Abstract
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) is an arbovirus that causes severe disease in humans and livestock in sub-Saharan African countries. The virus carries a tripartite, single-stranded, and negative–sense RNA genome, designated as L, M, and S RNAs. RVFV spread can be prevented by the effective vaccination of animals and humans. Although the MP-12 strain of RVFV is a live attenuated vaccine candidate, MP-12 showed neuroinvasiveness and neurovirulence in young mice and immunodeficiency mice. Hence, there is a concern for the use of MP-12 to certain individuals, especially those that are immunocompromised. To improve MP-12 safety, we have generated a single-cycle, replicable MP-12 (scMP-12), which carries L RNA, S RNA encoding green fluorescent protein in place of a viral nonstructural protein NSs, and an M RNA encoding a mutant envelope protein lacking an endoplasmic reticulum retrieval signal and defective for membrane fusion function. The scMP-12 undergoes efficient amplification in the Vero-G cell line, which is a Vero cell line stably expressing viral envelope proteins, while it undergoes single-cycle replication in naïve cells and completely lacks neurovirulence in suckling mice after intracranial inoculation. A single-dose vaccination of mice with scMP-12 confers protective immunity. Thus, scMP-12 represents a new, promising RVF vaccine candidate. Here we describe protocols for scMP-12 generation by using a reverse genetics system, establishment of Vero-G cells, and titration of scMP-12 in Vero-G cells.
Access provided by CONRICYT – Journals CONACYT. Download protocol PDF
Similar content being viewed by others
Key words
- Rift Valley fever virus
- Vaccine
- Single-cycle replicable virus
- Reverse genetics
- Transfection
- Stable cell establishment
1 Introduction
Rift Valley fever virus (RVFV), a member of the genus Phlebovirus within the family Bunyaviridae, carries a tripartite, single-stranded, and negative-sense RNA genome [1–3]. The L RNA encodes the L protein, a viral RNA-dependent RNA polymerase. The M RNA encodes four proteins, including two accessory proteins, the NSm and 78 kDa proteins, and the two major viral envelope proteins Gn and Gc (Gn/Gc). The S RNA uses an ambisense strategy to express nucleocapsid (N) protein and an accessory protein, NSs. In infected cells, L and N proteins drive viral RNA synthesis in the cytoplasm, while viral assembly and budding take place at the Golgi apparatus where Gn/Gc accumulates.
The virus is transmitted by mosquitoes and maintained by transovarial transmission in local mosquitoes in sub-Saharan Africa. The transmission of the virus among domestic ruminants has resulted in a high mortality rate and spontaneous abortions in virtually all pregnant animals [1]. Human infection occurs via RVFV-infected mosquito bites or direct transmission of the virus from infected animal tissues or blood. Human disease symptoms include febrile illness, retinitis, encephalitis, and, in about 1 % of cases, hemorrhagic fever [4–6]. Since RVFV is able to infect various species of mosquitoes [7], it has the potential to spread to other areas of the world by movement of infected vectors. Indeed, RVFV has already spread outside of the African continent, e.g., to the Arabian Peninsula. There is an increasing consensus that the spread of Rift Valley fever into North America and Europe is no longer a question of if, but when. RVFV has also been considered a potentially exploitable agent for bioterrorism [8].
RVFV spread can be prevented by the effective vaccination of animals and humans [9]. RVFV is considered to be serologically monotypic [10–12]. Also, humoral immunity , particularly neutralizing antibodies that recognize Gn/Gc, is important for protection [13–21]. Therefore, RVFV vaccines that elicit strong humoral immune response s will be able to prevent infection by any strain of RVFV. Although a good human RVFV vaccine is urgently needed, there is no approved vaccine that can be adapted to massive vaccination programs. An attenuated RVFV, MP-12, was developed by serial passage of the wild-type (wt) RVFV ZH548 strain in the presence of mutagen [2]. The MP-12 is a promising live vaccine candidate for both human and veterinary use because the virus is markedly attenuated in mice, nonhuman primate s, and ruminants and retains its high immunogenicity [3, 22–27]. However, intraperitoneal (i.p.) inoculation of young mice with MP-12 can result in efficient virus replication in the central nervous system (CNS) (J. Morrill et al, unpublished data). Furthermore, i.p. inoculation of SCID mice with MP-12 results in the development of neurological signs and death of all mice [24]. These data demonstrated that MP-12 can invade and undergoes efficient replication in the CNS of young animals or immunocompromised animals, and implied that the virus potentially replicates in the CNS of humans with immature or impaired immune system. Thus, it is important to develop highly immunogenic RVFV vaccines with reduced or no neurovirulence for mass vaccination programs.
