Keywords

1 Introduction

The rapid economic growth achieved after globalization has adversely affected the quality of the environment and has become a major threat to sustainable development (World commission on environment and development 1987). The pollution load discharged into the environment has exceeded the assimilative capacity and affects sectors like agriculture, domestic water supply, fisheries, public health and biodiversity. Among the entire, industrial processing units textile processing units use huge quantities of water, the effluents discharged by these units are generally hot alkaline, strong smelling, coloured with large amount of toxic substances and they accumulated into the soil. Most of the small scale industries practice traditional processing technology is not treating their effluents properly (Nelliyat 2007). The use of metals and chemicals in dyeing industries generates large quantities of liquid effluent loaded with high levels of heavy metals, often as bioavailable forms (Calderon et al. 2003). For these reasons, interest has arisen recently in the investigation of some alternative methods involving only ecofriendly materials, that leads to metal recovery with minimal impact on the environment and are cost effective. Potentially bioremediation is cheaper than the chemical and physical methods and can deal with even lower concentration of contaminants more effectively although the process may take longer. Microbial populations in metal polluted environments adapt to toxic concentrations and become metal resistant. Different species of Aspergillus, Pseudomonas, Bacillus have been reported as efficient metal reducers and their detoxifying ability can be manipulated (Rajbanshi 2008; World commission on environment and development 1987). This biological process for removal of metal ions from solution can be divided into biosorption and bioaccumulation. Bioaccumulation is the uptake of metal by species means of metabolism dependent processes which may involve both transport into cell and partitioning into intracellular components.

2 Materials and Methods

In 2011, water, soil and plant (Pennisetum typhoides) samples from an irrigation field receiving discharge from small scale textile industries of Tirupur, located on the banks of the Noyyal River were collected (Fig. 1). A portion of the effluent and soil samples were acidified to pH ≤ 2 with Conc. HNO3, refrigerated to prevent the volume change due to evaporation and the concentration of various heavy metal present in all the samples. Crops were washed, air dried, crushed and ground to a powder using mortar and pestle for metal analysis. Soil samples from the rhizosphere region to recover the Arbuscular mycorrizal spores. The samples were processed in 24 h for isolation, enumeration, identification and characterization of microbial flora.

Fig. 1
figure 1

Sample collection area

Full size image

2.1 Physico-chemical Characterization of Effluent, Soil and Crop

The physico-chemical parameters like color, odour, pH, temperature, TS, TSS, TDS, Chlorides, BOD and COD of the effluent, soil texture (Bouyoucos 1962), water holding capacity (Rayment and Higginson 1992), electrical conductivity, cation exchange capacity, organic carbon, free calcium carbonate, organic matter, nitrogen content, bioavailable metal ions (Atomic Absorption Spectrophotometer), sulphide (acidified ammonium acetate extract) whereas bio available potassium, nitrate and phosphorus (Spectronic 20 flame photometer) were analyzed according to standard methods (APHA 2005). Rhizosphere was analyzed for the number of AM spores per 50 g by wet sieving and decanting technique using a series of sieves (50, 75, 100 µm mesh size). Spores were counted on filter paper under a dissection microscope and grouped according to their morphological characteristics (Abubacker et al. 2014).

Detection of metal concentration: The effluent (Babyshakila 2009), soil (Banytan et al. 2000) and the crop (Patel et al. 2004)were digested and analyzed using hollow cathode lamps for chromium (Cr), cadmium (Cd), lead (Pb), zinc (Zn) and nickel (Ni) at 357.9, 228.8, 217.0, 213.9 and 232.0 nm respectively at Sophisticated Analytical Instrument Facility (SAIF), in Indian Institute of Technology Madras (IITM), Chennai using Inductively Coupled Plasma Atomic Emission Spectroscopy.

