Introduction

The family Trichomonascaceae was proposed by Kurtzman and Robnett (2007) through multi-gene phylogenetic analysis of the teleomorphic genera Trichomonascus, Wickerhamiella, Sugiyamaella, and Zygoascus (Lachance et al. 2000; Kurtzman and Robnett 2007; Smith et al. 2011; Péter et al. 2011). The Trichomonascus/Blastobotrys clade includes anamorphic and teleomorphic members and comprises species from the polyphyletic genus Candida (Lachance et al. 2011) and the genus Blastobotrys (Kurtzman and Robnett 2007) as anamorphic members. The genus Blastobotrys was described in 1967 by von Klopotek, as a hyphomycete (von Klopotek 1967), but phylogenetic analysis of D1/D2 of the large-subunit (LSU) rDNA demonstrated that assigned species are actually anamorphic members of the Saccharomycetales (Kurtzman and Robnett 1998). The multigene analysis of LSU rDNA, the cytochrome oxidase II (COXII) and small-subunit (SSU) rDNA gene demonstrated Blastobotrys, Arxula, Sympodiomyces and several Candida species to be members of the same clade, which was interpreted as a single genus. Kurtzman and Robnett in 2007 transferred the anamorphic species of the Trichomonascus clade to the genus Blastobotrys (Kurtzman and Robnett 2007; de Hoog et al. 1985), which has taxonomic priority over Sympodiomyces (Fell and Statzell 1971) and Arxula (van der Walt et al. 1990), and several species of Candida. Although Trichomonascus (Jackson 1947) has taxonomic priority over Blastobotrys, the use of Blastobotrys as generic name for the Trichomonascus/Blastobotrys clade was favoured by participants of a workshop on yeast taxonomy (Utrecht, The Netherlands 2015, pers. information H. M. Daniel). However, this proposal still needs to be formalized. Members of the Trichomonascus/Blastobotrys clade are heterothallic which raises the possibility that anamorphic species in the clade may represent mating types (Kurtzman 2007).

In cave and cave-like habitats (i.e. mines) microbiota are related to changes in organic compounds from the outside environment, and fungal growth is generally nutrient-limited due to the rarity of organic materials in caves (Chelius et al. 2009; Jurado et al. 2009). There are some reports about the biodiversity of fungi in caves. Rutherford and Huang (1994) detected 127 species in 59 genera of fungi found in caves habitats. Vanderwolf et al. (2013) reviewed 1029 species in 518 genera of fungi, slime molds, and yeasts from different caves (Rutherford and Huang 1994; Vanderwolf et al. 2013). Most of the fungal taxa commonly studied from caves are associated with insects, soils, or plant materials and they generally function as decomposers or parasites in the cave environment (Yoder et al. 2009). Of course, it should be noted that many fungi found in caves could be carried by water, air currents, or animals in the cave environment and are present as spores. In 2004, Grishkan reported that many fungal species in the cave environment were isolated with low abundance and had low frequency of occurrence (Grishkan et al. 2004).

Fungal taxa reported from caves belong mostly to Ascomycota (69%), Basidiomycota (20%), Zygomycota (7), and fungus-like microorganisms (3.6%). The main reason for the relative rarity of Basidiomycota versus Ascomycota can be attributed to the lack of large nutrient-rich substrates in caves such as spoilable plant materials and dung. The most frequent yeast and yeast-like fungi genera reported from caves all around the world are Histoplasma, Candida, Aureobasidium, Microascus, Cryptococcus, Saccharomyces, Rhodotorula, Trichosporon, Sporobolomyces and Monascus (Vanderwolf et al. 2013). In this study, Blastobotrys was reported from cave soil for the first time. Many studies reported that the diversity in microbiota and biomass decrease from the entrance to deep zones in caves (Hsu and Agoramoorthy 2001; Urzi et al. 2010; Kuzmina et al. 2012; Mulec et al. 2002). Unexpectedly, in a South African gold mine, Pohl et al. (2007) reported that the biodiversity of filamentous fungal genera increased from the outside to deeper zones of cave and the opposite trend was reported for yeast genera. Direct air supply from the surface was considered as a reason for the increase in the number of filamentous fungi in the air. Moreover, the presence of yeast isolates related to human and animal activities and the biodiversity of yeast genera decreased from the outside to the inside (Pohl et al. 2007). Vaughan-Martini et al. (2000) studied the yeast communities of three caves of the Frasassi complex in the Marche region of Italy. They reported that the higher counts of yeast isolates were directly related to the frequencies of human or animal visitation. The number of yeast isolates in the Grotta del Vento cave with mass tourism and human visitors was 3.25 times of those found in the Grotta del Fiume cave (Vaughan-Martini et al. 2000).

