Abstract
For development of transgenic varieties of interest in rice, we have developed a simple, efficient and universal Agrobacterium mediated transformation protocol. Mature seeds of two indica (IR64 and Jaya), one each from japonica (AC41039) and aromatic (Basmati370) varieties were used as explants in the present study. Agrobacterium tumefaciens strain EHA 105 carrying Ti plasmid (pBI121) with the selectable marker npt II along with the reporter gene uidA encoding β-glucuronidase (GUS) was successfully integrated with rice genome without use of acetosyringone. Sterile distilled water washing in place of cefotaxime in the elimination process has been used to control excess growth of Agrobacterium. All the material after transformation germinated in 2 to 3 days of co-cultivation on MS basal medium. Germinated seeds transferred to the selection medium i.e. plain MS medium with 50 mg/l of kanamycin, produced two to three primary tillers within 2 weeks. Mesocotyls from 2 week old in vitro grown plants were taken and cultured in the multiplication medium (MS supplemented with 0.5 mg/l BA and 50 mg/l Kanamycin) where within 6–8 days they produced 3–4 secondary tillers. All the five to six tiller shoots so produced in the process developed roots on plain MS and grew well when transferred to pots containing autoclaved soil and vermicompost in the proportion of 4:1. Transient expression of GUS was observed in all the tissues of recipient plants. Integration of the transgene was confirmed by employing southern blotting and real-time PCR technique. The transformation protocol developed can be efficiently used across the two major subspecies/ecotypes of the Asian rice cultivar Oryza sativa.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Recombinant DNA technology is a potential tool to move genes of interest across sexually incompatible species and find thereby solution to problems that defy conventional breeding/selection approaches. Efficient protocols of tissue culture traits like regeneration and transformation are important prerequisites for successful development of transgenics of interest. Of them regeneration of plants by cell/tissue culture has been the challenging task across crop species in general and monocots in particular and rice is no exception. Despite efficient culture system already available for well responding model varieties such as Nipponbare (japonica) and Kasalath (indica), many of the popular varieties of both indica and japonica origin offer difficulty in both regeneration as well as transformation process. Regeneration efficiency is affected by a number of factors which include genotype, type and physiological status of explant, composition of culture medium, plant growth regulators and culture conditions (Rueb et al. 1994; Ge et al. 2006). Of them, genotype is the most important. As of now, many different protocols have been developed for Agrobacterium-mediated transformation in different sub-species of O.sativa. For instance, Ge et al. (2006) have developed variety specific regenaration-transformation protocols for different varieties of indica rice, while Nishimura et al. (2007) have developed Agrobacterium-mediated transformation protocol for elite japonica varieties. Likewise for aromatic varieties also many standardized protocols are available (Rashid et al. 2003; Rao and Rao 2007). Standardization of genotype specific protocols for so many varieties/subspecies is however quite laborious and time consuming, warranting thus the need and urgency for development of a universal protocol for use across genotypes.
Keeping in view the need for a transformation protocol usable across a varieties/subspecies the present study was undertaken with the sole objective of developing an efficient Agrobacterium-mediated transformation system. To represent fairly divergent germplasm, varieties belonging to the two major subspecies of Oryza sativa viz indica and japonica as well as a basmati type, which is considered to be different from both recognized sub species were used as test germplasm. The efficiency of the regeneration protocol was assessed from the frequency of multiple shoot formation while transformation by Real time PCR and Southern blot analysis for putative transformants. The real time PCR (TaqMan assay) analysis was done with reference to sucrose phosphate synthase (SPS), a single copy endogenous control gene (Ding et al. 2004; Wang et al. 2010 and Weng et al. 2004).
Materials and methods
Plant material and surface sterilization
Four rice genotypes viz., IR64 and Jaya (indica), AC41039 (japonica) and Basmati370 (aromatic) have been chosen to represent the rice sub-species/ecotype for transformation. Seeds of the genotypes were dehusked and after washing in SDW rinsed with Tween 20, a liquid detergent solution for 15–20 min followed by 0.1% (w/v) HgCl2 for 7–8 min for surface sterilization. Finally, the seeds were thoroughly rinsed in sterile double distilled water for at least four times under aseptic conditions and used as the source material for both in vitro culture and transformation with Agrobacterium.