2.2 Characterization of Pennisetum typhoides Seeds Elemental Analysis

Elemental analysis and Scanning Electron Microscopic images coupled with energy dispersive Xray consisting 3.5 and 2.5 nm resolution for tungsten filament and LaB6 and EDX detector resolution 133 eV of Pennisetum typhoides seeds was assessed (Make: SEM—TESCON—Czechoslovakia). The seeds were dried in hot air oven at 50 °C for 1 h and then powdered using mortar and pestle. The powdered material was placed in steel stab with carbon tape and sputter coated with gold particle for 50 s in high vacuum conditions (Vinod and Sasidhar 2010).

2.3 Enumeration, Isolation and Identification of Bacteria

The soil and effluent samples were serially diluted and plates yielding 30–300 colonies were selected for enumeration. Further, isolation and identification was carried by following standard procedures (Cappuccino and Sherman 2002) and numbered as TEAK 01–TEAK 13 and identified at generic level using the taxonomic scheme of Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994). Upon the percentage of distribution, the predominant isolates from soil and effluent sample were chosen and characterized. CTAB method was used to extract large quantities of heavy molecular weight DNA from bacteria. The pellet obtained was washed with 70% ethanol, dried and dissolved in 50 µl TE buffer with pH 7 or water (Prabha et al. 2013).

For sequencing of 16S rRNA gene region of the selected bacterial isolates, standard PCR amplification was carried out using Ready-To-Go PCR Beads (Sigma Aldrich) containing 5 µl of 10X MTP Taqbuffer, 1 µl of 10 Mm dNTP mix, 0.5 μM of each primer (5′ AACGGCTCACCAAGGCGACG 3′and 5′ GTACCGTCAAGGTGCCGCCC 3′), 0.05 µl of MTP Taq DNA polymerase and 10 ng of template DNA in a 50 µl of reaction mixture in a thermal cycler. The cycling profile included an initial denaturation of 94 °C for 1 min followed by 30 cycles of denaturation (94 °C for 1 min), annealing (5 °C for 60 s) and Extension (72 °C for 65 s) and cooled at 4 °C. 10 μl of the amplified products were subjected to electrophoresis, visualized under UV transilluminator. The amplified PCR products were purified using QIA quick PCR purification kit (Qiagen GmbH, Hilden, Germany) as recommended by the manufacturer. The DNA sequences were run on an ABI 310 automated sequencer using the chain-termination method with big-dye terminators (Applied Biosystems, Foster, CA, USA). Automated base calls were checked by manual inspection of the electrophorogram of both forward and reverse sequences. The base call conflicts were resolved by alignment and comparison of both strands using the Seq Scape® software v 2.5 (Applied Biosystems, Foster, CA, USA) and blasted in the GenBank database (www.ncbi.nlm.nih.gov) for similarity search.

The Phylogenetic tree was constructed using the BLAST tree tool to demonstrate the evolutionary relationship between species, a group of genes related through a process of divergent evolution from a common ancestor or the result of convergent evolution was demonstrated.

2.4 Maximum Resistance Levels (MRL) of Bacterial Isolates Against Cr and Zn

MRL of the purified and characterized bacterial isolates against the HM was determined by preparing nutrient agar medium amended with varying concentrations (mg/L) of the heavy metals Zn (100–3600) and Cr (25–3000). The surface of the heavy metal incorporated agar plates were streaked with pure isolates and incubated at 37 °C for 48–72 h. The highest concentration of heavy metal that allows growth after 48 h of incubation was designated as MRL (Rajbanshi 2008).Textile effluent Bacillus sp. MTCC 5342 and Pseudomonas sp. MTCC 2847 were used as positive control.

2.5 Bioaccumulation Potential of Bacterial Isolates

A stock metal solution of (4000 mg L−1) Zn and Cr was prepared by dissolving AR grade salts of ZnSO4. 7H2O and K2Cr2O7 in double distilled water. The working concentration (100, 500, 1000 mg L−1) were prepared from the stock metal solution.

