Introduction

GATA transcription factors (GATA TFs) encode a type IV zinc-finger protein, which binds to the DNA sequence (A/T) GATA (A/G) and performs as regulators of gene expression (Zhang et al. 2018; Lowry and Atchley 2000). The GATA gene family is a very conservative transcription factor family (Gupta et al. 2017). GATA TFs are classified into A-, B-, C-, and D-GATA classes (Reyes et al. 2004; Behringer et al. 2014; Ranftl et al. 2016). TFs act as a synchronous element between action (stimulation) and response (gene expression). TFs can control gene expression, which is accomplished by specific binding with the promoter/enhancer sequence of the gene (Kemal and John 2013).

The role of these GATA TFs has been widely studied in fungi and animals (Tsai et al. 1994; Marzluf 1997, 2004; Scazzocchio 2000; Tong et al. 2000; Pikkarainen et al. 2004). GATA TFs have not been widely studied in plants. Compared with animal genome, the family of GATA TFs in plants is relatively large, with about 30 members. In Arabidopsis thaliana, the GATA gene family consists of 30 members. Although it is rarely described, some have been shown to regulate embryonic development and seed germination. For example, GNC and GNL inhibited seed germination, and mutant seeds with loss of function germinated faster than wild-type (WT) seeds (Richter et al. 2010). On the contrary, BLUE MICROPYLAR END3 (BME3), another GATA TF, acts as a positive regulator of Arabidopsis seed germination (Liu et al. 2005). In Triticum aestivum, TaGATA1 is localized in the nucleus and binds to the core cis element of GATA in wheat and has transcriptional activation activity. The overexpression of TaGATA1 greatly enhanced the resistance of wheat to Rhizoctonia cerealis. On the contrary, silencing TaGATA1 reduced this resistance. TaGATA1 actively regulates immune response to R. cerealis by activating the expression of defense genes in wheat (Liu et al. 2019). In rice, the GATA gene family contains 28 members and encodes 35 hypothetical GATA TFs (Gupta et al. 2017). In Glycine max, sixty-four GATA genes were identified. The soybean genome has more GATA genes than A. thaliana or rice. Preliminary functional analysis showed that GmGATA44 has a similar regulation function of chlorophyll biosynthesis in a A. thaliana and rice (Zhang et al. 2015). In Vitis vinifera, nineteen grape GATA genes (VvGATA) were analyzed and identified (Zhang et al. 2018). GATA protein in model plants is related to growth and development. However, little is known about its role in immunity. There is no genetic evidence for the role of GATA in the immune response in potato which is one of the three major food crops on which human beings depend (Bali et al. 2018). In recent years, potato cultivation and production are often seriously threatened by the RSSC (Ralstonia solanacearum species complex), which is one of the main limiting factors for the stable and abundant potato yield (Peeters et al. 2013). RSSC is a highly diverse strain group found worldwide, many of which are destructive and can cause bacterial wilt (BW) in a variety of host plants (Ravelomanantsoa et al. 2018). Because of the increasing number of hosts and limited control technology, RSSC has become a major disease in many cultivated plants. Therefore, it is of great significance to accelerate the research of the disease control and resistance breeding in theory and application.

This study used bioinformatics method to make the first genome-wide prediction of the StGATA gene family, and made a preliminary study on its member distribution, gene structure, evolutionary model and expression analysis. A representative member StGATA9 gene was found, induced by abiotic and biological stress, and analyzed in combination with the results of bioinformatics. This will lay a foundation for further research on the function of StGATA9 gene.

Materials and methods

Plant material and growth conditions

The potato (diploid genotype ED13) plants used in this study were provided by the Chinese Academy of Agricultural Sciences (CAAS). Potato ED13 genotype was resistant to bacterial wilt (Pang et al. 2019). Aseptic tuber ED13 was planted in pots containing 450 mL peat and vermiculite (3:1, volume ratio) (10 cm, in diameter and 15 cm in height). The culture conditions were as follows: 16 h light (24 °C)/8 h dark (18 °C) photoperiod (light intensity approximately 3000 lx) with 75% relative humidity (Pang et al. 2019).

