Introduction

Articular cartilage absorbs an enormous mechanical load and allow almost frictionless motion between the articulating surfaces of diarthrodial joins (Marmotti et al. 2015; Scotece and Mobasheri 2015). However, cartilage tissue has very limited self-healing capacity for lack of vascular. Recently, various approaches applied in clinical practice, such as surgical interventions, have led to some positive results (Getgood et al. 2009; Hunziker 2002). But it is still unsatisfactory for its surgical injury to normal articular cartilage. Mesenchymal stem cells (MSCs), which are multipotent stromal cells that can differentiate into a variety of cell types, have been reported to be an attractive option for potentiating cartilage repair (Ham et al. 2015; Petrella et al. 2015; Trounson and McDonald 2015). MSCs can be isolated from various sources, such as umbilical cord, blood, bone marrow, adipose tissue, synovium, and other tissues (Friedenstein et al. 1968; Katz et al. 2005; Kern et al. 2006; Tepliashin et al. 2005; Wang et al. 2015). Recently, Synovium-derived (SMSCs) have been recognized as an excellent source, owing to their superior chondrogenic potential (Fan et al. 2009). SMSCs could be isolated from normal or pathological synovium and successfully proliferate (Trounson and McDonald 2015; Wu et al. 2013). In addition, synovial tissue is conveniently accessible for the acquisition of autologous SMSCs via undergoing an ordinary examination (De Bari et al. 2003).

SRY-related HMG-box (Sox) family plays an important role in proliferation and differentiation of MSCs (Liu and Lefebvre 2015; Sun et al. 2015). Sox4 is a member of the Sox family with a critical role in embryonic development and cell-fate determination during organogenesis and differentiation (Jafarnejad et al. 2013; Parvani and Schiemann 2013). Increased Sox4 activity contributes to cellular transformation. For example, Sox4 directly modulates key cellular regulators, including epidermal growth factor receptor (EGFR), heat shock protein 70 (Hsp70), frizzled homolog 5 (Fzd5), Delta-like 1 (Dll1), and Patched-1 (Ptch1) and the transcriptional regulators Foxa1 (Scharer et al. 2009). However, the role of Sox4 in human SMSCs remains elusive. Here, we demonstrated a pivotal role of Sox4 in chondrogenic differentiation and proliferation of human SMSCs by directly regulating the expression of long noncoding RNA DANCR (anti-differentiation noncoding RNA). DANCR was fist identified in hepatocellular carcinoma (HCC) (Yuan et al. 2015). DANCR is overexpressed in stem-like HCC cells and markedly increased stemness features to promote tumorigenesis. In addition, the function of DANCR relies largely on regulation of β-catenin transcription (Yuan et al. 2015). However, whether DANCR contribute to the differentiation and proliferation of human synovium-derived stem cells is still unknown.

Materials and methods

Isolation and culture of SMSCs

SMSCs were obtained from the synovium of osteoarthritis patients. SMSCs were isolated following a standardized procedure (De Bari et al. 2001). Briefly, Synovial tissue was digested in 0.2 % collagenase (Sigma) at 37 °C for 1 h. Single cell suspensions were centrifuged and resuspended in high glucose DMEM supplemented with 10 % fetal bovine serum (FBS) (Gibco), and then plated onto a culture dish.

Sox4 overexpression in human SMSCs

Full-length human Sox4 and DANCR cDNA was cloned from normal human tissue RNA pools by RT-PCR. Full-length Sox4 or DANCR cDNA was inserted into pcDNA3.1 mammalian expression vector. Stable cells were established by hygromycin selection.

RNAi-mediated knock down of DANCR

SiRNA sequences directed against DANCR were designed and synthesized by the Shanghai Genechem Company, China. The sequence was: CTACAGGCACAAGCCATTG. For transfection, siRNA or control in Lipofectamine™2000 (Invitrogen) was transfected into cells according to manufacturer’s instructions.