2.5.1 Optimization of the Accumulation Process in Bacteria

Investigation of process dependency on pH: 2% inoculum concentration of bacterial isolates (2 days old cultures) were inoculated separately into 5 sets of 250 ml Ehrlimayar’s flask contained 100 ml of minimal salt medium containing 100 mg L−1 of chromium or 100 mg L−1 of zinc. The pH varied from 6.5 to 8.5 (6.5, 7.0, 7.5, 8.0 and 8.5). The pH of the medium was adjusted using dilute HCL or NaOH and incubated on a rotary shaker in 150 rpm speed at 37 °C with control containing cells inoculated medium without heavy metal. Every 6 h interval, the residual metal concentration was analyzed. Cells were harvested by centrifugation at the end of 48 h incubation. The biomass was weighed, digested and analyzed for accumulation of chromium and zinc ions (Congeevaram et al. 2007).

Dependency of the metal concentration for nourishment: Minimal salt medium (pH 7.5) containing varying concentrations of metal ions ranging from 100 to 3000 mg L−1 was incubated with 2% inoculum at 37 °C. Every 6 h interval, a flask of varying metal concentration was analyzed for the residual metal concentration. At the end of 48 h, the cells were harvested and the biomasses were weighed and the concentrations of heavy metals were analyzed (Congeevaram et al. 2007).

After centrifugation, the filtrate and the pellet were digested with conc. HNO3 in slow boiling, evident by brownish fume (Babyshakila 2009). The concentration of chromium was determined using diphenyl carbazide assay method and concentration of zinc was analyzed using inductively Coupled Plasma Atomic Emission Spectroscopy as described earlier.

Compatibility analysis of the Screened, adapted Bacterial strains: The Compatibility among the isolates, i.e. the antagonistic effect of bacterial isolate on the other bacterial strain was studied by standard well-cut method. Nutrient agar was prepared and poured into sterilized petri dishes and allowed to solidify. Two wells of 6 mm diameter were punctured at equidistant positions adjacent to one another in 9 cm petri dish containing the culture media using sterile cork borers. Hundred µl of each bacterial suspension was added to the wells and the plates were incubated at 37 °C. The diameter of the zone was measured in mm (Chin et al. 2001).

2.6 Bioremoval of Cr (VI) and Zn (II) Ions from Waste Water Through Accumulation Process

Immobilization: An inexpensive matrix Luffa aegyptiaca, commonly known as bath sponge was used for immobilization of bacteria. The dry matrix was sliced into pieces, washed with distilled water and dried in oven at 105 °C. The dried matrices weighing approximately 0.1 g were inoculated with 1 ml of bacterial suspension in petri plates containing 20 ml of sterilized nutrient broth and incubated. The Immobilized material was removed after 48 h and tried for remediation studies (Iqbal and Edyvean 2005).

Bioaccumulation of Cr (VI) and Zn (II) from textile dye effluent waste water: 100 ml of filtered Textile effluent aliquots were taken in six 250 ml Erlenmeyer flasks and their initial chromium and zinc ion concentrations were assayed. To this effluent, growing cells of bacterial isolate TEAK 03 and TEAK 06, bacterial consortium immobilized on Luffa aegyptiaca were added separately, enriched with 0.01% glucose and incubated under the optimized condition respectively. After incubation, the immobilized bacterial cells were harvested and the aliquots were digested using 10 ml of triple acid solution (HNO3, H2SO4 and HCIO4 in 9:2:1 proportion respectively) till the effluent becomes colorless (Ameer Basha and Rajaganesh 2014). Filtered and unfiltered effluent sample without inoculum were used as control. Later, the digested sample was analyzed for the residual metal ions Cr and Zn as per the standard methods.

2.7 Toxicity Assessment of Treated Waste Water—Bioaccumulation Process

The Physicochemical parameters like pH, EC, total suspended solids, total solids, total dissolved solids, chlorides, BOD, COD, metal concentration of the treated effluent was analyzed as per standard procedures (APHA 2005). Seeds of Pennisetum typhoides were surface sterilized with 95% ethanol and then treated with 0.2% mercuric chloride and washed three times with sterile distilled water and blot dried under aseptic conditions. Seeds for the study were obtained from the Institute of Agricultural Research, Tamil Nadu. The seeds were soaked in 40 ml of treated wastewater for 30 min and dried under aseptic condition for 4 h to assess the toxic effect of treated waste water where as the seeds soaked in distilled water and untreated wastewater was used as a control. A total of six seeds were placed in each petri plate containing a moist filter paper and the plates were maintained in a growth chamber for 7 days, the germination percentage was calculated (Prashanth and Mathivanan 2009). The concentration of chromium and zinc was analyzed by digesting the germinated seeds and the filtrate samples were analyzed for Cr and Zn concentration using Inductively Coupled Plasma Atomic Emission Spectroscopy (Patel et al. 2004).