Identification and characterization of StGATA gene family

Referring to the previous methods (Peng et al. 2019), to get complete potato StGATA genes, potato genome was downloaded from Phytozome database, and a Hidden Markov Model (HMM) seed file of the GATA domain (PF00320) was downloaded from Pfam. All StGATA gene candidates were analyzed using the HMM (Liang et al. 2017). Physical properties such as peptide length, isoelectric point and molecular weight, and subcellular localization were completed by ExPASy (http://web.expasy.org/protparam/) and PSORT (https://wolfpsort.hgc.jp/) online tools.

Phylogenetic tress analysis

A phylogenetic tree was constructed with MEGA 7 using Neighbor-Joining (NJ) method (Dereeper et al. 2010). A phylogenetic tree is also built through 1000 Bootstrap repeats and other default parameters (phylogenetic reconstruction; replacement type: amino acid; model/method: P-distance; inter-site ratio: uniform ratio; gap deletion data processing: partial deletion).

Conserved motif analysis, chromosome mapping and gene structure analysis of StGATA

The conserved domain of the protein was analyzed by online software MEME (http://meme-suite.org/) (Zou et al. 2019). The chromosomal locations information were retrieved from potato genome data and these data were downloaded from the phytozome (Liang et al. 2017). The gene structure of StGATA was analyzed by GSDS website (http://gsds.gao-lab.org/index.php).

Digital expression analysis of StGATA protein

Referring to the previous methods (Nussbaumer et al. 2014), expressions of each StGATA member in four tissues and developmental stages were investigated according to digital expression data retrieved from RNASeq Expression Browser (http://solanaceae.plantbiology.msu.edu/pgsc_download.shtml).

Promoter sequence analysis

The base of the 5′ upstream 2000 bp of the initiation codon ATG of the StGATA genes was obtained from the potato genomic DNA, and then PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) was used to search the promoter region in the download sequence, to analyze each binding site and predict its potential cis-acting elements (Lescot et al. 2002).

Hormone treatment

Potato plants grew to 7–8 leaf age and were treated with 100 μ mol/L ABA and 50 μ mol/L MJ. The method was referred to the previous work (Blaudez et al. 2003). The samples were sampled at 0, 1, 2, 3, 4 and 5 d after treatment and frozen in liquid nitrogen for 10 min used for RNA extractions (Denancé et al. 2013). Each treatment was repeated three times.

Inoculation

Potato seedlings of 7–8 leaf age were treated with 108 cfu/mL (OD600 = 0.2) solution and inoculated with root injury irrigation method (He et al. 1983). Control plants were inoculated with an equal volume of water. The samples were collected at 6, 12, 24, 48 and 84 h after the inoculation, wrapped with aluminum foil, placed in liquid nitrogen for 20 min (Kong et al. 2016).

Quantitative real-time polymerase chain reaction

In our previous work, a suppression subtractive hybridization (SSH) cDNA library was created and the EST of the StGATA9 gene was found to up-regulated induced by R. solanacearum in potato. Potato Actin gene is internal reference gene (GenBank Accession: X55747). qRT-PCR reference Schmittgen’S method (Schmittgen and Livak 2008), 2 µg of total RNA was inversely recorded into cDNA according to the operation of TransScript II All-in-One First-Strand cDNA Synthesis SuperMix kit. The subsequent qRT-PCR was finished with the following primers: StGATA9-F: GTCATTGTGTAACGCATGTG G,StGATA9-R: TGATCAGTTTTCCCATTTGCTG; internal referenc: Actin-F: TA TAACGAGCTTCGTGTTGCAC, Actin-R: ACTGGCATACAGCGAAAGAACA.