RNA isolation and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted using TRIzol Reagent (Invitrogen) and reverse-transcribed using a PrimeScript 1st Strand cDNA Synthesis Kit (Takara) according to the manufacturer’s instructions. cDNA was quantified by qRT-PCR using an ABI 7500 System (Applied Biosystems). PCR was performed using SYBR Green reagents (Takara) according to the manufacturer’s instructions. GAPDH was used as an internal control. Primers used for qRT-RCR are listed followed: Sox4: F: CCAAATCTTTTGGGGACTTTT, R: CTGGCCCCTCAACTCCTC; DANCR: F: GCGCCACTATGTAGCGGGTT, R: TCAATGGCTTGTGCCTGTAGTT; GAPDH F: GGTCTCCTCTGACTTCAACA, R: GTGAGGGTCTCTCTCTTCCT; Col2: F: CTGTGACTGTAGTTCCCGTTTAT, R: GAGGCTGTTAGGTGTAGGATTG; AGC1: F: GTTGCAGTGAGCCGAGATTA, R: CTCTGGGAGAGAATTGGACTTG; Sox9: GCAGCGAAATCAACGAGAAAC, TCCAAACAGGCAGAGAGATTTAG.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was performed using the EZ ChIP™ Chromatin Immunoprecipitation Kit (Millipore), according to its manual. Briefly, crosslinked chromatin was sonicated into 200–1000 bp fragments. The chromatin was immunoprecipitated using anti-Sox4 (Abcam) antibody. Normal mouse immunoglobulin G (IgG) was used as a negative control. qRT-PCR was conducted using SYBR Green Mix (Takara). Primers are listed followed: F: TACTGCATGAGCCACACCTA, R: AGCCAATCCCGGGAAGAT.

In vitro differentiation assay

Empty-vector-transfected or Sox4-transfected SMSCs were cultured to obtain adequate cells for 25 days. After expansion, these cells were trypsinized and seeded at 5 × 106 cells/mL in 15-mL polypropylene tubes. The cells were centrifuged for 10 min at 2000 rpm for use in an aggregate culture system. The cell aggregates were prepared and cultured in chondrogenesis medium that consisted of insulin-transferrin-selenium premix (Gibco BRL), 50 mM ascorbate-2-phosphate (Sigma) and 100 nM dexamethasone (Sigma) at 37 °C. The aggregates formed into a free-floating mass within the first 24 h of culture. The medium was replaced every 3 days for 14 days. The volumes were calculated by the formula \( {\text{V}} = \raise.5ex\hbox{$\scriptstyle 1$}\kern-.1em/ \kern-.15em\lower.25ex\hbox{$\scriptstyle 2$} \, \left( {{\text{L }} \times {\text{W}}^{2} } \right) \), where L is the length (longest dimension) and W is the width (shortest dimension).

Histology

Aggregates were fixed in 10 % paraformaldehyde and embedded in paraffin and cut into 5-μm sections. Sections were stained with toluidine blue and Safranin-O stain according to routine protocols. Samples were examined via light microscopy (Leica).

Viability assay

The cells were seeded at a density of 3 × 103 cells per well in 96-well plates. Cell proliferation was determined by the Cell Counting Kit-8 (CCK-8) assay. Each well was incubated with WST-8 solution (Vazyme) for 3 h, and the absorbance of each well was measured at 450 nm using a spectrophotometer.

Measurement of glycosaminoglycans (GAG) content

The GAG content was measured as previously described (Kim et al. 2014).

Statistical analysis

All data are presented as the mean ± SD. Comparisons of two groups were performed by Student’s t test. Differences were considered statistically significant at p < 0.05. All data were analyzed using the SPSS software.

Results

Overexpression of Sox4 enhances cell proliferation

To investigate the immunophenotype change of Sox4-overexpressed SMSCs, we characterized MSC specific markers via qRT-PCR analysis. The results revealed that the surface marker genes expression (CD14−,CD19−, CD73+, CD90+, CD105+) of MSCs were not significantly different whether they were transfected with or without Sox4 (Fig. 1a). To characterize the influence of Sox4 overexpression on SMSCs viability, we measured cell viability using a CCK-8 assay. The CCK-8 assay revealed that cell numbers were not significantly different by day 3. However, cell viability of Sox4-overexpressed SMSCs gradually increased from day 4 to day 7 compared to control group (Fig. 1b). Therefore, Sox4 overexpression enhances SMSCs proliferation.