Agrobacterium mediated transformation and subculturing
Surface sterilized dehusked rice seeds of the four varieties and the Agrobacterium strain EHA105 carrying a disarmed Ti plasmid (pBI121) with the selectable marker gene npt II that confers resistance against kanamycin to transformed cells along with the reporter gene (uidA) that encodes β-glucoronidase (GUS) ware taken for transformation. The Agrobacterium tumefaciens strain grown on 30 ml of YEM [Yeast extract(0.4 g) + mannitol(10.0 g) + NaCl(0.1 g) + MgSO4.7H2O(0.2 g) + K2HPO4(0.5 g) in one litre of water] medium with kanamycin (50 mg/l) was set for shaking at 150 rpm at 280 C for 20 h by inoculating a single colony with a sterile loop.10 ml of overnight grown bacterial culture diluted to 1/5th with fresh YEM medium (adjusted O.D600.-0.3-0.6) poured in a petridish (90 mm) containing 10 seeds of each variety. Seeds were slightly pounced with a pointed needle mixed with the bacterial suspension by gentle swirling and immersed in the same for 35 min. Seeds were blot in sterile tissue paper and placed on the co-cultivation medium CCM Murashige and Skoog (1962) basal medium +3% sucrose + 0.8% agar(pH-5.8) for 2 days at 25 ± 20 C in a culture room for co-cultivation. For elimination of Agrobacterium the seeds were simply washed 2 to 3 times in sterile distilled water and blot dried with sterile filter paper. Later the seeds were placed on selection medium (CCM + 50 mg/l Kanamycin). Mesocotyls (containing multiple meristems) from 2 week old in vitro grown plants derived from the selection medium were transferred onto multiplication medium (full strength MS medium with 0.5 mg/l of 6-benzyladenine with 50 mg/l kanamycin) for shoot proliferation. Then these shoots were transferred to MS basal medium + 3% Sucrose + 0.8% Agar (pH-5.8) for rooting. Then for hardening, all the plants of (10 of each variety) were transferred to pots containing 4:1 ratio of autoclaved soil and vermicompost.
Media preparation, culture condition and data analysis
MS (Murashige and Skoog 1962) salt composition, sucrose (30 g/l) and bacteriological grade agar-agar (8 g/l) were used throughout the study with or without incorporation of growth regulators and the pH was adjusted to 5.8. All the cultures were incubated in a culture room maintained at 25 ± 2°C under 16 h/8 h light/dark cycle, 45 μmol m−2 s−1 irradiance level was provided by cool white fluorescent tubes (Philips, India) and with 55–60% relative humidity. The experiment was repeated thrice with each treatment consisted of 10 explants. Duncan’s multiple range test (DMRT) was applied for comparison of regeneration results in terms of number of shoots and shoot length for the four cultivars.
GUS assay
The plants obtained from the process of Agrobacterium transformation were placed in petriplates containing GUS assay solution consisting of 10 mg X-gluc (5-bromo-4-choloro-3-indolyl, β-D-glucuronic acid), 100 μl dimethyl formamide (DMF), 1 ml of 1 M sodium phosphate (pH 7.0) and 1 ml of the detergent Triton X-100. The volume was made up to 20 ml with distilled water and the solution was stored in dark in refrigerator for the assay. A solution of X-Gluc was prepared, aliquoted, and stored frozen until needed. A positive control was included to monitor the extent of penetration of the substrate into the material. The plants were incubated at 37°C overnight and placed in 70% ethanol to bleach chlorophyll so as to make it easier to see the blue staining of the plant tissue. The plants were placed into fresh 70% ethanol at least three times till the plant tissues became light green.
PCR analysis
Presence of the transgene in transformed and non-transformed plants was confirmed by PCR analysis. Genomic DNA was extracted from leaves using modified CTAB method (Cheng et al. 2003). Presence of GUS and npt II was confirmed by amplification of PCR specific primer sequences 5′TTCGCGTCGGCATCCGCTCAGTGGCA3′ and 3′GCGGACGGGTATCCGGTTCGTTGGCA5′ for uidA (GUS) 5′GAGGCTATTCGGCTATGACTG3′and 3′ATCGGGAGGGGCGATACCGTA5′ for npt II. Each PCR reaction was performed in 25 μl (total volume) of reaction mixture consisting of approximately 50 ng of genomic DNA obtained from the transgenics showing Gus expression, 1 X PCR buffer, 50 μM dNTPs, 1.5 mM MgCl2, 5 pmoles of each primer and 1 unit of Taq DNA polymerase. PCR was carried out in a thermal cycler (ABI Veriti) using the following conditions: 94°C for 4 min as preheating, 35 cycles of 94°C denaturing for 1 min, 58°C (for uidA g)/55°C (for npt II) annealing for 1 min and 72°C extension for 1 min and 10 min at 72°C final extension. Amplified DNA fragments were electrophoresed on 1.2% agarose gel detected by ethidium bromide staining and photographed under ultraviolet light of Bio-Rad Molecular Imager Gel Doc XR System.