Fluorescence in situ hybridization

Referring to the previous methods (Peng et al. 2019), the bacterial liquid of R. solanacearum strain PO41 (Biovar 2, race 3, 108 colony forming units/mL) was used to infect ED13 seedlings. After 48 h of inoculation, a small number of leaves and 2–3 stem segments (6–7 cm),) were collected from each seedling and put into the 10 mL centrifuge tube. The plant material was immersed in a fixative comprising 85 mL 50% ethanol, 10 mL 37% formaldehyde, 5 mL glacial acetic acid and 0.1% DEPC. An RNA probe was generated from the StGATA9 gene fragment amplified by PCR, labeled with 5-FAM, and added to the paraffin section made from previously prepared samples. The StGATA9 probe sequence was 5′-ATGACTAACTTGTCTT CTCTCTTCCACAAGCT-3′, and the probe concentration was used at 100 μmol/L.

Results

Genome-wide identification of StGATA genes

In total, StGATA genes were identified in the potato genome and were named StGATA1 to 49. The study showed that the amino acid number of the StGATA gene family was 118 and the largest was 380, and its molecular weights varied from 13,146.94 Da to 60,626.92 Da. We predicted the isoelectric points (pIs) of StGATAs proteins, and pIs were also great differences. The pI of StGATA18 was 4.53 and StGATA23 was 10.34, which were the smallest and largest pIs in the StGATA gene family, respectively. StGATA were predicted to be localized in the Nucleus, chloroplast stroma, cytoplasm, mitochondrial matrix space, microbody (peroxisome), plasma membrane and mitochondrial intermembrane space (Table 1).

Table 1 Genome-wide identification of StGATA genes
Full size table

Phylogenetic analysis of StGATA protein

In order to study the StGATA family, using MEGA7.0, the phylogenetic tree of 49 amino acid sequences of StGATA domain was constructed by NJ method. The StGATA gene family is divided into five different groups, I to V (Fig. 1).

Fig. 1
figure 1

Phylogenetic analysis of StGATA proteins. A phylogenetic tree constructed using the neighborjoining (NJ) method in MEGA 7.0. Parameters were set as pairwise alignment, and 1000 bootstrap replicates. Branch lines with different colors indicated different subgroups. The proteins on the tree can be divided into five distinct subgroups, which are indicated by different colored backgrounds

Full size image

Chromosomal location and gene structure of StGATAs

Using MapInspect tool, all StGATAs were located on 12 chromosomes, and the location map of StGATA was drawn (Fig. 2). StGATA was found in all the 12 chromosomes and these genes were unevenly distributed on the chromosomes. Chromosome 1 has the largest number of StGATA, with 13 (about 26.5%), while chromosomes 7 and 10 contain only one StGATA. In addition, thirty-four StGATA genes shared close physical distances on the chromosomes. The structural distribution of exons and introns of StGATA was obtained by analyzing the functional genome database of potato (Fig. 2). The number of introns varied from 0 to 10. Out of the forty-nine StGATAs, the shortest intron was found to be in StGATA16 and StGATA17, while the longest ones were seen in StGATA14. The number of exons of StGATA family members varies, consisting of 1–11 exons, of which the shortest exon is in StGATA30 and StGATA31, while the longest exon is in StGATA43.

Fig. 2
figure 2

Chromosomal location and gene structure of StGATA. a Chromosomal distribution of StGATA. Vertical bars indicate locus of SotubMCs on potato chromosomes. b The exon–intron structure of StGATA genes visualized by online tool GSDS 2.0, yellow boxes indicated exons and gray lines indicated introns

Full size image

Conserved motif analysis of StGATA protein

The conserved motifs of StGATA proteins were analyzed by online program MEME server and the phylogenetic tree of all potato StGATA proteins was constructed by MEGA 7.0 software. To further understand the evolutionary relationship and conserved motif of StGATA protein. Forty-nine StGATA proteins were divided into 5 subgroups and 10 motifs were identified. Therefore, we speculated that the subgroup proteins in the same subgroup had similar conserved motif structure (Fig. 3).