To develop a safe and immunogenic RVF vaccine , we have generated a novel, single-cycle replicable MP-12 (scMP-12), which does not cause systemic infection in immunized hosts [28]. Figure 1a shows our design of the scMP-12 system. scMP-12 carries L RNA; M RNA mutant encoding wt NSm protein, wt 78-kDa protein, wt Gn protein, and mutant Gc protein lacking the C-terminal 5-amino-acid-long endoplasmic reticulum retrieval signal and having two amino acid substitution within a putative fusion peptide (Gn/GcΔ5); and S RNA carrying green fluorescent protein (GFP) in place of NSs protein (S-GFP RNA). Due to amino acid substitutions in the putative fusion peptide, Gc protein of scMP-12 is fusion defective. We rescued scMP-12 by using a modified MP-12 reverse genetics system [29], in which BSR-T7/5 cells stably expressing T7 polymerase [30] are co-transfected with three RNA-expression plasmids expressing the L RNA, the mutant M RNA encoding the mutant Gc protein, and S-GFP RNA, as well as three protein expression plasmids encoding the L, N, and Gn/Gc proteins. There is a possibility that the M RNA synthesized from the RNA expression plasmid acquires a wt Gc sequence from the M RNA synthesized from the Gn/Gc protein expression plasmid by homologous RNA recombination, generating infectious MP-12. To reduce a chance of homologous recombination between these two RNA transcripts, the Gn/Gc protein expression plasmid encodes a bovine codon-optimized Gn/Gc sequence. The scMP-12 that is produced from the plasmid-transfected cells is infectious due to the presence of wt Gn/Gc and undergoes amplification in Vero-G cells stably expressing Gn/Gc. In scMP-12-infected naïve cells, intracellular accumulation of all of the viral structural proteins and the production of noninfectious viruslike particles (VLPs) occur. Accordingly, in immunized hosts, scMP-12 undergoes single-cycle replication and produces noninfectious VLPs from infected cells. scMP-12 particles in the inoculum, viral proteins accumulated in scMP-12-infected cells, and released noninfectious VLPs all serve as immunogens to elicit immune response s to RVFV proteins. Due to its characteristic single-cycle replication, the scMP-12 did not cause any sign of neurovirulence after intracranial inoculation into suckling mice. scMP-12-immunized mice elicited neutralizing antibodies and efficiently protected the mice from wild-type RVFV challenge by inhibiting wild-type RVFV replication in various organs and viremia [28].
This chapter describes methods for scMP-12 generation. A flowchart presents an outline of the scMP-12 generation procedure (Fig. 2). We first describe methods for construction of the scMP-12 M RNA expression plasmid and bovine codon-optimized Gn/Gc expression plasmid. Then, procedures are given for scMP-12 generation by using a reverse genetics system. Subsequently, we describe procedures for establishment of Vero-G cells by using a plasmid encoding Gn/Gc proteins and a drug selection maker. Finally, we provide methods for propagation and titration of scMP-12 in Vero-G cells.
2 Materials
2.1 Plasmid Construction
-
1.
Proofreading PCR enzyme: Pfu ultra DNA polymerase (Agilent), or equivalent.
-
2.
10 mM dNTP mix.
-
3.
Agarose, loading dye, and nucleic acid stain suitable for gel electrophoresis.
-
4.
Agarose gel electrophoresis system: 1.0 % agarose gel, use ultrapure agarose (electrophoresis grade) with 1× TBE. Prepare 1 L of 10× TBE stock solution in ultrapure water with 108 g of Tris base, 55 g of boric acid, 40 mL of 0.5 M EDTA (pH 8.0).
-
5.
QIAquick Gel Extraction Kit (Qiagen).
-
6.
QIAquick PCR Purification Kit (Qiagen).
-
7.
2× Rapid Ligation Buffer (Promega) and T4 DNA ligase (Promega) or equivalent.
-
8.
Chemical-competent cells TOP10 (Invitrogen).
-
9.
SOC medium: Add 20 g tryptone, 5 g yeast extract, 2 mL of 5 M NaCl, 2.5 mL of 1 M KCl, 10 mL of 1 M MgCl2, 10 mL of 1 M MgSO4, 20 mL of 1 M glucose in 1000 mL of H2O. Sterilize by autoclaving and store at room temperature.
-
10.
LB agar plate with ampicillin: Add 5 g tryptone, 2.5 g yeast extract, 5 g NaCl, and 15 g of Bacto Agar (BD Biosciences), in 1000 mL of H2O. Sterilize by autoclaving. After cooling down to 55 °C in a water bath, add 1 mL of 50 mg/mL ampicillin, and mix well. Pour 15 mL of LB/agar media into 10 cm Petri dish. After solidifying the LB/agar, store at 4 °C.
-
11.
14 mL Round-bottomed, snap-cap tubes, sterile.
-
12.
LB medium with ampicillin: Add 5 g tryptone, 2.5 g yeast extract, and 5 g NaCl in 1000 mL of H2O. Sterilize by autoclaving. After cooling down to room temperature, add 1 mL of 50 mg/mL ampicillin. Store at 4 °C.
-
13.
Qiaprep Miniprep Kit (Qiagen) or equivalent.
-
14.
QIAGEN Plasmid Midi Kit (Qiagen) or equivalent.
2.1.1 Construction of pProT7-M-scMP12 Plasmid
-
1.
Plasmid: pProT7-M [29].
-
2.
Primer pair: deltaGc-tail-F, AAACGTCTCTTAGATCAGTGCGTGTAAAAGC, and deltaGc-tail-R, AAACGTCTCTTCTAGGCAGCAAGCCAC.
-
3.
Primer pair: M F826N_N827A-F,GAATGTGGAGGATGGGGGTGTGGGTGTAACGCTGTGAACCCATCTT, and M F826N_N827A-R,AAGATGGGTTCACAGCGTTACACCCACACCCCCATCCTCCACATTG.
-
4.
T7 terminator primer: ATGCTAGTTATTGCTCAGCGG.
-
5.
Restriction enzymes: BsmBI, DpnI (NEB).
2.1.2 Construction of pCAGGS-Gn/Gc-Bovine
-
1.
Synthetic gene, bovine codon-optimized M RNA expression plasmid, pProT7-M-bovine.
-
2.