Real-Time PCR analysis
Real time PCR (RT-PCR) was carried out in Applied Boisystems 7500 Real-Time PCR System with Software v2.0. The corresponding nucleotide sequence of the SPS F-5′-TTG CGC CCT GAA CGG ATA T-3′;SPS R- 5′-CGG TTG ATC TTT TCG GGA TG-3′; SPS P - FAM-TCC GAG CCG TCC GTG GGT/GB and GUS F-5′TTA ACT ATG CCG GAA TCC ATC GC-3′; GUS R- 5′AAC GCT GAC ATC ACC ATT GGC-3′ GUS P- FAM-ATG CTC TAC ACC ACG CCG AAC/GB were taken for amplification. All the primers and fluorogenic probes were synthesized and taken from Integrated DNA technologies, RFCL Limited. The SPS and GUS probes were labeled with FAM™ reporter dye at 5′ end and Quencher NFQ-MGB (non fluorescent quencher—minor groove binder) at 3′ end. For q-PCR each reaction mixture of 25 μl containing 12.5 μl of TaqMan universal PCR master mix of 2.0X (P/N 4304437—It contains AmpliTaq Gold® DNA, AmpErase Uracil-N-glycosylase, dNTPs with dUTPs, optimized buffer components, and Passive Reference dye); 50 ng of cDNA sample synthesized from RNA isolated from individual transgenic lines (by Promega Kit), 750nM of each SPSF/R primers with 300nM flurogenic SPSP probe and 500nM GUSF/R primer and 150nM GUSP probe. The amplification conditions were 50°C for 2 min(holding stage- UNG incubation),95°C for 10 min(holding stage for AmpII TaqGold activation),cycling stage of 40 cycles for 30s at 94°C,annealing at 56°C of 30s and extension of 30s at 72°C. Each sample was quantified in triplicate.
Calculation of relative gene expression level
To analyze data from real-time quantitative PCR experiments relative quantification (RQ) was done. The 2−ΔΔCt method was used being a convenient way to analyze relative changes in gene expression from real-time quantitative PCR experiments (Pfaffl 2001; Pfaffl et al. 2002; Livak and Schmittgen 2001; Yuan et al. 2006). The experiment involved control and treatment sample. For each sample, a target gene and a reference gene for internal control were included for PCR amplification. The threshold cycle CT (Ct) is the cycle number from the amplification curves, at which the amount of amplified target gene reaches a fixed threshold in a real-time PCR assay.
For relative quantification (RQ) comparative Ct method was adopted and CV, SD was calculated for validation of reliability and reproducibility of the results.
Southern blot analysis
Ten micrograms of each DNA of four transgenic rice varieties and plasmid DNA were completely digested with HindIII. The digested DNA resolved in 0.8% agarose gel and then transferred into nitrocellulose membrane. A 800 bp npt II (amplified PCR product) DNA fragment was used as the hybridized probe by using Amersham ECL Direct Nucleic Acid Labeling and Detection Systems (GE healthcare).Hybridization was performed at 42°C for 24 h and the filter was washed at room temperature with 2x SSC/0.1%SDS and 1xSSC/0.1%SDS for 10 min each and at 42°C with 0.2x SSC/0.1% SDS for 30 min.DNA markers (λ DNA digested with Hind III) were run on the same gel.
Results and discussion
Standardisation of germination and multiplication protocol
Of different medium with various hormone composition tried for in vitro seed germination and plant multiplication of mesocotyl explants derived from germinated rice seeds. MS medium without any hormone supplement was found to be the best. Mesocotyls from germinated seeds of Basmati 370, Jaya, IR64 and AC41039 when cultured on MS medium with BA and KN alone or in combination, the medium containing 0.5 mg/l BA produced three to five shoots. Among the four varieties tried, Basmati 370 responded comparatively with higher shoot multiplication than other three varieties (Table 1). As use of plain MS and MS with BA supplement proved effective and rewarding in terms of shoot formation in the standardization process, so this medium composition was used for transformation/regeneration in the respective protocol.
