Chimeric Pestivirus Experimental Vaccines

Abstract

Chimeric pestiviruses have shown great potential as marker vaccine candidates against pestiviral infections. Exemplarily, we describe here the construction and testing of the most promising classical swine fever vaccine candidate “CP7_E2alf” in detail. The description is focused on classical cloning technologies in combination with reverse genetics.

1 Introduction

Classical swine fever (CSF) is among the most important viral disease of domestic and feral pigs and has a serious impact on animal health and pig industry. In most countries with industrialized pig production, prophylactic vaccination against CSF is banned, and all efforts are directed towards eradication of the disease, e.g., by culling of infected herds and animal movement restrictions [1]. Nevertheless, emergency vaccination of domestic pigs and wild boar remain an option to minimize both the spread and the socioeconomic impact of outbreaks [2]. For this application, potent vaccines are needed that allow differentiation of infected from vaccinated animals. Among the promising next-generation marker vaccines, the chimeric pestivirus “CP7_E2alf” is the most far developed and characterized candidate. The chimeric “CP7_E2alf” virus is constructed using the full-length infectious cDNA clone “pA/BVDV” of Bovine viral diarrhea virus (BVDV) strain CP7 (GenBank accession numbers U63479.1 and AF220247.1). The parental virus was first described by Corapi et al. [3], and the generation of the cDNA construct is described by Meyers et al. [4]. In brief, total RNA from CP7-infected MDBK-cells was used to generate corresponding cDNA. In a first step, libraries were established in λZAPII (Stratagene) following the manufacturer’s instructions. After screening of the derived fragments, sub-cloning into pBluescript plasmids (Stratagene) was done by in vivo excision following the instructions provided by the supplier. Assembly of the genome was subsequently done in several steps using clone intermediates (intermediates spanning different parts of the genome and rational supplementation of missing sequence stretches at the 5′- and 3′-ends). The final version of the full-length clone was based on the different fragments and cloned into the low-copy-number plasmid pACYC177 (New England Biolabs, GenBank accession X06402, L08776) including a T7 RNA polymerase promoter in front of 5′ end of the viral genome as well as a cleavage site (SmaI) at the 3′ end for linearizing the plasmid DNA. For in vitro transcription, the cloned full-length cDNA construct was linearized, purified, and transcribed into RNA using T7 RNA polymerase (New England Biolabs).

In vitro-transcribed positive-stranded RNA of “pa/BVDV” was finally transfected into bovine cells by using electroporation and the resulting recombinant virus progeny was further characterized as identical to parental BVDV CP7.

For the generation of the chimeric BVDV/CSFV pestivirus “CP7_E2alf”, the envelope protein E2-encoding region, which is the most immunogenic protein in the structure of Pestiviruses, was replaced in the BVDV CP7 backbone with the respective coding sequence of Classical swine fever virus (CSFV) strain “Alfort 187” [5]. Therefore, in the following, an overview is given on its construction as an example for a chimeric pestivirus. Critical steps are described in detail and supplemented by methodological notes.

2 Materials

• 1. Porcine kidney cells (PK15, RIE0005-1, CCLV).

• 2. Diploid bovine esophageal cells (KOP-R, RIE244, CCLV).

• 3. Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 % BVDV-free fetal bovine serum (FBS).

• 4. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄, pH 7.4.

• 5. Trypsin buffer: 136 mM NaCl, 2.6 mM KCl, 8 mM NaH₂PO₄, 1.5 mM KH₂PO₄, 3.3 mM EDTA, 0.125 % trypsin.

• 6. CSFV Alfort 187 strain.

• 7. Escherichia coli TOP10F′ cells (Invitrogen).

• 8. Plasmid purification kits (Mini, Midi, or Maxiprep).

• 9. Full-length cDNA clone “pA/BVDV” (kindly provided by G. Meyers, FLI) [4].