Fig. 1
figure 1

Overexpression of Sox4 enhances SMSCs proliferation. a For each group, the MSC-specific marker genes were determined by Real-time PCR. mRNA expression levels were normalized to GAPDH. b Cell viability was estimated at 1, 2, 3, 4, 5, 6 and 7 days after Sox4 transfection using the CCK-8 assay. Data are shown as mean ± SD; n = 3. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test)

Full size image

Sox4 promotes chondrogenic differentiation of SMSCs

To investigate the chondrogenic potential of Sox4-transfected SMSCs, we used the aggregate culture system. After Sox4 transfection for 14 days, aggregates of all groups were subjected to histological examination by toluidine blue (matrix proteoglycans) and Safranin-O staining. The aggregates formed by Sox4-overexpressed SMSCs had a greater amount of toluidine blue staining than control group (Fig. 2a). And, the size of aggregates from SOX4-transfected SMSCs was significantly increased compared with control group (Fig. 2b). Furthermore, we detected the expression of chondrogenic specific marker genes, such as Sox9, AGC1, and Col2. Consistent with histological results, these markers were significantly increased after transfection of Sox4 (Fig. 2c). Finally, we measured the accumulation of GAG in aggregates of all groups at day 14 after chondrogenic induction. GAG/DNA ratio of Sox4-overexpressed SMSCs were much higher than control group (Fig. 2d). These findings corresponded to the results of histological analysis and the expression of chondrogenic markers during chondrogenesis.

Fig. 2
figure 2

Chondrogenic differentiation of SMSCs in aggregate culture following Sox4 transfection. a Aggregates of all groups were stained with Safranin-O and toluidine blue for histological characterization. b Aggregate sizes for each group. c For each group, the chondrogenic-specific marker genes Aggrecan, Type II collagen and Sox9 were determined by Real-time PCR. mRNA expression levels were normalized to GAPDH. d Biochemical analysis for the assessment of chondrogenic differentiation index. After 14 days of chondrogenic induction, aggregates were digested in papain and sulfated glycosaminoglycans (S-GAG) and DNA content was measured. The GAG content was normalized to the total DNA content of each sample. Data are shown as mean ± SD; n = 3. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test)

Full size image

DANCR is a direct transcriptional target of Sox4

The important role of Sox4 in SMSCs motivated us to identify the target genes that were directly regulated by Sox4. It has been reported that lncRNA DANCR was closely associated with cell differentiation and cell transformation (Yuan et al. 2015). And we noticed that the DANCR promoter contained one consensus Sox4-binding motif (CAATGG). We hypothesized that DANCR was a direct target of Sox4. Interestingly, overexpression of Sox4 significantly increased DANCR level (Fig. 3a). ChIP assay also revealed the promoter of the DANCR gene to be directly bound by Sox4 in SMSCs (Fig. 3b). Finally, we cloned DANCR promoter (−500 to +200) and generated deletion mutant of promoter-luciferase construct based on the location of Sox4-binding motif (Fig. 3c). As determined by DANCR promoter luciferase reporter assay, DANCR promoter activity was increased upon Sox4 overexpression (Fig. 3d). When the region containing the Sox4-binding motif was deleted, we did not observe any changes in Sox4-mediated DANCR promoter-luciferase activation. These results indicate that lncRNA DANCR is a direct target of Sox4 in SMSCs.

Fig. 3
figure 3

DANCR is a direct transcriptional Target of Sox4. a DANCR expression was detected in SMSCs cells by Real-time PCR after transfection of Sox4 or the vector. b ChIP assay of Sox4 binding at the DANCR promoter. c DANCR promoter and deletion mutant of promoter luciferase construct. d Luciferase activity in SMSCs cotransfected with Sox4 and luciferase reporters containing DANCR promoter or its mutant. Data are shown as mean ± SD; n = 3. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test)

Full size image

Sox4 enhances chondrogenic differentiation and proliferation of SMSCs via upregulation of lncRNA DANCR

Next, we examined whether overexpressing DANCR could lead to the same phenotypes seen in SMSCs with Sox4 overexpression: chondrogenic differentiation and proliferation. Using CCK-8 assay, we found that overexpressing DANCR significantly promoted proliferation in SMSCs (Fig. 4a). In addition, we observed that DANCR significantly increased the size of aggregates formed by SMSCs compared with control group (Fig. 4b). This changes of phenotypes induced by DANCR was similar to which induced by Sox4.