BsmEco-MboGnGc-F, AAACGTCTCTAATTCACCATGGCCGGCATCGCCATG, BsmNot-MboGnGc-R, AAAACGTCTCTGGCCGCTCTAGCTAGCTTTTTTTGTAGCAGCC
-
3.
Restriction enzymes: EcoRI, NotI, BsmBI (NEB).
2.1.3 Construction of pCAGGS-bla-G
-
1.
Plasmids: pCX4-bsr, and pCAGGS-G.
-
2.
Restriction enzymes: NotI, StuI, EcoRV (NEB).
2.2 Establishment of Vero-G Cells
-
1.
Restriction enzyme: FspI.
-
2.
QIAquick PCR Purification Kit (Qiagen).
-
3.
Vero E6 cells.
-
4.
Growth media: DMEM (HyClone) supplemented with 10 % FBS, 1× penicillin/streptomycin (100 unit/mL of penicillin, 100 μg/mL of streptomycin).
-
5.
6-Well plates.
-
6.
96-Well plates.
-
7.
Fugene HD transfection reagent (Promega).
-
8.
pCAGGS-Bla-G (Subheading 2.1.3).
-
9.
Opti-MEM (Gibco).
-
10.
Blasticidin S hydrochloride (Gibco).
-
11.
10 % Formalin in PBS.
-
12.
0.1 % TritonX-100 in PBS.
-
13.
2 % BSA in PBS.
-
14.
Anti-Gn monoclonal antibody (R1-4D4) [31].
-
15.
Alexa-594-conjugated anti-mouse IgG (Invitrogen).
2.3 scMP-12 Generation by Reverse Genetics
-
1.
BSR T7/5 cells.
-
2.
Glasgow’s minimal essential medium supplemented with 10 % FBS, 10 % tryptose phosphate broth, 1 mg/mL G418, 1× penicillin/streptomycin (100 unit/mL of penicillin, 100 μg/mL of streptomycin).
-
3.
6-Well plate.
-
4.
Plasmids: pProT7-L [29], pProT7-S-GFP [28], pProT7-M-scMP12 (Subheading 2.1.1), pT7IRES-L [29], pT7IRES-N [29], pCAGGS-Gn/Gc-bovine (Subheading 2.1.2).
-
5.
TransIT-LT1 (Mirus).
-
6.
Opti-MEM (Invitrogen).
2.4 Propagation of scMP-12 in Vero-G Cells
-
1.
Vero-G cells (Subheading 2.2).
-
2.
Growth media: DMEM 10 % FCS, 1× penicillin/streptomycin (100 unit/mL of penicillin, 100 μg/mL of streptomycin).
-
3.
Supernatant from plasmid-transfected BSR T7/5 cells (Subheading 2.3).
-
4.
6-Well culture plate.
2.5 Plaque Assay for Titration of scMP-12 in Vero-G Cells
-
1.
Vero-G cells (Subheading 2.2).
-
2.
6-Well culture plate.
-
3.
scMP-12 virus stock solution (Subheading 2.4).
-
4.
96-Well deep-well plate.
-
5.
Growth media: DMEM 10 % FCS, 1X penicillin/streptomycin (100 unit/mL of penicillin, 100 μg/mL of streptomycin).
-
6.
MEM containing 0.6 % Tragacanth gum (MP Biomedicals), 5 % FBS, and 5 % tryptose phosphate broth.
-
7.
4 % Paraformaldehyde in PBS.
-
8.
0.1 % TritonX-100 in PBS.
-
9.
Anti-N rabbit polyclonal antibody, which was generated by injecting a purified, bacterially expressed fusion protein consisting of glutathione-S-transferase and full-length MP-12 N protein into rabbits.
-
10.
HRP-conjugated anti-rabbit IgG antibody (Santa Cruz).
-
11.
NovaRED peroxidase substrate (Vector Laboratories).
3 Methods
3.1 Plasmid Constructions
3.1.1 Construction of pProT7-M-scMP12 Plasmid
pProT7-M-scMP12 plasmid is produced from M RNA expression plasmid pProT7-M by deleting five amino acid residues of C-term of Gc protein and introducing F826N/N827A mutation in putative fusion peptide of Gc protein. To generate pProT7-M-scMP12, two steps are required: (1) delete five amino acid residues of C-terminal of Gc first and (2) introduce F826N/N827A mutations.
-
1.
Prepare reaction mixture for PCR amplification,
-
40 μL Nuclease-free H2O.
-
5 μL 10× reaction buffer.
-
1 μL 10 mM dNTPs.
-
1 μL Forward primer: deltaGc-tail-F (10 pmol/μL).
-
1 μL Reverse primer: deltaGc-tail-R (10 pmol/μL).
-
1 μL pProT7-M template at 10 ng/μL concentration.
-
1 μL Pfu Ultra DNA Polymerase.
-
-
2.
Preheat the thermal cycler to 95 °C, then heat the samples at 95 °C for 1 min, and run the thermal cycling program for 30 cycles with the following setting: 30 s at 95 °C, 30 s at 58 °C, and 6 min at 72 °C. Add one cycle at 72 °C for a final extension of 10 min.
-
3.
Run 5 μL of the PCR product by 1 % agarose gel electrophoresis in 1× TBE buffer. Use a 1 kbp DNA ladder to control for the correct product size. Cut out the band, and the extracted PCR fragment by using QIAquick Gel Extraction Kit, eluting fragments with 30 μL of H2O (see Note 1 ).
-
4.
Digest the purified DNA fragment with 1 μL of BsmBI (see Note 2 ) and 1 μL of DpnI (see Note 3 ) enzymes in reaction volume 25 μL for 1 h at 37 °C and for 1 h at 55 °C. Purify the digested DNA fragments by using a QIAquick PCR purification kit, eluting fragments with 30 μL of H2O.