3 Results and Discussion

3.1 Physico-chemical Characterization of Effluent, Soil and Crop

Various parameters viz colour, smell, pH, temperature, electrical conductivity, total dissolved solids, metal concentration of the collected effluent samples, soil samples and VAM spores were analyzed (Tables 1, 2, 3, 4, 5, 6, 7 and 8). The color of the effluents at the sites 1–6 are blackish green, greenish black, slight greenish black, slight greenish, slight greenish, slight greenish and colourless respectively. The offensive odour was found at site 1, pungent odour at site 2, 3 and effluent at site 4–6 were odourless. Because of the effluent pollution, the colour of the soils were dark brown at site 1, reddish brown at site 2–3, brown at site 4, light yellow and site 5 and site 6 remains colourless. There was pungent odour in site 1, fishy in site 2 and rests were muddy in odour. The site 1 is clay loam in texture, whereas in remaining sites were sandy.

Table 1 Physico-chemical characterization of effluent
Full size table
Table 2 Concentration of metal ions present in the effluent
Full size table
Table 3 Exchangeable form of metal ions in effluent sample
Full size table
Table 4 Physico-chemical characterization of effluent discharged soil
Full size table
Table 5 Concentration of metal ions present in the soil
Full size table
Table 6 Exchangeable form of metal ions in soil sample
Full size table
Table 7 Concentration of metal ions present in the plant
Full size table
Table 8 AMF Spore density associated with plantation near the effluent discharge point (Total No. of spores/100 g of soil)
Full size table

The study clearly demonstrates that soil adjacent to the effluent discharge point experiences a change in physicochemical parameters from site to site, well above the CPCB limits (Asfaw 2014; Furaha et al. 2015; Mohabansi et al. 2011; Rohilla et al. 2012). The elevated metal concentrations may be due to high content of metal ions present in the dye and mordants (HRB 38, Nickle-phthalocyanine complex, HRV5 copper containing azo dye, zinc yellow pigment and chrome yellow), and discharge of unbounded metal ions into the waste water and thus direct and continuous exposure alters the physicochemical properties and accumulation of metal ions in the soil (Jayashree et al. 2011). Thus, waste water being used for crops cultivation results in built up toxic substances in the soils (Joshi and Santani 2012; Joshi et al. 2011; Mahawar and Akhtar 2015) and affects the fertility. Reduced agricultural production due to accumulation of heavy metals is concern of regional global scale (Muhammad et al. 2015). Long term irrigation with heavy metal contaminated soil, accumulation of heavy metal in the root and shoot system of the plant (Jayashree et al. 2011).

Significant variation in AMF spore density was observed in all the sites (Table 9). Over all 22 different AMF species were isolated from the rhizosphere of Pennisetum typhoides, commonly cultivated near the contaminated sites. Acaulospora elegans, Acaulospora morrowiae, Sclerocystis rubiformis were not present in the contaminated soil (Fig. 2).

Table 9 Biochemical characterization of isolated bacterial stains from effluents
Full size table
Fig. 2
figure 2

AM spore (400X) identified in contaminated site. a Sclerocystis rubiformis; b Acaulospora elegans; c Acaulospora morrowiae; d Glomus albidium; e G. citricolon; f G. claroideum; g G.deserticola; h G. dimorphicum; i G. geosporum; j G. occulatum; k G. melanosporum; l G.etunicatum; m G. mossae; n G. fulvum; o G. radiatum; p G. pulvinatum; q G. microcarpum and r G. macrocarpum

Full size image

Thus, the results conclude plants grown well with heavy metal contaminated soil on long term irrigation reduces the AM spore population and changes its diversity. The symbiotic association formed by the mycorrhiza fungi in the roots of plant responsible for nutrient transfer is affected in the polluted site (Abubacker et al. 2014).