• 10. Restriction endonuclease enzymes KpnI, PacI, RsrII, SnaBI, and SmaI. T4 DNA ligase, Klenow enzyme for end repairing.

• 11. Polylinker containing sequences for PacI, RsrII, and SnaBI, restriction endonucleases generated by PCR with p7_PacI primer: 5′-CAAGGGTACCCATTAATTAACGGTCCTACGTAGTCCAGTATGGGGCAGGTGA-3′ (+sense) and p7R_KpnI P7R primer: 5′-GCTCTAGGTACCCCTGGGCA-3′- (−sense).

• 12. “E2Alf_PacI (5′-GCATTAATTAACCAGCTAGCCTGCAAGGAAGATT-3′, +sense)” and “E2AlfR_SnaBI (5′-GACCTACGTAACCAGCGGCGAGTTGTTCTGTT-3′, −sense)”.

• 13. RNA extraction and purification kit for cultured cells.

• 14. RT-PCR system for cDNA generation and equipment for PCR amplification.

• 15. QIAquick Nucleotide Removal Kit (Qiagen).

• 16. T7 RiboMax Large-Scale RNA Production System (Promega).

• 17. Ethanol, RNAse-free water, agarose gel electrophoresis system, ethidium bromide.

• 18. Gene Pulser Xcell Electroporation System and electroporation cuvettes with 0.4 cm gap width (Bio-Rad).

• 19. 3 % paraformaldehyde, acetone, primary antibodies specific to CSFV proteins E2 and NS2/NS3. Anti-mouse IgG Alexa Fluor 488 conjugated.

• 20. Fluorescence microscope.

3 Methods

3.1 Cell Culture

Porcine kidney cells (PK15) and diploid bovine esophageal cells (KOP-R, RIE244, CCLV), are propagated in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% BVDV-free fetal bovine serum (FBS). After a short washing step with PBS cells are detached with trypsin buffer. The cells are routinely passaged twice weekly at a split ratio of 1:6–1:8.

3.2 Generation of cDNA Constructs

All plasmids are propagated in Escherichia coli TOP10F′ cells (Invitrogen). Restriction enzyme digestion and cloning procedures are performed according to standard protocols. Plasmid DNA is purified by Qiagen Plasmid Mini, Midi, or Maxi kits according to the manufacturer’s instructions. The E2-deleted cDNA construct of the original infectious CP7-clone “pA/CP7_ΔE2PacI” and the E2-exchanged chimeric cDNA clone “pA/CP7_E2alf”, underlying the CP7_E2alf vaccine virus, are all constructed based on the above mentioned full-length cDNA clone “pA/BVDV”.

• 1. Digest plasmid “pA/BVDV” with restriction enzyme KpnI, to excise the E2-gene to the end of the p7-encoding region.

• 2. Purify and religate the digested plasmid to obtain the intermediate cDNA construct “pA/CP7_ΔE2p7” which shows an in-frame deletion of E2 and p7 of the pA/BVDV.

• 3. Subsequently, the deleted p7-encoding region has to be repaired and a small polylinker with the restriction cleavage sites for PacI, RsrII, and SnaBI inserted. To this means, a PCR-fragment was amplified using plasmid DNA of pA/BVDV as template and primers “p7_PacI (CAAGGGTACCCATTAATTAACGGTCCTACGTAGTCCAGTATGGGGCAGGTGA, +sense)”, which contains recognition sites for the restriction enzymes KpnI, PacI, RsrII, and SnaBI, and “p7R_KpnI P7R (GCTCTAGGTACCCCTGGGCA, −sense)”. The PCR-fragment is subsequently digested with KpnI and cloned into the KpnI site of plasmid “pA/CP7_ΔE2p7” (see above). The resulting construct was named “pA/CP7_ΔE2PacI” (Fig. 1).