-
5.
Perform ligation using T4 DNA ligation; add 1 μL of the digested fragments and 5 μL of 2× ligation buffer, 1 μL of T4 DNA ligase, and 3 μL of H2O into a 1.5 mL tube and incubate for 5 min at room temperature.
-
6.
Transform 50 μL of TOP10 competent cells with the 3 μL of ligated product.
-
7.
Add 100 μL of SOC media to the transformed cells.
-
8.
Incubate with 180–200 rpm shaking at 37 °C for 1 h.
-
9.
Plate onto LB agar plates supplemented with ampicillin for selection and incubate the plates at 37 °C for 16–20 h.
-
10.
Select well-isolated colonies from the transformation plates, inoculate the colonies in 1 mL LB media for bacterial culture with ampicillin, and incubate with 180–200 rpm shaking for 10–16 h at 37 °C.
-
11.
Make plasmid minipreps from the cultures by using the QIAprep Miniprep Kit, eluting fragments with 50 μL of H2O.
-
12.
Determine the DNA concentration in each preparation by measuring the absorbance at 260 nm by using a spectrophotometer.
-
13.
Screen the clones by sequencing using T7 terminator primer.
-
14.
Sequence entire M RNA with clones which possess Gc cytoplasmic tail deletion (see Note 4 ). Designate one clone possessing correct sequence as pProT7-Gn/GcΔ5.
-
15.
Perform site-directed mutagenesis by using Quickchange II site-directed mutagenesis kit following the manufacturer’s protocol with M F826N_N827A-F and M F826N_N827A-R primer.
-
16.
Add 1 μL of DpnI into PCR reaction tube in step 15 (see Note 3 ).
-
17.
Transform 50 μL of TOP10 competent cells with the 3 μL of ligated product.
-
18.
Add 100 μL of SOC media to the transformed cells.
-
19.
Incubate with 180–200 rpm shaking at 37 °C for 1 h.
-
20.
Plate onto LB agar plates supplemented with ampicillin for selection and incubate the plates at 37 °C for 16–20 h.
-
21.
Select well-isolated colonies from the transformation plates, inoculate the colonies in 1 mL LB broth for bacterial culture with ampicillin, and incubate with 180–200 rpm shaking for 10–16 h at 37 °C.
-
22.
Make plasmid minipreps from the cultures, and using the QIAprep Miniprep Kit, elute fragments with 50 μL of H2O.
-
23.
Determine the DNA concentration in each preparation by measuring the absorbance at 260 nm by using a spectrophotometer.
-
24.
Sequence entire M RNA and choose one clone possessing correct sequence (see Note 4 ).
-
25.
Propagate the pProT7-M-scMP12 by midiprep.
3.1.2 Construction of pCAGGS-Gn/Gc-Bovine
-
1.
Synthesize bovine codon-optimized MP-12 Gn/Gc gene (Gn/Gc-bovine) by commercial company.
-
2.
PCR amplify the Gn/Gc-bovine gene to add linker sequence.
Prepare PCR reaction mix on ice:
-
40 μL Nuclease-free H2O.
-
5 μL 10× Reaction buffer.
-
1 μL 10 mM dNTPs.
-
1 μL Forward primer: BsmEco-MboGnGc-F (10pmol/μL).
-
1 μL Reverse primer: BsmNot-MboGnGc-R (10pmol/μL).
-
1 μL Template at 10 ng/μL concentration.
-
1 μL Pfu Ultra DNA polymerase.
-
-
3.
Preheat the thermal cycler to 95 °C, then heat the samples at 95 °C for 1 min, and then run the thermal cycling program for 30 cycles with the following setting: 30 s at 95 °C, 30 s at 58 °C, and 6 min at 72 °C. Add one cycle at 72 °C for a final extension of 10 min.
-
4.
Analyze 5 μL of PCR product on a 1 % agarose gel with ethidium bromide in 1× TBE-buffer. Use a 1 kbp DNA ladder to control for the correct product size.
-
5.
Purify the PCR product using QIAquick PCR purification kit, eluting fragments with 30 μL of H2O.
-
6.
Digest the purified DNA fragment with 1 μL of BsmBI enzyme in 40 μL reaction volume for 1 h at 55 °C (see Note 5 ). Simultaneously, digest 1 μg of pCAGGS-G with 1 μL of EcoRI and 1 μL of NotI enzymes in 25 μL reaction volume for 1 h at 37 °C.
-
7.
Run the digested PCR product and plasmid by 1 % agarose gel electrophoresis with ethidium bromide in 1× TBE buffer, cut out the band, and extract DNA fragment by using the QIAquick Gel Extraction Kit, eluting fragments with 30 μL of H2O, respectively.
-
8.
Perform ligation reaction using T4 DNA ligation; add 1 μL of the digested PCR fragment and 1 μL of the digested vector and 5 μL of 2× ligation buffer, 1 μL of T4 DNA ligase, and 2 μL of H2O into 1.5 mL tube and incubate for 5 min at room temperature.
-
9.
Transform 50 μL of TOP10-competent cells with the 3 μL of ligated product.
-
10.
Add 100 μL of SOC media to the transformed cells.
-
11.
Plate onto LB agar plates supplemented with ampicillin for selection and incubate the plates at 37 °C for 16–20 h.
-
12.