Fig. 3
figure 3

Conserved motif analysis of StGATA genes. a The conserved motif of StGATA proteins analyzed by online program MEME server, different colored boxes indicated different motifs. b Highly conserved amino acid residues across all StGATAs

Full size image

Cis-acting elements analysis in the promoter regions of StGATA

In order to understand the transcriptional regulation of StGATA gene during plant development and stress response, 2000 bp bases upstream of the initiation codon ATG of StGATA genes were obtained from potato genomic DNA. As shown in Fig. 4, the sequence analysis of the promoter of StGATA gene family showed that there were elements related to abiotic stress in the 2000 bp region of the StGATA promoter, including abscisic acid (ABRE), MeJA reactivity (TGACG- motif) and salicylic acid (TCA- element). There were hormone-related regulatory elements in the promoter region, indicating that StGATA was involved in hormone regulation. And there were stress-related cis-acting elements in the promoter region, indicating that StGATA was involved in stress regulation (Fig. 4).

Fig. 4
figure 4

Cis-acting elements analysis in the promoter regions of StGATAs. ABRE, Abscisic acid responsive element; TGACG-motif, involved in MeJA responsiveness; TCA-element, Salicylic acid responsive element; TC-rich repeats, involved in defense and stress responsiveness; CGTCA motif, involved in Methyl-jasmonic acid (MeJA) response

Full size image

Conserved microsynteny of GATA genes from two species

Syntenic blocks consist of conserved genes arranged similarly in chromosomes of different species. We detected 16 StGATAs and 16 SlGATAs involved in duplicated genomic blocks, accounting for around 32% (20/49) and 43% (16/37) of the GATA genes in each species (Fig. 5). The potato genes on chromosomes ST4.03ch01,ST4.03ch02,ST4.03ch03, ST4.03ch05, ST4.03ch06, ST4.03ch07, ST4.03ch08, ST4.03ch11 and ST4.03ch12 may come out conserved fragments on tomato chromosome 1, 2, 3, 5, 6, 7, 8, 9 and 11. Moreover, the duplicated GATA gene pairs occurred either within a chromosome.

Expression profile of StGATA genes in various organs and tissues

The expression data for StGATAs had been retrieved from RNASeq Expression Browser. Two of the StGATAs (StGATA2 and SStGATA34) do not express themselves in root, five of the StGATAs (StGATA7, StGATA24, StGATA25, StGATA34 and StGATA48) failed to express in tuber and two of the StGATAs (StGATA26 and StGATA48) failed to express in leaver. On the contrary, other StGATA genes were generally expressed in tissues at different developmental stages (Fig. 6).

Fig. 5
figure 5

Comparative orthologous relationships of GATA gene from potato and tomato. Orthomcl was used to analyze the gene homology relationship between potato and tomato GATA gene families, and Circos was used to visualize the gene chromosome localization and homology relationship. GATA genes connecting potato genome and tomato genome are shown in colored links

Full size image

StGATA9 expression patterns elicited by phytohormones

The expression of StGATA9 was up-regulated by the exogenous hormone ABA and MJ (Fig. 6). The relative expression of the StGATA9 gene reached highest peak after 1 d of ABA treatment. However, the expression decreased significantly at 2 d, and began to increase at 3 d. After treatment with MJ, the expression level of StGATA9 was maintained in the first 2 d, reached the peak on the 3 d, and then decreased. The exogenous hormone could strongly stimulate the up-regulated expression of StGATA9 gene, indicating that the expression of StGATA9 would be likely to play a significant role in the process of hormone signal transduction.