  Fig. 1

  

  Schematic representation of the engineered constructs. NTR, nontranslated region; C, E^RNS, E1, E2, coding sequences for the structural proteins; NS2, NS3, NS4A, NS4B, NS5A, NS5B, sequences encoding nonstructural proteins. The horizontal dotted line shows the deleted region, arrows indicate restriction enzyme sites. The shaded box represents the inserted sequence encoding the CSFV E2 protein of the CSFV isolate Alfort 187

• 4. In order to obtain the final construct “pA/CP7_E2alf” (Fig. 1), digest plasmid “pA/CP7_ΔE2PacI” with restriction enzymes PacI and SnaBI.

• 5. To amplify the E2Alf cDNA, perform a RT-PCR using RNA derived from CSFV Alfort 187 infected PK15 cells using primers “E2Alf_PacI (GCATTAATTAACCAGCTAGCCTGCAAGGAAGATT, +sense)” and “E2AlfR_SnaBI (GACCTACGTAACCAGCGGCGAGTTGTTCTGTT, −sense)”, containing PacI and SnaBI restriction sites, respectively.

• 6. Purify the PCR fragment, covering the complete E2-encoding sequence of CSFV Alfort 187, and digest with PacI and SnaBI.

• 7. Ligate the digested PCR fragment into the plasmid “pA/CP7_ΔE2PacI”. This results in the final plasmid “pA/CP7_E2alf”.

3.3 Recovery of Chimeric Pestivirus “CP7_E2alf” from Recombinant cDNA Construct “pA/CP7_E2alf”

The final vaccine virus CP7_E2alf was obtained through transfection (electroporation) of in vitro-transcribed RNA from the linearized chimeric plasmid “pA/CP7_E2alf” into porcine kidney and bovine esophageal cells.

3.3.1 In Vitro Transcription

• 1. Linearize the full-length cDNA construct “pA/CP7_E2alf” with SmaI (see Note 1 ).

• 2. Purify the digested DNA by using the QIAquick Nucleotide Removal Kit (Qiagen) and precipitate the product with ethanol. Resuspend the dried DNA in RNase-free water and use it as template for in vitro-transcription (see Note 2 ).

• 3. Perform an in vitro transcription reaction by using the T7 RiboMax Large-Scale RNA Production System (Promega) according to the manufacturer’s instructions. Prototype T7 reaction mixture is: 1 μg linearized DNA, 4 μl T7 5X transcription buffer, 6 μl 25 mM rNTPs, 2 μl enzyme mix, and nuclease-free water to a final volume of 20 μl.

• 4. Mix gently and incubate the reaction at 37°C for 2 hours.

• 5. Estimate the amount of RNA by ethidium bromide staining after agarose gel electrophoresis (see Note 3 ).

3.3.2 Electroporation

• 1. Prepare a semi-confluent cell culture of KOP-R or PK15 cells at the time of harvest (see Note 4 ).

• 2. Detach about 1 × 10⁷ cells using trypsin solution and wash cells twice with PBS.

• 3. Suspend the cells in 1 ml PBS and mix them with 1–5 μg of in vitro-transcribed RNA by gently pipetting up and down.

• 4. Transfer the DNA-cell mixture into electroporation cuvettes with 0.4 cm gap width (Bio-Rad).

• 5. Electroporate cells with two pulses at 850 V, 25 μF, and 156 ω, using the Gene Pulser Xcell Electroporation System (Bio-Rad) (see Note 5 ).

• 6. Seed cells immediately in culture vessels according to the experimental requirements and incubate them at 37°C for 72h

3.3.3 IF Staining

At the day of supernatant collection, virus replication is monitored by standard immunofluorescence (IF)-staining using a fluorescence microscope. For the detection of BVDV and CSFV proteins, the monoclonal antibodies (mab) WB210 (anti-E^RNS BVDV, CVL Weybridge), 01–03 (anti-E^RNS panpesti, Schelp), WB215 (anti-E2 BVDV, CVL Weybridge), CA3 (anti-E2 BVDV, Institute for Virology, University of Veterinary Medicine, Hannover), HC/TC50 (anti-E2 CSFV, Institute for Virology, University of Veterinary Medicine, Hannover), HC34 (anti-E2 CSFV, Institute for Virology, University of Veterinary Medicine, Hannover), mab-mix WB103/105(anti-NS3 panpesti, CVL Weybridge), and C16 (anti-NS3 panpesti, Institute for Virology, University of Veterinary Medicine, Hannover) were used. Standard IF-analysis using a fluorescence microscope (Olympus) were performed as previously described [6, 7].

