Introduction

Gallbladder cancer (GBC) still has a poor prognosis with 5-year overall survival rates at less than 15 % [1, 2]. The complete surgical resection at the early stage is the most effective therapy to cure this disease. However, many GBC patients initially present with unresectable tumors, because there are no typical symptoms or signs at the early stages. Thus, the clinical outcome of GBC patients remains poor [3, 4]. The commonly reported prognostic factors including pathologic stages are insufficient to predict either the clinical course or the biological behavior of GBC. Therefore, investigation of new prognostic biomarkers is needed to predict the biological behavior of GBC.

The human stomatin-like protein 2 (SLP-2) gene was first cloned and reported by Wang and Morrow [5], and it is a novel and unusual member of the stomatin gene superfamily. Recently, the overexpression of SLP-2 has also been identified in several types of cancer, including esophageal squamous cell carcinoma, gastric cancer, breast cancer, endometrial adenocarcinoma, laryngeal squamous cell carcinoma (LSCC), pulmonary squamous cell carcinoma (PSCC), and glioma [6–14]. In addition, overexpression of SLP-2 protein has now been strongly linked to poor prognosis in cancer, such as gastric cancer [8], breast cancer [10], LSCC [12], and PSCC [12]. However, no information is available regarding SLP-2 expression in human GBC. To explore the vital role of SLP-2 in the tumorigenesis and progression of GBC, we examined expression patterns of SLP-2 in GBC tissues, analyzed the relationship between SLP-2 expression and clinicopathological factors of GBC.

Materials and Methods

Patients and specimens

The study was approved by the Research Ethics Committee of the Affiliated Jiangyin People's Hospital of Southeast University Medical College and the Affiliated People's Hospital of Jiangsu University, China. Informed consent was obtained from all of the patients. All specimens were handled and made anonymous according to the ethical and legal standards.

Archived and paraffin-embedded samples were obtained from 74 patients with a diagnosis of GBC who underwent surgical resection between January 2003 and January 2007 in Jiangyin People's Hospital and the Affiliated People's Hospital of Jiangsu University. Clinical information on these samples is described in Table 1. None of the patients had received radiotherapy or chemotherapy prior to surgery. Complete clinical data were electronically recorded. All tumor tissues were classified according to the World Health Organization classification guidelines. In addition, 18 self-pairs of GBC specimens and adjacent noncancerous tissues were snap frozen in liquid nitrogen and stored at −80 °C following surgery for real-time quantitative polymerase chain reaction (qRT-PCR) analysis.

Table 1 Relationship between clinicopathological features and SLP-2 expression in patients with GBC
Full size table

Real-time quantitative polymerase chain reaction

Total RNA was isolated by TRIzol extraction liquid (Invitrogen, Carlsbad, CA, USA). Total RNA (2 μg) was reverse transcribed by cDNA Reverse Transcription Kits (Invitrogen) according to the manufacturer's instructions. Primers were designed and synthesized by Sangon Biological Engineering Technology and Services (Shanghai, China). The primers for SLP-2 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were designed as follows: SLP-2 primer, forward 5′- GTGACTCTCGACAATGTAAC-3′, reverse 5′- TGATCTCATAACGGAGGCAG-3′; GAPDH primer, forward 5′- TGAAGGTCGGAGTCAACGG -3′, reverse 5′- CTGGAAGATGGTGATGGGATT -3′. qRT-PCR was performed with SYBR Green PCR Master Mix according to the manufacturer's instructions by using the CFX96 sequence detection system (Bio-Rad, Hercules, CA, USA) and accompanying analytical software. The reaction was first denatured at 95 °C for 10 min, then 40 cycles at 95 °C for 10 s, 60 °C for 20 s, and followed by 72 °C for 10 s. Each reaction was performed in triplicate, and the mean SLP-2 mRNA level for each tumor was compared with its matched noncancerous tissue. The expression level of SLP-2 was expressed as 2−ΔΔCt, where ΔCt = Ct (SLP-2) − Ct (GAPDH).