Select well-isolated colonies from the transformation plates, inoculate the colonies in 1 mL LB media for bacterial culture with ampicillin, and incubate with 200 rpm shaking for 10–16 h at 37 °C.
-
13.
Make plasmid minipreps from the cultures, using the QIAprep Miniprep Kit, eluting fragments with 50 μL of H2O.
-
14.
Determine the DNA concentration in each preparation by measuring the absorbance at 260 nm by using a spectrophotometer.
-
15.
Sequence the either open reading frame of Gn/Gc (see Note 4 ).
-
16.
Propagate pCAGGS-Gn/Gc-bovine with midiprep.
3.1.3 Construction of pCAGGS-bla-G
-
1.
Digest pCX4-bsr with 1 μL of EcoRV and 1 μL of NotI enzymes in 25 μL reaction volume for 1 h at 37 °C. Simultaneously, digest 1 μg of pCAGGS-G with 1 μL of NotI and 1 μL of StuI enzymes in 25 μL reaction volume for 1 h at 37 °C.
-
2.
Run the digested pCX4-bsr and pCAGGS-G by 1 % agarose gel electrophoresis, respectively. Extract pCX4-bsr NotI-EcoRV fragment (1254 bp) and pCAGGS-G NotI-StuI fragment (7471 bp) using the QIAquick Gel Extraction kit, eluting fragments with 30 μL of H2O.
-
3.
Perform ligation reaction using T4 DNA ligation; add 1 μL of the pCX4-bsr NotI-EcoRV fragment and 1 μL of the digested vector and 5 μL of 2× ligation buffer, 1 μL of T4 DNA ligase, and 2 μL of H2O into 1.5 mL tube and incubate for 5 min at RT.
-
4.
Transform 50 μL of TOP10-competent cells with the 3 μL of ligated product.
-
5.
Add 100 μL of SOC media to the transformed cells.
-
6.
Plate onto LB agar plates supplemented with ampicillin for selection and incubate the plates at 37 °C for 16–20 h.
-
7.
Select well-isolated colonies from the transformation plates, inoculate the colonies in 1 mL LB broth for bacterial culture with ampicillin, and incubate with 200 rpm shaking for 10–16 h at 37 °C.
-
8.
Make plasmid minipreps from the cultures, by using the QIAprep Miniprep Kit, eluting fragments with 50 μL of H2O.
-
9.
Identify clones with correct insert size by restriction digestion.
-
10.
Determine the DNA concentration in each preparation by measuring the absorbance at 260 nm using a spectrophotometer.
-
11.
Sequence the entire insertion region.
-
12.
Propagate pCAGGS-bla-G (Fig. 3) with plasmid midiprep kit.
3.2 Generation of Vero-G Cells
To obtain a Vero cell line stably expressing Gn and Gc proteins, Vero cells were transfected with a plasmid encoding Gn/Gc and a drug selection gene. We screened individual cell clones for Gn expression levels by using indirect immunofluorescence with an anti-Gn monoclonal antibody (R1-4D4), isolated a cell clone expressing highest levels of Gn, and designated it as Vero-G cells.
-
1.
To linearize pCAGGS-bla-G, digest 10 μg of pCAGGS-bla-G with 2 μL of FspI enzyme in 100 μL reaction volume for 1 h at 37 °C (see Note 6 ).
-
2.
Purify the digested pCAGGS-bla-G product by using QIAquick PCR purification kit, eluting fragments with 30 μL of H2O.
-
3.
Determine the DNA concentration in each preparation by measuring the absorbance at 260 nm using a spectrophotometer.
-
4.
Seed 3 × 105 cells/well of Vero E6 cells at least two wells of a 6-well plate in DMEM medium supplemented with 10 % FBS and incubate the plates in a 37 °C cell incubator overnight. The cell density should be approximately 80 % confluency at the time of transfection.
-
5.
Add 200 μL OPTI-MEM (Invitrogen) and 3 μg of pCAGGS-bla-G to a 1.5 mL tube. Add 9 μL of FuGENE HD (Promega) and mix by vortexing. Incubate for 15 min at room temperature. The entire transfection mixture was added to a well dropwise. Add 200 μL of OPTI-MEM to at least one well of the plate as mock transfection.
-
6.
Incubate the plate overnight at 37 °C, 5 % CO2.
-
7.
Aspirate the media from the cells and add DMEM medium containing 10 % FCS and 20 μg/mL of blasticidin. Incubate the plate for 5–7 days at 37 °C, in a 5 % CO2 atmosphere until all mock-transfected cells die (see Note 7 ).
-
8.
Clone the cells by limiting dilution. Wash the cells once with PBS, add 0.2 mL of EDTA-trypsin, and incubate for 5 min at 37 °C. Confirm that all cells are detached. Add 2 mL of DMEM medium containing 10 % FCS and 20 μg/mL of blasticidin and suspend the cells. Adjust cell concentrations to 0.5–1 cells/well in medium containing 20 μg/mL of blasticidin, and dispense a 100 μL cell suspension to each well of 96-well culture plates.
-
9.
Incubate these plates at 37 °C in a 5 % CO2 atmosphere until cells are visible to the naked eye (see Note 8 ). Screen wells forming single colony.
-
10.
Trypsinize the cells with 50 μL of trypsin-EDTA and resuspend in 200 μL of media. Divide into two and seed into two 48-well plate. Incubate overnight at 37 °C in a 5 % CO2 atmosphere.
-
11.
Wash the cells with 200 μL of PBS once.
-
12.
Fix with 100 μL of 10 % formalin for 10 min at room temperature.
-
13.