Fig. 6
figure 6

Heat map showing expression profiles of StGATAs in different tissues. Heat-map showing expression patterns of StGATA in roots, stems, leaves and tuber based on RNA seq data. The Illumina RNA-seq data were reanalyzed, and the relative expression was calculated with respect to control samples

Full size image

StGATA9 expression levels induced by R. solanacearum

The induced expression of StGATA9 mRNA in potato seedlings inoculated with R. solanacearum was compared and analyzed by Real-time PCR method. Comparative analysis revealed that the expression of StGATA9 gene was up-regulated by R. solanacearum treatment (Fig. 7). The relative expression of StGATA9 gene reached highest peak after 6 h of R. solanacearum treatment. However, the expression decreased significantly at 12 h. Then, the expression level was up-regulated again in 24 h. The control group has been in a low expression state. Therefore, when plants were not stressed, the expression level of StGATA9 in plants was low, and when stressed by R. solanacearum, the expression of StGATA9 gene was up-regulated. It is speculated that StGATA9 gene plays an important role in resistance to bacterial wilt in potato.

Fig. 7
figure 7

The relative expression of StGATA9 gene in potato seedlings treated with hormone ABA and MJ was analyzed by real-time quantitative PCR. Mean ± standard deviation (SD) (n = 3 independent experiments, t-test)

Full size image

Tissue Localization of StGATA9 Expression

Fluorescence in situ hybridization analysis showed that StGATA9 mRNA was mainly distributed in the phloem of stem vascular system (Fig. 8a3) and leaf vascular bundle (Fig. 8c3). In addition, weak hybridization signals were observed in the control plants (Fig. 8b3 and d3). These results showed that StGATA9 gene was located in vascular bundle and showed certain tissue specificity.

Fig. 8
figure 8

The relative expression of StGATA9 gene in potato seedlings inoculated with R. solanacearum species complex was analyzed by real-time quantitative PCR. Water was used as control. Normalization is carried out at each point in time based on the value of actin. The value is the average ± standard deviation (SD) (n = 3 independent experiments, t-test)

Full size image

Discussion

TFs play an important role in different physiological and biochemical processes in the life system. In this study, we identified forty-nine StGATA genes. Based on the genome-wide investigation of GATA domain sequence, thirty GATA members were identified in A. thaliana (Ravindran et al. 2017). Twenty-nine GATA members were identified in rice (Chen et al. 2017a, b), and nineteen GATA members were identified in grape (Zhang et al. 2018).

We analyzed the phylogenetic relationship, chromosome distribution, gene structure and expression pattern of forty-nine StGATA genes, and predicted the promoters of all StGATA genes. Considering the unique domain structure, complex gene structure and phylogenetic analysis of StGATAs, and StGATA gene is divided into five subgroups (Fig. 1). Subgroup II is the largest with fifteen GATA members, namely StGATA4, StGATA6, StGATA9, StGATA14, StGATA15, StGATA16, StGATA17, StGATA19, StGATA20, StGATA21, StGATA22, StGATA34, StGATA44, StGATA46 and StGATA47. We have found GATA motifs in all GATA proteins. In addition, some GATA proteins also contain new domains, namely ASXH, TIFY and CCT (Fig. 3). In A. thaliana, the CCT domain is found in Constans (CO) proteins related to circadian rhythm and flowering control (Chen et al. 2017a, b). The TIFY domain has been found to characterize a large class of transcription factors (Vanholme et al. 2007). As expected, all StGATA proteins contain highly conserved GATA domains (motif 1). By comparing the evolutionary tree and conserved motifs of potato GATA proteins (Fig. 3), we found that the conserved motifs of StGATA proteins changed when they evolved into a new family. This study found that the number of exons of StGATAs is not equal, numbered 1–11 (Fig. 2b). In addition, we also found that StGATAs in the same branch have similar motif composition and gene structure, so we can infer that they are very similar in molecular function (Xu et al. 2019).

