Indo-Pacific lionfishes (Scorpaenidae) are popular aquarium fish, and well known for their ornate beauty and venomous spines. Two species of the lionfish, Pterois volitans and Pterois miles, have invaded the Western Atlantic (Whitfield et al. 2002; Freshwater et al. 2009a; Morris 2012), and are a concern to coastal managers because of their threat to fisheries resources, native fish communities, and human health (Morris and Akins 2009; Morris and Whitfield 2009). The invasive range of lionfish has expanded annually (Schofield 2010) and it is likely that it will ultimately include the entire Caribbean, Gulf of Mexico, and subtropical western Atlantic (Ahrenholz and Morris 2010; Morris and Whitfield 2009).

Mitochondrial DNA sequence analyses of lionfish revealed that both P. volitans and P. miles haplotypes are present in the Atlantic with reduced haplotype diversity compared to their native ranges, and some population structuring related to range expansion and connectivity within the Caribbean (Hamner et al. 2007; Freshwater et al. 2009a, b; Betancur et al. 2011). Highly polymorphic nuclear markers are needed to further analyze genetic diversity and population connectivity among sites in the western Atlantic. To this end, next-generation sequencing techniques were used to identify 18 polymorphic microsatellite markers from lionfish collected off the coast of North Carolina.

Genomic DNA was extracted from ethanol preserved gill tissues using the Wizard SV Genomic DNA Purification System (Promega). Non-enriched genomic DNA was subjected to next-generation sequencing on a Roche 454 GS-FLX instrument (Roche) at the Duke University Institute for Genomic Science and Policy Genome Sequencing Facility. A total of 105,334 sequence reads were generated, 69,003 were >300 bp in length and were screened for repetitive elements using Msatcommander (Faircloth 2008). A total of 5,737 repetitive sequences were found and flanking primers designed with Primer3 software (Rozen and Skaletsky 2000). Tetrameric repeats (>6) with sufficient flanking sequence information for primer design were given priority.

Table 1 Polymorphic microsatellite loci from Pterois volitans and Pterois miles
Full size table

Genomic DNA was amplified in 20 μl polymerase chain reactions (PCRs) as follows: 2 μl DNA, 2 μl 10× PCR Buffer (200 mM Tris, pH 8.8; 500 mM KCL; 0.1 % Triton X-100, 0.2 mg/ml BSA), 1.6 μl 25 mM MgCl2, 1.6 μl 2.5 mM dNTP’s, 0.2 μl 10 μM Forward primer, 0.8 μl 10 μM Reverse primer, 0.8 μl 10 μM labeled (FAM, NED, PET, or VIC) T3 primer (Eurofins; Applied Biosystems), and 0.2 μl Taq DNA polymerase. PCR products were indirectly labeled using Forward primers with 5′-T3 tags (ATTAACCCTCACTAAAGGGA; not shown in Table 1) and fluorescently labeled T3 primers. Reactions were run under the following conditions: 94 °C 4 min; 25 cycles of 94 °C 15 s, 62 °C 15 s, 72 °C 30 s; 8 cycles of 94 °C 15 s, 53 °C 15 s, and 72 °C 30 s; final extension at 72 °C for 5 min. All amplifications were performed using a single standard condition.

PCR products were diluted 1:3 and 2 μl mixed with 0.05 μl DNA Orange (MCLab), 0.05 μl 10 mg/ml salmon sperm DNA, and 8.95 μl water, denatured at 95 °C for 10 min, and chilled on ice. Size-fragment analysis was conducted on an ABI 3730xl DNA Analyzer (Applied Biosystems), and chromatograms scored using Genemarker v1.8 (SoftGenetics). Deviations from Hardy–Weinberg Equilibrium were calculated using Arlequin v3.2 (Excoffier and Lischer 2010). Heterozygote excess, heterozygote deficiency and linkage disequilibrium were tested with Genepop version 4.0.10 (Rousset 2008) and corrected for multiple comparisons using the sequential Bonferroni approach (Rice 1989). Presence of null alleles, stutter, and large allele dropout were assessed using MicroChecker (1,000 randomizations: Van Oosterhout et al. 2004).

Forty-eight primer pairs were screened for robust amplification using DNA from four individual lionfish samples representing both P. volitans and P. miles haplotypes. Primers showing strong polymorphic products were then used to amplify DNAs from another 74 individuals from multiple locations (North Carolina, Bahamas, and Florida). Results from 18 loci scored on a minimum of 35 individuals are presented in Table 1. The number of alleles ranged from 2 to 20 with a mean of 7.1 alleles per locus. The allele frequencies of all 18 loci conformed to Hardy–Weinberg expectations after correcting for multiple comparisons using the sequential Bonferroni method (k = 18; Rice 1989). MicroChecker indicated the presence of null alleles at three loci (Pvm4, Pvm14, and Pvm37), while no loci showed evidence of scoring errors due to stuttering or large allele dropout. Arlequin detected evidence for linkage disequilibrium in pairwise comparisons among loci in both P. volitans (22) and P. miles (28) populations.

The lionfish invasion provides an excellent, albeit unfortunate, natural experiment of population connectivity within the tropical and subtropical western Atlantic. Betancur et al. (2011) used mitochondrial haplotype analysis and the chronological progression of the invasion to test hypotheses of connectivity and breaks within the Caribbean. The resolving power of these haplotype data however are limited, especially for the invasive lionfish where strong initial and secondary founder effects are present (Hamner et al. 2007; Freshwater et al. 2009b; Betancur et al. 2011). These microsatellite markers will provide much greater resolution for exploring the invasion’s expansion and connectivity among marine organisms.