3.2 Scanning Electron Microscopy—Energy Dispersive X-Ray (SEM–EDX) of Pennisetum typhoides Seeds Elemental Analysis

SEM–EDX elemental analysis confirms the presence of Cr and Zn in the seeds of Pennisetum typhoides irrigated near the effluent discharge point and the concentration was found to be 0.22 and 1.30% and the seeds cultivated at 1 km distance from the discharge point showed decreased concentration (0.08 and 0.44%) whereas the control seeds does not show the occurrence of metals (Figs. 3, 4 and 5).

Fig. 3
figure 3

SEM–EDX: Seeds of Pennisetum typhoides irrigated with borewell water (control)

Full size image
Fig. 4
figure 4

SEM–EDX: Seeds of Pennisetum typhoides irrigated with effluent near discharge point

Full size image
Fig. 5
figure 5

SEM–EDX: Seeds of Pennisetum typhoides irrigation field 1 km away from discharge point

Full size image

3.3 Enumeration, Isolation and Identification of Bacteria

Bacterial load was calculated in all the sites (Soil and effluent). The soil sample contained more cfu/mg in site 1 to site 6 (3.70 ± 0.01 × 106 to 2.99 ± 0.02 × 106) than the reference sample (2.40 ± 0.02 × 105). Similarly the effluent sample has more cfu/ml varied from 5.81 ± 0.03 × 103 to 4.21 ± 0.01 × 103 and the reference site showed 3.29 ± 0.01 × 103. The colony of the bacterial isolates from effluent ETEAK 1–13 were round/irregular, undulate margin; circular; small mucoid, entire umbonate; small circular; small circular flat, entire, powdery; large, irregular flat; circular convex, smooth entire; small, pinpoint convex; irregular round, medusa head; circular, pinhead, convex, entire; mucoid, umbonate elevation; circular, pinpoint, entire raised depressed center and circular, flat, undulated margin respectively. The ETEAK 1–13 were yellow; bright yellow non-diffusible pigment; red pigment; No pigment; light yellow green with black centre; smooth waxy whitish to cream mousy smell; tan to buff-color; grey color; golden-brown color; diffusible green pigment, fruity odor; white and cream colour, whereas the shapes were rods, diplo cocci, rods thin, diplorods, diplo rods, rods in chain, short rods, coccirods, diplo coccic, rods, diplo cocci and rods respectively. Based on the morphological and biochemical characteristics the isolates were identified as Lactobacillus sp., Agrobacterium sp., Pseudomonas sp., Acinetobacter sp., Alcaligenes sp., Bacillus sp., Micrococcus sp., Staphylococcus sp., Enterococcus sp., Aerococcus sp. (Adesemoye et al. 2006; Malekzadeh et al. 2010; Das et al. 2010) (Table 9).

The colony morphology of soil bacterial isolates STEAK 1–13 isolated from soil contaminated by textile effluent were formed the colony and seemed as small, round, convex, entire; small, round, convex, entire; small, circular, convex, entire; small, circular elevated entire; small round, biconvex spreading edge; small circular, flat undulate margins; small irregular round, medusa head; small irregular, wrinkled, opaque; pinhead circular, convex, entire; pinhead circular, convex, entire; small, mucoid, umbonate elevation, entire; small, pinpoint convex entire and small, circular, convex, entire respectively. The colour and pigment of them were as follows off-white to cream, shiny; watery white cream no pigment; shiny wet, diffusible green fluorescent pigment; pale yellow white; greyish pigment; translucent, colorless, fruity smell no pigment; Diffusible cream no pigment; Smooth grayish pigment; slightly yellow colour, no pigment; bright yellow, non-diffusible pigment; Whiteno pigment; diffusible green pigment, fruity odor; Grey, no pigment and semi-transparent, white grey, surrounded by narrow zone of green color. The shape of the colony were rods, except for STEAK 5, 10, 12 (Diplococci), STEAK 9, 13 (Cocci). From the morphological and biochemical characteristics (Table 10), the genus semi-transparent, white grey, surrounded by narrow zone of green color were identified as Lactobacillus sp., Agrobacterium sp., Pseudomonas sp., Acinetobacter sp., Alcaligenes sp., Bacillus subtilis, Bacillus sp., Micrococcus sp., Staphylococcus sp., Pseudomonas sp., Enterococcus sp. and Aerococcus sp. respectively.