Agrobacterium infection and shoot multiplication
Dehusked seeds of the four rice varieties punctured and co-cultivated with the Agrobacterium strain EHA 105 carrying the disarmed Ti plasmid (pBI121) with the selectable marker (npt II ) and the reporter gene (uidA) germinated on co-cultivation medium (CCM) (Table 2 and Fig. 1a) and produced 2 to 3 primary tillers after 1 week of culturing on selection medium (SM) (Fig. 1b). After 2 weeks, the primary tillers were cut leaving the mesocotyls with multiple meristems and placed in the rooting medium. The mesocotyls when raised on the multiplication medium (selection medium with 0.5 mg/l of BA) for its secondary passage resulted again in 2–4 secondary tillers with well developed roots (Table 3 and Fig. 1c). The individual shoots derived from the primary and secondary tillers when cut at the base and grown on the same MS medium for rooting produced 2–3 well developed roots (Fig. 1d). As against many an attempt made earlier to develop efficient transformation protocol in rice through indirect organogenesis, the present finding is the first successful direct method (Tyagi et al. 2007; Rao and Rao 2007).
Effect of acetosyringone, cefotaxime and kanamycin concentration on transformation and regeneration efficiency
In the absence of acetosyringone, in the co-cultivation medium all the four genotypes responded with 100% transformation as they were growing well on the selection medium (Fig. 1a). Nontransformed seeds either failed to germinate or showed rudimentary growth and died in the selection medium.
Use of acetosyringone in co-cultivation possibly accelerated the pace of Agrobacterium growth which was not easy to control with cefotaxime treatment. Acetosyringone is a phenolic compound secreted from wounded tissues of dicotyledons. Monocot species which lack vir inducing compounds though impair Agrobacterium mediated transformation in them. Importance of acetosyringone in Agrobacterium mediated transformation of monocot species has thus seen emphasized by various workers viz in rice (Chan et al. 1993; Hiei et al. 1994), maize (Gould et al. 1991), wheat (Cheng et al. 1997) and sorghum (Pandey et al. 2010).As against the belief that addition of acetosyringone in the transformation and co-cultivation medium is important for to improving Agrobacterium-mediated transformation efficiency, in the present study, without using acetosyringone, 100% transformation frequency could be observed significantly. Only distilled water washing controlled the bacterial growth in the cocultivation medium. Addition of acetosyringone did not show any significant difference in the vector mediated transformation. Its use rather created a problem in controlling the growth of the bacterium during the co-cultivation process. The present findings were in conformity with those of Rao and Rao (2007) who have reported that in the absence of acetosyringone at bacterial pre-induction or co-cultivation or both the stages showed transient expression of transgenes in indica rice.
Use of cefotaxime even at a low concentration of 5 mg/l in CCM medium or its wash before cocultivation for control of bacterial growth was found to cause a severe necrotic and detrimental effect resulting in inhibited regeneration of transformed explants. Instead of cefotaxime only distilled water washing was found to optimize the transformants growth in selection medium.
Use of kanamycin in different concentrations as a selectable marker as well was observed to affect the efficiency of plant transformation. The antibiotic used as 50 mg/l completely blocked regeneration process in untransformed seeds and thus was found useful to select transformed seedlings. This finding is in agreement with those reported of Indian mulberry, (Moruus indica) (Bhatnagar and Khurana 2003) and grasspea, (Lathyrus sativus L.) (Barik et al. 2005).
For all the transformation process as incubation period was 35 min while co-cultivation period 2 to 4 days. For selection of transformed plants 50 mg/l of kanamycin was used in the selection medium (MS with and without BA 0.5 mg/l). As for the differential response of genotypes and multiplication medium as summarized in Tables 2 and 3, Basmati370 to be the best in comparison to other varieties as and MS with 0.5 mg/l BA to be the best medium for multiplication. The mesocotyls with multiple meristems when cultured in MM produced 2–3 secondary tillers with well developed roots (Fig. 1c) within 6 to 8 days and every tiller when cut at the base and when cultured on plain MS medium produced roots (Fig. 1d) after 1 week. Regenerated transformants established well when transferred to plastic cups then to buckets (Fig. 1e).