Remove formalin and wash the cells three times with 200 μL of PBS.
-
14.
Add 100 μL of 0.1 % TritonX-100 in PBS and incubate for 10 min at room temperature for permeabilization.
-
15.
Remove TritonX-100 in PBS and wash the cells three times with 200 μL of PBS.
-
16.
Add 200 μL of blocking reagent (2 % BSA in PBS) and incubate for 60 min at room temperature.
-
17.
Remove blocking reagent.
-
18.
Add 100 μL of anti-Gn monoclonal antibody (R1-4D4) to the wells in PBS and incubate for 30 min at room temperature (see Note 9 ).
-
19.
Remove antibody containing PBS and wash three times with 200 μL of PBS.
-
20.
Add 100 μL of Alexa594-conjugated anti-mouse IgG to the wells in PBS and incubate for 30 min at room temperature.
-
21.
Remove antibody containing PBS and wash three times with 200 μL of PBS.
-
22.
Observe under fluorescent microscopy and select a cell clone expressing highest levels of Gn and designate as Vero-G cells.
-
23.
Propagate the selected clone cells in TC75 flask and make cell stocks.
3.3 scMP-12 Generation by Reverse Genetics
-
1.
Seed ~5 × 105 BSR T7/5 cells/well of a 6-well plate (see Note 10 ).
-
2.
Incubate cells for 24 h in growth medium. Cells should be 60–80 % confluent at the time of transfection.
-
3.
Premix DNAs for transfection:
-
(a)
Use 1.1 μg each of the pProT7-L, pProT7-M-scMP12, and pProT7-S-GFP RNA expression plasmids and pT7IRES-N protein expression plasmids.
-
(b)
Use 0.55 μg of pCAGGS-Gn/Gc-bovine and pT7IRES-L protein expression plasmids.
-
(c)
This gives a total of 5.5 μg of DNA to be transfected.
-
(a)
-
4.
Transfection:
-
(a)
Add 200 μL of OPTI-MEM and premixed DNAs into a 1.5 mL tube.
-
(b)
Add 2 μL transfection reagent (TransIT-LT1, Mirus) per μg of DNA (see Note 11 ).
-
(c)
Incubate transfection mixture for 15 min at room temperature.
-
(a)
-
5.
Aspirate media from wells and add 2 mL of growth medium, and, then, add transfection mixture dropwise to cells.
-
6.
Incubate the plate for 10 days at 37 °C, 5 % CO2. Check GFP-positive cell spreading under fluorescent microscopy every day (see Note 12 ).
-
7.
Collect the virus-containing supernatant.
-
8.
Remove cell debris by centrifugation (10,000 × g, for 5 min, at 4 °C).
-
9.
Aliquot and store at −80 °C.
3.4 Propagation of scMP-12 in Vero-G Cells
-
1.
Seed 5 × 105 Vero-G cells/well of a 6-well plate in growth medium (DMEM 10 % FCS, 1× penicillin/streptomycin).
-
2.
Incubate cells for 24 h at 37 °C and 5 % CO2; cells should be near confluent at the time of infection.
-
3.
Remove media.
-
4.
Add 300 μL of undiluted virus-containing supernatant to Vero-G cells (see Note 13 ).
-
5.
Infect Vero-G cells for 1 h at 37 °C and 5 % CO2.
-
6.
Wash Vero-G cells once with growth medium to remove virus inoculum.
-
7.
Incubate cells with growth medium for 4–5 days at 37 °C and 5 % CO2.
-
8.
Observe cells daily to confirm GFP signal spreading under fluorescence microscopy: GFP signal can be typically observed within 18 h of infection.
-
9.
When ~90 % of Vero-G cells become GFP positive, harvest virus-containing supernatant.
-
10.
Remove cell debris by centrifugation (10,000 × g, for 5 min, at 4 °C).
-
11.
Transfer virus-containing supernatant to fresh tube.
-
12.
Aliquots the virus-containing supernatant and store at −80 °C. One aliquot should be used for determination of the virus titer described below.
3.5 Plaque Assay
-
1.
Seed 5 × 105 Vero-G cells/well of a 6-well plate in growth medium.
-
2.
Incubate cells for 24 h at 37 °C and 5 % CO2; cells should be near confluent at the time of infection.
-
3.
Prepare a tenfold serial dilution of the virus stock solution (from 10−1 to 10−5 dilution): add 450 μL of media into each well of a 96-well deep-well plate. Add 50 μL of the virus stock solution to be tested into the first well and carefully pipette up and down. Then transfer 50 μL of this first dilution into the second well and continue as described for the first dilution to generate a serial dilution.
-
4.
Remove media from 6-well-plated Vero-G cells.
-
5.
Add 400 μL of virus dilutions prepared in Vero-G cells. Include negative control by providing cells with medium lacking virus inoculum.
-
6.
Incubate the 6-well plates for 1 h at 37 °C and 5 % CO2. Rock the plate gently back and forth every 15 min to keep the cells covered by virus diluent.
-
7.
Aspirate the inoculum.
-
8.
Wash the Vero-G cells once with media.
-
9.
Add 2 mL of MEM containing 0.6 % Tragacanth gum (MP Biomedicals), 5 % FBS, and 5 % tryptose phosphate broth to each well and incubate the plates for 4 days at 37 °C and 5 % CO2.
-
10.
On day 4, remove the Tragacanth gum-containing media from 6-well plates.
-
11.
Wash the cells with 400 μL of PBS once.
-
12.
Fix with 400 μL of 4 % paraformaldehyde for 10 min at room temperature.