The StGATA genes can specifically interact with cis-acting elements in the promoter region. Element binding regulated the expression of downstream stress response genes. We predicted various cis-acting elements in its promoter region (Fig. 4). Among them, there are GARE binding sites in the promoter region of StGATA23. GARE is galacturonic acid-responsive element. This is consistent with the results of previous studies. GATA transporter were specifically induced by GA. GATA transporter contain a conserved motif (GARE) in their promoter regions (Niu et al. 2015). By comparing RNA-seq data, we could further understand the tissue expression pattern of StGATA family genes. In this study, twenty StGATA genes (StGATA-1, 5, 8, 9, 10, 12, 13, 15, 17, 18, 20, 21, 23, 27, 30, 32, 38, 40, 42, 47) were not expressed in four potato tissues. These results suggested that these genes may be pseudogenes or expressed only in specific environmental conditions or developmental stages. In addition, the other twenty-nine GATAs genes were expressed in four potato tissues. Among them, StGATA19, StGATA22, StGATA33, StGATA35, StGATA37, StGATA39, StGATA46 and StGATA49 genes have high expression in roots. StGATA4, StGATA7, StGATA24, StGATA25, StGATA26, StGATA31 and StGATA48 were extremely highly expressed in the stems. StGATA2, StGATA3, StGATA11, StGATA14, StGATA16, StGATA19, StGATA25, StGATA34, StGATA36, StGATA44 and StGATA45 had high expression in leaves. And StGATA6, StGATA28, StGATA29 and StGATA43 had high expression in tubers (Fig. 9). It was further found that the expression of StGATA gene in different subgroups had certain specificity, and the expression of StGATA gene in the same subgroup was significantly different in different tissues, indicating that it may have multiple functions in potato.

Fig. 9
figure 9

StGATA9 was located in the phloem of leaf vascular bundles and the stem vascular system. The stem and leaf tissues of potato seedlings were taken 48 h after inoculation with R. solanacearum, and the localization of StGATA9 in cells was observed by laser scanning imaging system. The first column and the second column are blue natural fluorescence, giving priority to the xylem. The third column is green fluorescence, corresponding to the location of StGATA9. The fourth column is the combined image of the second column of blue fluorescence and the third column of green fluorescence. a Stems of Potato seedlings inoculated with R. solanacearum were crosscutting. b Stems of Potato Seedling after Water treatment were crosscutting. c Leaves of Potato seedlings inoculated with R. solanacearum were crosscutting. d Leaves of Potato Seedling after water treatment were crosscutting. The ruler is 20 µm

Full size image

Plant TF gene will have a higher level in resistant strains after pathogen infection (Bai et al. 2011; Zhang et al. 2012). In our previous work, StGATA9 gene was gained. In this study, we identified the role of potato StGATA9 in host immune response to R. solanacearum (Fig. 7). Due to the interaction between R. solanacearum and plants in the potato seedling stage, in the early stage of infection by R. solanacearum, the plant spontaneous immune system protects against the invasion of pathogens through a series of defense pathways. In the late stage of R. solanacearum infection, a large number of R. solanacearum gathered in the vascular system of stems and leaves, blocking the pathways of nutrients and water led to plant wilting to death (Peeters et al. 2013). Combined with fluorescence in situ hybridization results (Fig. 8), StGATA9 was expressed in the vascular bundles in a tissue-specific manner, and the location of bacterial activity was also in the vascular bundles. Therefore, it is speculated that StGATA gene plays an important role in potato resistance to bacterial wilt. Meanwhile, the StGATA9 promoter contains cis-elements of biological stress response (Fig. 4). In order to evaluate the role of these GATA TFs in abiotic stress, we analyzed the relative transcriptional levels of plant hormones ABA and MJ in response to multiple stresses. Expression analysis under exogenous hormone ABA and MJ stress resulted in up-regulation of StGATA9 expression (Fig. 6). These findings suggest that GATA domains in StGATA9 may regulate its role in abiotic stress signal transduction.

To sum up, this study preliminarily discussed the role of potato GATA gene family in plant growth and development through bioinformatics analysis, and its specific function needs to be further analysed and verified by molecular biological means.