Immunohistochemistry

All specimens were fixed with 4 % formaldehyde, dewaxed, embedded, and cut into 4-μm serial sections. Briefly, antigen retrieval was carried out in 10 mmol/l citrate buffer (pH 6.0) for 15 min at 100 °C in a microwave oven. Endogenous peroxidase activity was blocked with 3 % hydrogen peroxide for 10 min at room temperature. The sections were then incubated overnight at 4 °C with anti-SLP-2 antibody (Santa Cruz Biotechnology). After washing with PBS, sections were incubated with secondary antibodies for 30 min at 37 °C. The sections were then washed three times with PBS and treated with 3,3′-diaminobenzedine for approximately 5 min. Finally, the sections were counterstained with hematoxylin, dehydrated, mounted, and examined by light microscopy. Negative controls were probed with PBS under the same experimental conditions. Immunohistochemical staining was assessed by two independent experienced pathologists who were blinded to all clinicopathological features. Each sample was assigned by the extent of immunoreactivity to one of the following categories: 0, 0 %; 1, <25 %; 2, 25–50 %; 3, 51–75 %; or 4, >75 %. Staining intensity was categorized as 0, negative; 1, weak; 2, moderate; and 3, strong. For each case, the immunostaining score, also known as the staining index (SI), was calculated by multiplying the percentage of positive cells with the staining intensity score, yielding a value between 0 and 12. For this study, an optimal cutoff value was identified as follows: an SI score of 8 or higher was used to define tumors with high SLP-2 protein expression, and an SI score of less than 8 was used to indicate low SLP-2 expression [12].

Statistical analysis

A chi-square test was used to determine the association between SLP-2 expression and clinicopathological parameters. Kaplan–Meier analysis and log-rank tests were used to assess the survival rate, and to compare differences in survival curves. Cox regression analysis was performed to assess the significance of multiple predictors of survival. Differences were considered significant at P <0.05.

Results

SLP-2 mRNA and protein expression in GBC tissues and adjacent noncancerous tissues

To elucidate the role of SLP-2 in the initiation and progression of GBC, we first analyzed SLP-2 mRNA expression in 18 pairs of GBC and adjacent noncancerous tissues using qRT-PCR. We found that 15 of the 18 patients (83.3 %) had higher SLP-2 mRNA expression in GBC tissues than in adjacent noncancerous tissues. In addition, the relative expression of SLP-2 mRNA in GBC tissues was significantly higher than in the adjacent noncancerous tissues (2.35 ± 0.87 vs. 1.18 ± 0.53, P <0.001; Fig. 1). The expression of SLP-2 protein in archived GBC tissues and adjacent noncancerous tissues was analyzed by immunohistochemistry (Fig. 2). According to the SLP-2 immunoreactive intensity, we observed that 58.1 % (43/74) of the GBC samples showed high SLP-2 expression. In comparison, the rate of high SLP-2 protein expression was 12.2 % (9/74) in noncancerous epithelial cells. The protein expression level of SLP-2 was markedly higher in GBC tissues than the level in adjacent noncancerous tissues (P <0.001).

Fig. 1
figure 1

Relative expression of SLP-2 mRNA in GBC tissues compared to noncancerous tissues. The gene expression of SLP-2 in GBC tissues was significantly higher (2.35 ± 0.87) than in noncancerous tissues (1.18 ± 0.53; P <0.001)

Full size image
Fig. 2
figure 2

Immunohistochemical analysis of SLP-2 in GBC samples and adjacent noncancerous tissues. a Strong staining of SLP-2 in GBC tissues. b Weak staining of SLP-2 in adjacent noncancerous tissues. c Representative negative staining of SLP-2 in adjacent noncancerous tissues

Full size image

Correlations between SLP-2 expression and clinicopathological variables

Immunohistochemistry showed that SLP-2 expression in tumor tissues was not significantly associated with gender, age, and tumor size (Table 1). However, elevated SLP-2 expression was strongly correlated with histological grade (P <0.001), pathologic T stage (P = 0.019), clinical stage (P = 0.001), and lymph node metastasis (P = 0.026) (Table 1).