-
13.
Remove paraformaldehyde solution and wash the cells three times with 1 mL of PBS.
-
14.
Add 400 μL of 0.1 % TritonX-100 in PBS and incubate for 10 min at room temperature.
-
15.
Remove TritonX-100 in PBS and wash the cells three times with 1 mL of PBS.
-
16.
Add 400 μL of blocking reagent (2 % BSA in PBS) and incubate for 60 min at room temperature.
-
17.
Remove blocking reagent.
-
18.
Add 400 μL of anti-N rabbit polyclonal antibody to the wells in PBS and incubate for 30 min at room temperature (see Note 14 ). Remove antibody containing PBS and wash three times with 1 mL of PBS.
-
19.
Add 400 μL of HRP-conjugated anti-rabbit IgG to the wells in PBS and incubate for 30 min at room temperature. Remove antibody containing PBS and wash three times with 1 mL of PBS.
-
20.
The plaques were visualized with Nova RED peroxidase substrate (see Note 15 ) (Fig. 4).
-
21.
Remove Nova RED peroxidase substrate solution.
-
22.
Count plaques in wells where the plaques can clearly be distinguished and calculate the plaque-forming units (pfu). Count plaques in each well and determine the PFU per milliliter using the following formula: PFU/mL = number of plaques × dilution factor × 2.5.
4 Notes
-
1.
Illumination of short-wavelength UV (254 nm) to DNA causes pyrimidine dimers, resulting in low transformation efficiency. To avoid this, long-wave UV (365 nm) or blue LED is useful.
-
2.
Cleavage site of BsmBI is downstream of the recognition site. Cleavage product does not contain the recognition site, allowing desired plasmid construction introducing insertion, deletion, and mutations (Fig. 5).
-
3.
DpnI digests only methylated plasmid produced in E. coli and does not digest non-methylated DNA, such as PCR products. Therefore, DpnI digestion of PCR products only removes template plasmids.
-
4.
Design sequencing primers for entire MP-12 M, which is available in Genbank (Accession number is DQ380208). Typically, in designing primers a 600–700 nt interval works for the regular sequencer. It depends on the performance of a sequencer.
-
5.
Bovine codon-optimized M sequence contains EcoRI site. BsmBI digests downstream of the recognition site with four-nucleotide overhangs. Forward and reverse primers are designed to possess four-nucleotide overhangs of EcoRI and NotI digestion by BsmBI digestion, respectively.
-
6.
Linearization of plasmid enhances the integration efficiency into cell genomes.
-
7.
When transfected cells become confluent during drug selection, passage the cells once with 1:10 dilution.
-
8.
Typically, 10–18 days are required for forming a visible plaque.
-
9.
If anti-Gn antibody is not available, anti-RVFV polyclonal antibody may work for this screening.
-
10.
If BSR T7/5 cells are not available, BHK cells stably expressing T7 RNA polymerase may work for generation of scMP-12.
-
11.
Selection of transfection reagent is important for this experiment. TranIT-LT1 is one of the most suitable reagents for reverse genetics for RVFV production.
-
12.
The viral titer of scMP-12 will reach its plateau when most of the cells turn to GFP positive.
-
13.
If viral titers are too high, nearly 100 % of Vero-G cells become GFP positive at 1 day postinfection. In this case, a 10–100 times dilution is required to avoid production of defective interfering particles.
-
14.
Anti-RVFV polyclonal antibody does not work in this experiment since anti-RVFV antibodies pick up Gn/Gc signals, causing high background.
-
15.
If the signals are weak, an avidin-biotin complex (ABC) staining method may help to enhance the signals.
References
Bird BH, Nichol ST (2012) Breaking the chain: Rift Valley fever virus control via livestock vaccination. Curr Opin Virol 2:315–323
Caplen H, Peters CJ, Bishop DH (1985) Mutagen-directed attenuation of Rift Valley fever virus as a method for vaccine development. J Gen Virol 66(Pt 10):2271–2277
Morrill JC, Jennings GB, Caplen H, Turell MJ, Johnson AJ, Peters CJ (1987) Pathogenicity and immunogenicity of a mutagen-attenuated Rift Valley fever virus immunogen in pregnant ewes. Am J Vet Res 48:1042–1047
Balkhy HH, Memish ZA (2003) Rift Valley fever: an uninvited zoonosis in the Arabian peninsula. Int J Antimicrob Agents 21:153–157
Peters CJ, Meegan JM (1989) Rift Valley fever virus. CRC Press, Boca Raton, FL
Peters CJ, LeDuc JW (1999) Bunyaviruses, phleboviruses, and related viruses. In: Belshe RB (ed) Textbook of human Virology. Mosby Year Book, St.Louis, pp 571–614
Gargan TP, Clark GG, Dohm DJ, Turell MJ, Bailey CL (1988) Vector potential of selected North American mosquito species for Rift Valley fever virus. Am J Trop Med Hyg 38:440–446
Sidwell RW, Smee DF (2003) Viruses of the Bunya- and Togaviridae families: potential as bioterrorism agents and means of control. Antiviral Res 57:101–111
Ikegami T, Makino S (2009) Rift valley fever vaccines. Vaccine 27(Suppl 4):D69–D72
