The Water monitor (Varanus salvator) can attain a length of three meters and is a large species of monitor lizard (Taylor 1963). As one of the most common monitor lizards, Water monitors are widely distributed through Asia. They inhabit in tropical rain forest, mangrove forest and freshwater swamp areas (Erdelen 1991). However, its wild population has declined rapidly because of excess hunting and habitat destruction (Komsorn and Kumthorn 2001). Their skins and meat are used for dietary protein, medicine, and leather goods (Gaulke 1992). It is both the largest lizard in the leather trade, and the most heavily exploited species (Shine et al. 1996). In order to conserve and improve this endangered monitor salvator, it is urgent for researchers to study its genetic structure. This study reports twelve polymorphic microsatellite loci isolated from V. salvator, which should be useful tool for further study.

A microsatellite-enriched partial genomic library was constructed following the procedure described by Yu et al. (2010). The genomic DNA was extracted from a small tail cut piece of one individual, using the DNeasy Tissue Kits (Qiagen). Extracted DNA was digested with restriction enzyme Sau 3AI (TaKaRa) for 3–4 h, and the fragments of 400–900 bp were excised from agarose gel and purified using DNA purification kit (Takara). The selected fragments were ligated to a blunt-end adapter (SAULA: GCGGTACCCGGGAAGCTTGG, SAULB: GATCCCAAGCTTCCCGGGTACCGC) with T4 DNA ligase (Takara). Ligation mixture was incubated at 16°C for 16 h, and the ligation products were amplified by polymerase chain reaction using the adapter SAULA as primers. Amplified fragments were denatured and hybridized with biotin-labeled probes dinucleotide repeats (CA)12 GCTTGA-Biotin and (GA)12 GCTTGA-Biotin. The hybridization mixture was incubated with VECTREX Avidin D (Vector Laboratories) at 37°C for 30 min and washed with TBS (100 mMTris, 150 mMNaCl, pH 7.5) for four times at different temperatures (50, 50, 68, 68°C) to remove unbound fragments. The bound fragments were eluted with 80 μl ddH2O at 95°C for 10 min, and amplified by PCR. Fragments ranging from 400 to 900 bp were excised from agarose gel and recovered, and then were ligated with pMD19-T vector (Takara) and transformed to E. coli DH5a competent cells (Takara). Recombinant clones were detected using blue/white screening. White clones were screened by PCR, PCR products were checked on 1.5% agarose gels, and clones that generated two or more bands were selected.

Sixty positive clones were identified from 120 recombinant colonies via PCR with linker primers and M13 universal primers (Takara), 50 sequences contained microsatellite repeats, of which 40 possess sufficient flanking sequence appropriate for primer design. Thirty pairs of primers were designed using Primer 5.0 program (PREMIER Biosoft International, Silicon Valley, USA). All the microsatellite loci developed here were evaluated on other 30 wild samples for subsequent evaluation.

All 30 specimens of V. salvator were collected from Guangzhou Forest Police Bureau in Guangzhou, China. Following DNA extracted with the Dneasy Tissue Kit (Qiagen), polymerase chain reaction (PCR) was carried out in 10 μl reactions containing 1 μl of DNA, 0.2 μl of each 10 μM primer, 5 μl of the Ex premix Taq polymerase (Takara) and 3.6 μl of water for a total volume of 10 μl. The PCR conditions for amplification were as follows: denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, a primer-specific annealing temperature for 30 s and 72°C for 40 s, with a final extension at 72°C for 10 min. The PCR products were checked by electrophoresis on 8% non-denaturing polyacrylamide gel and visualized with silver staining. In the study, 16 microsatellite loci amplified clear and specific products consistently.

Allele size was determined with software Gel-Pro Analyzer 4.5. Number of alleles, heterozygosity, test of Hardy–Weinberg expectations (HWE) of genotype frequencies and linkage disequilibrium (LD) between loci were analyzed using GENEPOP 3.4 (Raymond and Rousset 1995). Conditions and characteristics of the 16 loci were shown by Table 1. Sequences of these loci have been deposited with GenBank under accession nos. HQ896216–HQ896237.

Table 1 Isolation and characterization of polymorphic microsatellite loci from the Water monitor (Varanus salvator)
Full size table

Four of the 16 loci that amplified were monomorphic; 12 loci were polymorphic among them. The number of alleles per polymorphic locus varied from 2 to15, with the average of 6.000. The observed and expected heterozygosity values ranged from 0.2333 to 0.9000 and 0.2096 to 0.9203, respectively. Only 1 of these 12 loci (YBJX28) significantly deviated from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.01). In contrast, no significant linkage disequilibrium was detected.

These 12 polymorphic microsatellite loci reported here will be useful in population genetics, conservation and other relevant studies of V. salvator.