GUS expression
To confirm the transformation, leaf samples drawn from both primary and secondary tillers, as well as from whole plants were subjected to GUS assay. All the plant parts and leaves drawn from both primary and secondary tiller shoots showed diffused green fluorescent spots appearing as patches or scattered individual spots (Fig. 2a and b) confirming them to be transformed. Use of the widely used GUS assay as a rapid way to detect the presence of uidA gene (GUS) in the putative transformants as described by Jefferson et al.(1987) revealed the Agrobacterium strain EHA105 mediated transformation to be highly efficient irrespective of genotype and to be in agreement with earlier reports (Yi et al. 2001; Jeoung 2001; and Pandey et al. 2010).
Molecular analysis of transgenic plants
Aside GUS assays PCR analysis as well done to confirm the presence and integration of T-DNA revealed all the transformed explants to show amplification at 0.53 kb (Fig. 2c) suggesting integration of GUS gene. The results of PCR analysis were consistent with the X-gluc assay results of the GUS activity, thereby confirming the stable integration of the transgenes into the rice genome. For PCR confirmation npt II primers were used with both positive and negative control. All the putative transgenic plants showed the npt II DNA fragment amplification at 0.8 kb (Fig. 2d and e) and as expected, no npt II PCR product was seen in untransformed control plants.
RT-PCR and Southern blot techniques were employed further to confirm the transgenicity of putative transformants. The techniques used to eliminate Agrobacterium contamination and confirmation through RT-PCR and Southern blot, although successful, they involve more processing time and require various resources (Nain et al. 2005). The present protocol is similar to that of the improved procedure developed by Zou et al. (2008) in trifoliate orange (Poncirus trifoliate L. Raf.) wherein the limitations of southern blot and RT-PCR could be overcome by employing modified protocol for DNA isolation from the transgenic plants that avoids Agrobacterium contamination.
Selection of single-copy endogenous gene for comparison and quantification
To make the transgenics detection more reliable and precise, a reference gene is indispensible. The reference gene should fulfill three requirements viz species specific, low copy number and low heterogeneity among cultivars. Based on the study (Ding et al. 2004; Wang et al. 2010) of single copy the endogenous gene Sucrose Phosphate Synthase (SPS) was selected for quantitative PCR amplification in transformed plants. The amplification curve analysis (Figure ESM_1 in online resource) done with c-DNA isolated of RNA extracted from four varieties exhibited Ct values to vary from 24.29 to 30.45 for SPS with coefficient of variation (CV%) with range of 0.69–2.04 in respect of SPS and from 27.29 to 29.14 with coefficient of variation (CV%) between 0.085 and 0.665 for GUS indicating the copy number of the SPS gene to be similar and without allelic variation in all the test cultivars. The range of variability of Ct values derived from these tests was relatively small suggesting that the quantitative PCR detection system worked stably and reliably.
As evident from the restriction map of T-DNA of pBI121 (Fig. 3a), the restriction digestion with HindIII separates GUS from npt II genes. The DNA from transformed plant after digestion with HindIII hybridized with npt II probe for confirmation by southern blotting, which showed npt II gene to occur in two to three copy numbers (Fig. 3b). The results from RT-PCR analysis confirmed three to four copy number (Table ESM_2 in online resource) suggest some rearrangements in GUS and nptII insertions. The rearrangement perhaps happened during transformation process as explained as due to the possibility that the insertion of two T-DNA copies in an inverted orientation was cut in one fragment and yielded a single hybridization band. In southern blotting, multiple insertion, rearrangements, partial digestion and subjective evaluation of bands on the films are the most important reasons for affecting estimation of copy numbers (Yang et al. 2005). Because the real time PCR TaqMan assay being specific to a small sequence of the gene, rearrangement could be only factor that influence the true result (Mason et al. 2002).
In addition, the exact copy number of transgenes in T0 transformants can be estimated by the real time PCR method. After selfing, the segregation of transgenes in T1 plants and their corresponding number of copies cannot be estimated by traditional southern analysis. However, hemizygotes or homozygotes for the transgene in T1 plants can be identified directly by quantitative analysis method. Thus homozygous transgenic plants obtainable in the T1 generation itself can greatly reduce the time period taken for selecting ideal transgenic plants (Weng et al. 2004).