Table 10 Biochemical characterization of isolated bacterial stains from soil contaminated with textile effluent
Full size table

Long term exposure to heavy metals microbial community adapts to the polluted environment. In the present investigation, bacterial isolates Pseudomonas putida STEAK 03, Bacillus cereus ETEAK 06 exhibited their survival and tolerance towards heavy metal polluted environment. Results imply that heavy metals promote the selection of resistant species and decrease the other microbial diversity (Ezzouhri et al. 2009; Hemamalini and Sneha 2014; Singh et al. 2013).

The soil isolates STEAK 03 (29%) and effluent isolate ETEAK 06 (21%) has the highest frequency of occurrence and they belong to Pseudomonas and Bacillus genus. The evolutionary history of Pseudomoas putida STEAK 03 and Bacillus cereus ETEAK 06 was inferred using the Neighbor-Joining method. The optimal tree is drawn to scale with branch lengths (next to the branches) in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The 16s rRNA sequence (Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06) determined in this study was deposited in NCBI Genbank under accession number KP731884 and KP731883 (Figs. 6 and 7).

Fig. 6
figure 6

MRL of Becillus cereus ETEAK 06 against zinc

Full size image
Fig. 7
figure 7

MRL of Pseudomonas putida STEAK 03 against chromium

Full size image

3.4 Maximum Resistance Levels (MRL) of Bacterial Isolates Against Cr and Zn

Genotypically characterized Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 were assessed for their maximum tolerance level towards chromium and zinc. Pseudomonas putida STEAK 03 exhibited a greater tolerance level of 2,400 mg L−1 of Cr (VI) (Figs. 6 and 7). Bacillus cereus ETEAK 06 showed moderate growth in chromium concentration as high as 2100 mg L−1 with good growth at 1900 mg L−1. For Zn, both the strains showed the highest degree of tolerance, 3200 and 3100 mg L−1.

The time-course data for heavy metal removal and cellular growth were observed for each isolate under its optimal pH. The bacterial isolates removed Cr and Zn at pH 7.5. In the present study, the accumulation of bacterial isolates peaked at 2000 and 3000 mg L−1 of Cr and Zn and no growth at 3000 mg L−1 of Cr and lowered at 3000 mg L−1 of Zn. Thus, the viable cells used in shake flasks for removal of metal ions from aqueous solution offered several advantages including self replenishment, continuous metabolic uptake of metals after physical adsorption (Qazilbash 2004; Leung et al. 2000; Tam et al. 2001).

3.5 Bioaccumulation Potential of Bacterial Isolates

3.5.1 Optimization of the Accumulation Process in Bacteria

A series of experiments was designed to determine the tolerance/resistance levels of the Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 and indeed these strains remove Cr and Zn ions from the minimal salt media. Both the strains were cultured on minimal salt media with varying pH and varying metal concentration and observed for 2 days at the interval of 6 h (Figs. 8 and 9) represents the optimal pH and metal concentration.

Fig. 8
figure 8

Optimization of resistance level of P. putida STEAK 03 against chromium and zinc

Full size image
Fig. 9
figure 9

Optimization of resistance level of B. cereus ETEAK 06 against chromium and zinc

Full size image

The maximum uptake, of Cr and Zn by Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 was observed at pH 7.5 and complete accumulation was absorbed at 1000 mg L−1 with the maximum biomass ranges between (0.36–0.42 g) Cr and (0.49–0.51 g) Zn by Pseudomonas puitda STEAK 03 and Bacillus cereus ETEAK 06 respectively.