• 1. For NS2/3-staining wash cells twice with PBS and fix them with 3% paraformaldehyde on ice for 15 min.

• 2. Wash cells with PBS, and permeabilize for 5 min with 0.0025% digitonin in PBS at room temperature.

• 3. For E^rns and E2 protein staining, fix cells and permeabilize for 10 min with ice-cold 80% acetone.

• 4. Wash cells with PBS and incubate them with the first antibody for 15 min. After washing the cells twice with PBS, incubate cells for 15 min with the second antibody (anti-mouse-Ig Alexa 488). Rinse cells with PBS again twice and investigate by using a fluorescence microscope.

• 5. The rescued virus preparations are further passaged using PK15 or KOP-R cells, and all virus titers determined as TCID₅₀. In all cases, the whole virus population is passaged to avoid negative selection that would be caused by biologically cloned virus. The virus is subsequently subjected to in vitro and in vivo characterization and stability tests (see Note 6 ).

4 Notes

• 1. Depending on the way the 3′ end of the pestivirus genome is generated, the plasmid must be digested with appropriate restriction enzymes. Because the extreme 3′ end of the pestiviruses usually consists of three or more cytosines, blunt end cutter like the restriction enzyme SmaI are used for linearization of DNA templates prior to in vitro transcription to ensure the production of RNA of correct length. It is important to avoid the use of restriction enzymes which produce protruding ends (overhangs). Extraneous transcripts can appear in addition to the expected transcript when such templates are transcribed. Furthermore, extra bases will be added to the transcripts, which may interfere with RNA replication.

• 2. Clean-up of digested DNA before in vitro transcription is possible with commercially available systems (e.g., QIAquick Nucleotide Removal Kit, Qiagen). For complete elution of bound DNA from the spin columns, DNA can be eluted twice. To elute the DNA, RNase-free water should be used instead of elution buffer. However, store eluted DNA at −70 °C, as DNA may degrade in the absence of a buffering agent.

• 3. The purified linear DNA should be examined by agarose gel electrophoresis prior to in vitro RNA-transcription to verify complete linearization, and to ensure the presence of a clean, non-degraded DNA-fragment of the expected size. It is useful to start with at least 30 % more DNA than is required for the transcription reactions to compensate for any RNA-loss during purification.

• 4. The appropriate number of cells depends on the general electroporation conditions and on the growth rate of the cells and must therefore be optimized. Cells should be seeded for 24 h before electroporation and should not be confluent before transfection.

• 5. For most purposes, it is not necessary to clean up the in vitro-transcribed RNA before electroporation of cells. However, unincorporated nucleotides can be removed by isopropanol precipitation. The DNA-template may be removed by digestion with DNase following the transcription reaction. It is crucial to use an RNase-free DNase that is qualified for the degradation of DNA while maintaining the integrity of RNA. After DNase digestion the in vitro transcripts have to be cleaned up by phenol extraction or alternatively by commercially available spin-column-based systems for the purification of total RNA.

• 6. Novel pestivirus clones and technologies for manipulation are available today. Full-length sequences cloned into bacterial artificial chromosomes (BACs) have been described [8] which can be directly manipulated using bacterial recombination systems like Red/ET. Furthermore, full-length PCR and mutagenesis as well as fusion-PCR allow now a swift direct manipulation of plasmid-cloned pestivirus genomes [9].