The transformation protocol developed by us has many advantages. It enables producing 6–8 transformed plants from a single seed explant within 6 weeks (Schematic representation ESM_3 in online resource). The four genotypes representing three major subspecies of rice, used in the present study, showing no significant difference in their tissue culture response suggest that this protocol to be of universal kind and can be used across subspecies and ecotypes for effective transformation. Also it is proved most efficient by ensuring by 100% transformation and regeneration efficiency in addition to being a best method for large scale propagation of transgenic plants.
For effective transfer of alien gene(s) of interest by rDNA technology, efficient transformation and regeneration protocols are the prerequisites. Efficiency of transformation depends on many factors which primarily include type of explant, composition of culture medium and genotype. As of now, many efficient Agrobacterium mediated protocols have been developed for a monocot like rice. Experience shows that response to transformation—regeneration is subspecies and variety specific. Whereas japonicas are reported to be more responsive as compared to indicas, within subspecies only variety like Taipai 309 in japonica (Visarada and Sarma 2002) and Pusa Basmati and IR64 in indica relatively are more responsive (Hussain et al. 2010), though in general, transformation efficiency is low in rice. This technological constraint makes genetic engineering research relatively more difficult unlike in other crop species. Also, the need to develop variety specific protocols makes rDNA technology all the more difficult. Thus the need for Agrobacterium protocols applicable across varieties within and between subspecies has been felt since long. Generally, for realizing high response in rice tissue culture, immature embryos are used as explants to induce embryogenic calli for transformation. Preparation of high number of immature embryos is not only quite laborious and also their availability is season bound. Hence, the present effort has been to identify right explants and develop efficient protocols that can be used universally across the subspecies and varieties within. Whereas mature seeds identified as best explants for development of improved transformation-mediated regeneration protocols for efficient gene transfer, usable across a variety of genotypes through in vitro clonal propagation/shoot bud multiplication from mesocotyls avoiding the widely depended on callus—embryogenic route in transgenic research.
Abbreviations
- CTAB:
-
Hexadecyl-trimethyl-ammonium bromide
- q-PCR:
-
Quantitative PCR
- T-DNA:
-
Transfer DNA
- CT or Ct:
-
Threshold cycle
- RQ:
-
Relative quantification
References
Barik DP, Mohapatra U, Chand PK (2005) Trangenic grasspea (Lathyrus sativus L.):factors influencing Agrobacterium-mediated transformation and regeneration. Plant Cell Rep 24(9):523–531
Bhatnagar S, Khurana P (2003) Agrobacterium tumefaciens—mediated transformation of Indian Mulberry, Morus indica cv.K2: a time-phased screening strategy. Plant Cell Rep 21(7):669–675
Chan MT, Chang HH, Ho SL, Tong WF, Yu SM (1993) Agrobacterium-mediated production of transgenic rice plants expressing a chimeric alpha-amylase promoter/ß-glucuronidase gene. Plant Mol Biol 22:491–506
Cheng M, Fry JE, Pang SZ, Zhou HP, Hironaka CM, Duncan DR, Conner W, Wan YC (1997) Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant Physiol 115:971–980
Cheng YJ, Guo WW, Yi HL, Pang XM, Deng XX (2003) An efficient protocol for genomic DNA extraction from citrus species. Plant Mol Biol Rep 21:177–177
Ding J, Jia J, Yang L, Wen H, Zhang C, Liu W, Zhang D (2004) Validation of a Rice Specific Gene, Sucrose Phosphate Synthase, Used as the Endogenous Reference Gene for Qualitative and Real-Time Quantitative PCR Detection of Transgenes. J Agric Food Chem 52(11):3372–3377
Duncan DB (1955) Multiple range and multiple F tests. Biometrics 11:1–42
Ge X, Chu Z, Lin Y, Wang S (2006) A tissue culture system for different germplasms of indica rice. Plant Cell Rep 25:392–402
