its transcriptional induction by atRA in the primary hippocampal neurons, could possibly argue for its significance in cognitive functions such as synaptic regulation, learning and memory formation as well as their decline during aging.

5 Conclusion

Transcription, gene expression and RNA processing are complex and heterogeneous in the brain. LncRNAs have emerged as major regulators of these processes. This study is a conclusive representation of possible role of lincRNAs in mammalian brain during maturation from young to adulthood and aging from adulthood to old age. Since the onset of many neurological diseases such as dementia, Alzheimer, Parkinson, Huntington occur late in life, study of molecular aspects of brain functions such as impairment of cognitive functions like short and long term memory formation, thinking capability, decision making etc. with increasing age would provide an important basis for understanding details of such age-related diseases and, therefore, would pave new avenues for development of successful therapeutics and treatments. LncRNAs in coordination with various factor(s)/complex(es) have been found to modulate almost each and every process of the flow of genetic information as depicted in the revised “central dogma of molecular biology”, i.e., chromatin organization, gene expression, RNA processing, translation and RNA/protein trafficking, thus, regulating nearly every aspect of biological processes required for life. The immense transcription and functional implication of lncRNAs in the mammalian brain, thus, would provide a foremost way to explore the biological process of aging and its related diseases extensively. The age-dependent and differential expression of LINC-RBE in specific cell types/regions of the brain, e.g., cortex, hippocampus and cerebellum, the three interconnected regions involved in memory processing and other cognitive functions, may further contribute to more detailed study of brain maturation, aging and age-related diseases at molecular level. LINC-RBE may be used as a biomarker for brain aging.