To build a consortium both bacterial isolates should be compatible, Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 was analyzed for their compatibility in the nutrient agar medium and the isolates were found to be compatible.

3.6 Bioremoval of Cr (VI) and Zn (II) Ions from Waste Water Through Accumulation Process

Immobilization: Improvement in the removal of heavy metal using live cells depends on contact between the effluent and the isolates. Thus, immobilized growth was preferred to increase the contact time. Matrix with better holding capacity like Luffa aegyptiaca (bath sponge) was chosen and found to be most efficient. Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 and consortium of bacterial isolates were immobilized on Luffa aegyptiaca separately (Fig. 10a, b and c). Obtained results highlighted the potential use of immobilization with Luffa aegyptiaca for the removal of heavy metals from textile effluents.

Bioaccumulation of Cr (VI) and Zn (II) from textile dye effluent waste water: Over the stipulated period of incubation time, the results of the accumulation studies with immobilized consortium under optimized conditions showed noticeable changes in reduction of heavy metals and cellular growth than the individual bacterial isolates (Fig. 10d). 29.7% of Cr and 44.5% of Zn was adsorbed with Bacillus cereus ETEAK 06 and Pseudomonas putida STEAK 03 removed 32.2% of Cr and 48.5% of Zn, whereas Bacterial consortium removed 38.5 and 51.2% of Cr and Zn (Table 11). The results prove the accumulation by adsorption over the cell wall of microorganisms. However, it is to be noted that, more interestingly, the unfiltered effluent (raw effluent) which contained a mixture of microorganisms worked more effectively and removed (37.23% of Zn and 23.6% of Cr). This translated to the fact, bioremediation occurs naturally in the polluted environment, results also indicate consortium of microorganisms were doing equally good on the removal of heavy metal from the contaminated sites.

Fig. 10
figure 10

Bioremoval of Cr (VI) and Zn (II) through bioaccumulation

Full size image
Table 11 Physiochemical parameters of the bacterial consortium treated effluent
Full size table

3.7 Toxicity Assessment of Treated Waste Water—Bioaccumulation Process

The Physicochemical parameters like pH, EC, total suspended solids, total solids, total dissolved solids, chlorides, BOD, COD, metal concentration of the treated effluents was analyzed. The results reveal all the physiochemical parameters are within the permissible limit of central pollution control board. Observed average concentration (56.7 and 79% of Cr and Zn ions) was removed from the effluent sample.

Seed germination test: Phytotoxic studies on Pennisetum typhoides and Vigna radiata was carried out with consortium treated effluent and untreated effluent from industry. In seed germination study, there was no inhibition of germination by the bacterial consortium treated effluent and with the seeds soaked in bore-well water devoid of effluent where as 100% inhibition was observed with untreated effluent on 7 days of incubation and the germination was observed after 14 days of incubation and the metal concentration in the crop was also less and within the permissible limits for irrigation (Fig. 11).

Fig. 11
figure 11

Seed germination test of treated water on Vigna radiate

Full size image

The reduction in germination percentage with untreated textile effluent might have been due to presence of high concentration of metals and other toxic organic compounds that cause a range of cellular toxicities (Kadar and Kastori 2003) and the presence of high amounts of salts and organic compound in untreated textile effluent reduces the availability of water thereby resulting in reduced germination (Ashraf 2004).

4 Conclusion

Thus, Pseudomonas putida STEAK 03 and Bacillus cereus ETEAK 06 strains sufficiently supported the process of bioremediation. This technology may indeed be labeled as the panacea for the removal of toxic substances from the environment. Bioremediation is without doubt an innovative technique that needs to be adapted to help cleanse the environment of such toxic pollutants such as Cr and Zn, save the biodiversity of AM Spores, conserve them. Based on the above results, it is concluded the biological treatment of textile dye effluent with Luffa aegyptiaca immobilized bacterial isolates for the recovery of heavy metals are proven to be the best and the effluent treated is safe for irrigation.