Gould J, Devery M, Hasegawa O, Ulian EC, Peterson G, Smith RH (1991) Transformation of Zea mays L. using Agrobacterium tumefaciens and the shoot apex. Plant Physiol 95:426–434
Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271–282
Hussain Z, Khan M, Bano R, Rashid H, Chaudhry Z (2010) Protocol optimization for efficient callus induction and regeneration in three Pakistani rice cultivars. Pak J Bot 42(2):879–887
Jefferson RA, Kavanagh TA, Bevan MW (1987) EMBO J 6:3901–3907
Jeoung JM (2001) Agrobacterium-mediated gene transformation of grain sorghum. Ph.D. dissertation. Kansas State University, Manhattan, KS 66506, USA
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408
Mason G, Provero P, Vaira AM, Accotto GP (2002) Estimating the number of integrations in transformed plants by quantitative real-time PCR. BMC Biotechnol 2:20
Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol Plant 15:473–497
Nain V, Jaiswal R, Dalal M, Ramesh B, Kumar PA (2005) Polymerase Chain Reaction Analysis of Transgenic Plants Contaminated by Agrobacterium. Plant Mol Bio Report 23:59–65
Nishimura A, Aichi I, Matsuoka M (2007) A protocol for Agrobacterium-mediated transformation in rice. Nat Protoc 1(6):2796–2802
Pandey AK, Bhat BV, Balkrishna D, Seetharama N (2010) Genetic Transformation of Sorghum(Sorghum bicolar(L.)Moench). Int J Biotechnol Biochem 6(1):45–53
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acid Res 29:2002–2007
Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST(C)) for group-wise comparison and statistical analysis of relative expression results in Real-time PCR. Nucl Acid Res 30:e36
Rao MVR, Rao GJN (2007) Agrobacterium mediated transformation of indica rice under Acetosyringone-free conditions. Plant Biotechnol 24:507–511
Rashid H, Abbasi FM, Quraishi A (2003) Plant Regeneration from Seed Derived Callus of three varieties of Basmati Rice. Plant Tissue Cult 13(1):75–79
Rueb SM, Leneman RA, Schilproort HLAM (1994) Efficient plant regeneration through embryogenesis from callus induced on mature rice embryos (Oryza sativaL.). Plant Cell Tissue and Organ Cult 36:259–264
Tyagi H, Rajsubramaniam S, Dasgupta I (2007) Regeneration and Agrobacterium—mediated transformation of a popular indica rice variety, ADT39. Curr Sci 93(5):678–673
Visarada KBRS, Sarma NP (2002) Qualitative assessment of tissue culture parameters useful intransformation of indica rice. Curr Sci 82(3):343–347
Wang C, Jiang L, RaoJ LY, Yang L, Zhang D (2010) Evaluation of Four Genes in Rice for Their Suitability As Endogenous Reference Standards in Quantitative PCR. J Agric Food Chem 58:11543–11547
Weng H, Pan A, Yang L, Zhang C, Liu Z, Zhang D (2004) Estimating Number of Transgenic Copies in Transgenic Rapeseed by Real-Time PCR Assay With HMG I/Y as an Endogenous Reference Gene. Plant Mol Biol Rep 22:289–300
Yang L, Ding J, Zhang C, Jia J, Weng H, Liu W, Zang D (2005) Estimating the Copy number of transgenes in transformed rice by real-time quantitative PCR. Plant Cell Rep 23:759–763
Yi SL, Cao SY, Wang L, Chu CC, Li X, He SJ, Tang ZS, Zhou PH, Tian WZ (2001) Improvement of transformation frequency of rice mediated Agrobacterium transformation (in Chinese). Yi Chuan Xue Bao 28:352
Yuan JS, Reed A, Chen F, Stewart CN Jr (2006) Statistical analysis of real-time PCR data. BMC Bioinforma 7:85
Zou X, Li D, Luo X, Luo K, Pei Y (2008) An improved procedure for Agrobacterium-mediated transformation of trifoliate orange (Poncirus trifoliate L. Raf.) via indirect organogenesis. In Vitro Cell Dev Biol-Plant 44:169–177
Author information
Authors and Affiliations
Corresponding author
Electronic supplementary material
Below is the link to the electronic supplementary material.
ESM 1
(DOCX 496 kb)
Rights and permissions
About this article
Cite this article
Puhan, P., Vipparla, A., Vemireddy, L.R. et al. An efficient and universal Agrobacterium-mediated transformation protocol in rice. J. Plant Biochem. Biotechnol. 21, 252–260 (2012). https://doi.org/10.1007/s13562-011-0101-2
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s13562-011-0101-2