Fig. 4
figure 4

Sox4 enhanced chondrogenic differentiation and proliferation of SMSCs via upregulation of lncRNA DANCR. a Cell viability was estimated at 1, 2, 3, 4, 5, 6 and 7 days after DANCR transfection using the CCK-8 assay. b Aggregate sizes for each group. c DANCR expression was detected in SMSCs cells by Real-time PCR after cotransfection of Sox4 and siRNA against DANCR. d Cell viability was estimated at 1, 2, 3, 4, 5, 6 and 7 days after DANCR siRNA and Sox4 transfection using the CCK-8 assay. e Aggregate sizes for each group. Data are shown as mean ± SD; n = 3. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test)

Full size image

To determine whether Sox4 functions upstream of DANCR in the regulation of chondrogenic differentiation and proliferation of SMSCs, we knocked down DANCR expression in Sox4-overexpressed SMSCs (Fig. 4c). We found that knocking down DANCR expression significantly decreased the proliferation and differentiation that were induced by the Sox4 overexpression (Fig. 4d, e). Together, these results demonstrated that Sox4 exerts its function at least in part via regulating DANCR expression.

Discussion

Transplantation of SMSCs possessing chondrogenic potential is now considered to be a new approach for repairing damaged articular cartilage. These SMSCs may be applied to clinical application due to its ability of differentiation into osteoblasts, chondrocytes, and adipocytes. It has been reported that the differentiation of SMSCs is closely associated with growth factors, such as TGF-β1. Previous studies have demonstrated that supplementation or overexpression of TGF-β1 promoted chondrogenic differentiation of SMSCs (Kim et al. 2014; Pei et al. 2008; Zhang et al. 2015). Sox4 is a known downstream of TGF-β1 pathway. In the present study, we demonstrated that overexpression of Sox4 is sufficient to promote proliferation and chondrogenic differentiation in the absent of TGF-β1 treatment. Although Sox family is well known to regulate various cellar processes, the function of Sox4 in chondrogenesis is largely unknown. Recent reports from other group suggested that Sox4 might play a role in chondrogenesis (Ezura et al. 2009). In this study, for the first time, we demonstrated that Sox4 overexpression enhancec chondrogenic differentiation and proliferation of SMSCs. However, the precise mechanisms by which Sox4 exerts its function in SMSCs remain unclear. One hypothesis is that Sox4 activates Wnt signaling pathway which is essential for SMSCs proliferation and differentiation through upregulation of β-catenin/TCF4 transcription (Naito et al. 2015; Saegusa et al. 2012). Another idea is that Sox4 increases the stability of β-catenin by directly binding to β-catenin and TCF family (Lee et al. 2011). A third possibility is that differentiation requires coordinated transcriptomic reprogramming via chromatin remodeling, and Sox4 increases and interacts with EZH2 which trimethylates histone 3 lysine 27 (H3K27me3) for gene repression (Koumangoye et al. 2015; Tiwari et al. 2013). The exact mechanisms of Sox4 on SMSCs proliferation and differentiation require further investigation.

lncRNAs have been established to participate in various biological processes that are crucial for development and differentiation. However, the roles of lncRNAs in the mechanisms of SMSCs differentiation are not completely understood. In the present study, ectopic expression of DANCR promoted chondrogenic differentiation and proliferation of SMSCs. DANCR also regulates Wnt pathway through interacting with CTNNB1 mRNA and stabilizing its stability (Yuan et al. 2015). We also found that DANCR is a target gene of Sox4. And Sox4 enhances chondrogenic differentiation and proliferation of SMSCs at least in part via upregulation of DANCR.

In conclusion, we demonstrated that Sox4 overexpression in SMSCs enhanced cell proliferation and chondrogenic potential via upregulation of lncRNA DANCR expression. The function of Sox4 on proliferation and chondrogenisis may through regulating Wnt pathway in diverse pattern. Additional studies are needed to illuminate the exact mechanisms, which will be helpful for the clinical application of SMSCs-based cartilage regeneration.