Besselaar TG, Blackburn NK, Meenehan GM (1991) Antigenic analysis of Rift Valley fever virus isolates: monoclonal antibodies distinguish between wild-type and neurotropic virus strains. Res Virol 142:469–474
Shope RE, Peters CJ, Walker JS (1980) Serological relation between Rift Valley fever virus and viruses of phlebotomus fever serogroup. Lancet 1:886–887
Tesh RB, Peters CJ, Meegan JM (1982) Studies on the antigenic relationship among phleboviruses. Am J Trop Med Hyg 31:149–155
Anderson GW, Smith JF (1987) Immunoelectron microscopy of Rift Valley fever viral morphogenesis in primary rat hepatocytes. Virology 161:91–100
Besselaar TG, Blackburn NK (1991) Topological mapping of antigenic sites on the Rift Valley fever virus envelope glycoproteins using monoclonal antibodies. Arch Virol 121:111–124
Harrington DG, Lupton HW, Crabbs CL, Peters CJ, Reynolds JA, Slone TW Jr (1980) Evaluation of a formalin-inactivated Rift Valley fever vaccine in sheep. Am J Vet Res 41:1559–1564
Niklasson BS, Meadors GF, Peters CJ (1984) Active and passive immunization against Rift Valley fever virus infection in Syrian hamsters. Acta Pathol Microbiol Immunol Scand C 92:197–200
Peters CJ, Reynolds JA, Slone TW, Jones DE, Stephen EL (1986) Prophylaxis of Rift Valley fever with antiviral drugs, immune serum, an interferon inducer, and a macrophage activator. Antiviral Res 6:285–297
Peters CJ, Jones D, Trotter R, Donaldson J, White J, Stephen E, Slone TW Jr (1988) Experimental Rift Valley fever in rhesus macaques. Arch Virol 99:31–44
Pittman PR, Liu CT, Cannon TL, Makuch RS, Mangiafico JA, Gibbs PH, Peters CJ (1999) Immunogenicity of an inactivated Rift Valley fever vaccine in humans: a 12-year experience. Vaccine 18:181–189
Schmaljohn CS, Parker MD, Ennis WH, Dalrymple JM, Collett MS, Suzich JA, Schmaljohn AL (1989) Baculovirus expression of the M genome segment of Rift Valley fever virus and examination of antigenic and immunogenic properties of the expressed proteins. Virology 170:184–192
Spik K, Shurtleff A, McElroy AK, Guttieri MC, Hooper JW, SchmalJohn C (2006) Immunogenicity of combination DNA vaccines for Rift Valley fever virus, tick-borne encephalitis virus, Hantaan virus, and Crimean Congo hemorrhagic fever virus. Vaccine 24:4657–4666
Baskerville A, Hubbard KA, Stephenson JR (1992) Comparison of the pathogenicity for pregnant sheep of Rift Valley fever virus and a live attenuated vaccine. Res Vet Sci 52:307–311
Hubbard KA, Baskerville A, Stephenson JR (1991) Ability of a mutagenized virus variant to protect young lambs from Rift Valley fever. Am J Vet Res 52:50–55
Morrill JC, Carpenter L, Taylor D, Ramsburg HH, Quance J, Peters CJ (1991) Further evaluation of a mutagen-attenuated Rift Valley fever vaccine in sheep. Vaccine 9:35–41
Morrill JC, Mebus CA, Peters CJ (1997) Safety of a mutagen-attenuated Rift Valley fever virus vaccine in fetal and neonatal bovids. Am J Vet Res 58:1110–1114
Morrill JC, Mebus CA, Peters CJ (1997) Safety and efficacy of a mutagen-attenuated Rift Valley fever virus vaccine in cattle. Am J Vet Res 58:1104–1109
Morrill JC, Peters CJ (2003) Pathogenicity and neurovirulence of a mutagen-attenuated Rift Valley fever vaccine in rhesus monkeys. Vaccine 21:2994–3002
Murakami S, Terasaki K, Ramirez SI, Morrill JC, Makino S (2014) Development of a novel, single-cycle replicable rift valley fever vaccine. PLoS Negl Trop Dis 8:e2746
Ikegami T, Won S, Peters CJ, Makino S (2006) Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene. J Virol 80:2933–2940
Buchholz UJ, Finke S, Conzelmann KK (1999) Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J Virol 73:251–259
Keegan K, Collett MS (1986) Use of bacterial expression cloning to define the amino acid sequences of antigenic determinants on the G2 glycoprotein of Rift Valley fever virus. J Virol 58:263–270
Acknowledgements
We thank Robert Tesh, C. J. Peters, and Tetsuro Ikegami for anti-MP-12 antibody, monoclonal antibodies against Gn, and bacterially expressed N protein used for anti-N protein antibody production, respectively. This work was supported by Public Health Service grant AI101772, and in part by the John Sealy Memorial Endowment Fund for Biomedical Research. S. Murakami was supported by the James W. McLaughlin Fellowship fund and by a research fellowship from the Japan Society for the Promotion of Science.
Author information
Authors and Affiliations
Corresponding author
Editor information
Editors and Affiliations
Rights and permissions
Copyright information
© 2016 Springer Science+Business Media New York
About this protocol
Cite this protocol
Murakami, S., Terasaki, K., Makino, S. (2016). Generation of a Single-Cycle Replicable Rift Valley Fever Vaccine. In: Thomas, S. (eds) Vaccine Design. Methods in Molecular Biology, vol 1403. Humana Press, New York, NY. https://doi.org/10.1007/978-1-4939-3387-7_9
Download citation
DOI: https://doi.org/10.1007/978-1-4939-3387-7_9
Published:
Publisher Name: Humana Press, New York, NY
Print ISBN: 978-1-4939-3385-3
Online ISBN: 978-1-4939-3387-7
eBook Packages: Springer Protocols