Influence of the SLP-2 expression on survival

The prognostic value of SLP-2 for overall survival in GBC patients was evaluated by comparing the patients with high and low SLP-2 expression. According to the Kaplan–Meier survival analysis, the 5-year overall survival rate was significantly lower in patients with high SLP-2 expression than in those with low SLP-2 expression (Fig. 3, P <0.001).

Fig. 3
figure 3

Kaplan–Meier survival curve and log-rank test analysis showing the association between SLP-2 expression and GBC patient survival

Full size image

Univariate Cox regression analysis also showed that clinical variables, including histological grade, pathologic T stage, clinical stage, lymph node metastasis, and SLP-2 expression significantly associated with overall survival (Table 2). Furthermore, multivariate Cox regression analyses were performed to evaluate the potential of SLP-2 expression as an independent predictor for the overall survival of patients with GBC. Although other parameters failed to demonstrate independence, histological grade, pathologic T stage, clinical stage, lymph node metastasis, and SLP-2 expression may play a role in predicting overall survival in patients with GBC (Table 2).

Table 2 Univariate and multivariate analyses showing the overall survival rate for patients with GBC
Full size table

Discussion

GBC is a relatively uncommon neoplasm in the majority of countries and its incidence rate shows marked geographic and ethnic variation. GBC is a highly lethal disease since it is usually diagnosed at an advanced stage [15]. The 5-year survival rate of patients with GBC is poor despite surgical resection [16, 17]. Moreover, the majority of patients have frequent recurrences following surgery and unsatisfactory results following chemotherapy or radiotherapy [18]. Several prognostic models have been designed to identify patients with a high risk of disease progression following cholecystectomy, and features such as grade, depth of wall infiltration and lymph node metastasis have been determined to be classic clinicopathological prognostic factors. However, the majority of these molecular and genetic factors are not markedly associated with GBC. Therefore, it would be useful to identify new molecular markers that may be associated with prognosis and used as therapeutic targets.

SLP-2 is a member of the stomatin gene superfamily. Previous studies suggested that SLP-2 could be regarded as a novel cancer-related gene [5]. Aberrant expression of SLP-2 has been found in various malignancies [6–14]. Moreover, some recent evidences demonstrated that SLP-2 may be associated with the character of cancer progression including invasion and metastasis [10, 12, 19]. Furthermore, high expression of SLP-2 protein was associated with significantly decreased cancer patient survival, including gastric cancer [8], breast cancer [10], LSCC [12], and PSCC [12]. It seems that SLP-2 overexpression is a very common event in many kinds of cancer development, and SLP-2 expression may be a new valuable prognostic biomarker.

To explore the vital role of SLP-2 in the tumorigenesis and progression of GBC, we examined expression patterns of SLP-2 in GBC tissues, analyzed the relationship between SLP-2 expression and clinicopathological factors of GBC. In the present study, the overexpression of SLP-2 mRNA and protein in GBC was verified by real-time quantitative RT-PCR and immunohistochemistry analysis, respectively. The expression levels of SLP-2, mRNA, and protein in GBC tissues were both significantly higher than those in adjacent noncancerous tissues. It suggested that SLP-2 might play a role in the tumorigenesis of GBC. To investigate whether SLP-2 can accurately predict the outcome in patients with GBC, IHC was performed in 74 archived paraffin-embedded GBC samples. Interestingly, the expression of SLP-2 in GBC was closely correlated with histological grade (P <0.001), pathologic T stage (P = 0.019), clinical stage (P = 0.001), and lymph node metastasis (P = 0.026). Furthermore, Kaplan–Meier survival analysis showed that a high expression level of SLP-2 resulted in a significantly poor prognosis of GBC patients. Multivariate analysis revealed that SLP-2 expression level was an independent prognostic parameter for the overall survival rate of GBC patients.

In conclusion, our data suggest for the first time that SLP-2 overexpression is associated with advanced tumor progression and poor clinical outcome of GBC patients. SLP-2 might be a novel prognostic marker of GBC.