In this study, we report the isolation of two yeast strains from cave soil samples in Ilam, Iran, based on comparisons of rRNA gene sequences and propose them as new anamorphic species with the name Blastobotrys persicus sp. nov.

Materials and methods

Yeast isolation

Soil samples (200 g) were collected from different locations in December 2015 by digging 5–10 cm into the ground from the Mejare cave, Abdanan, Ilam, Iran (N32°35′24″, E47°31′12″), 1100 m above sea level. The feces and wool of domestic animals, such as goats and sheep, were seen at the cave entrance. Standing or running water was not observed in the sampling areas. The samples were obtained about 3–10 m into the dark zones in different areas (about 20–30 m from the entrance). The temperature of the cave was 25 °C. Spiders and ants were seen as the dominant animals of the cave. In total, 10 soil samples were placed in sterile plastic bags (10 × 10 mL) and were transported to the laboratory over a period of no more than 24 h. Afterward, 1 g of each soil sample was homogenized in sodium chloride solution (0.9% w/v) and then serially diluted in the same solution (10−1–10−3), and 100 μL from each dilution was spread over the yeast–peptone–glucose (YPG) agar (0.5% yeast extract, 1.0% peptone, 2.0% glucose, and 2.0% agar) supplemented with 0.01% chloramphenicol and 0.005% rose bengal. The plates were then incubated at 28 °C in the dark and monitored daily up to 5 days until yeast colonies developed. The colonies showing different morphotypes, mostly from dilution 10−2, were picked and purified on YPG agar as soon as they grew on the plates. The yeast colonies’ stock cultures were stored on the YPG broth with 20% (v/v) glycerol at − 80 °C until further analysis.

Phenotypic and physiologic characterization

Morphological characteristics were observed by light microscopy after culture on YPG, potato dextrose agar (PDA) (Merck), and cornmeal agar (Fluka). The phenotypic and physiological characteristics of the strains IBRC-M 30238T and IBRC-M 30239 were examined in accordance with the standard methods (Barnett et al. 2000; Kurtzman et al. 2011). Carbon assimilation tests were carried out with the auxanographic method at 28 °C in triplicates, and the results were recorded after 2 weeks of incubation.

The two strains IBRC-M 30238T and IBRC-M 30239 were examined (individually and crossed in mating experiments) for sporulation after growth on Gorodkowa (Merck), cornmeal (Fluka), malt 5% (Merck), and YM agar (Merck) (Kurtzman et al. 2011). In brief, to test for sexual compatibility, IBRC-M 30238T and IBRC-M 30239 were separately grown overnight in 5 mL YPG broth at 28 °C. The cells were collected by centrifugation at 14,000 rpm for 15 min and washed with sterile normal saline. The pellet was then re-suspended in 100 µL distilled normal saline and each cell suspension (10 µL) was spread in the above-mentioned sporulation media and incubated at 15 and 28 °C for 6 weeks.

Phylogenetic analysis

The small subunit (SSU), the internal transcribed spacer (ITS) region, and the D1/D2 domain of the large subunit (LSU) of ribosomal DNA (rDNA) gene were amplified by PCR using primers nu-SSU-0817 (TTAGCATGGAATAATRRAATAGGA) and nu-SSU-1536 (ATTGCAATGCYCTATCCCCA) (Moghimi et al. 2017), ITS1(TCCGTAGGTGAA CCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990), NL1 (GCATATCAATAAGCGGAGGAAAAG), and NL4 (GGTCCGTGTTTCAAGACGG) (Kamyabi et al. 2017) respectively. The PCR products were checked by agarose gel electrophoresis and purified by using the Bioneer purification kit (Bioneer, South Korea). The purified PCR product was submitted to the Bioneer Corporation (South Korea) for sequencing with the same primers used for gene amplification.

BlastN searches for sequences deposited in the NCBI GenBank were carried out. The sequences of related species retrieved from the GenBank were aligned iteratively by using the multiple alignment program CLUSTAL X, version 1.81 (Thompson et al. 1997).

The phylogenetic placement of the new species was conducted using the MEGA version 6 software package from the evolutionary distance data using the two-parameter model (Kimura 1980) and the maximum likelihood method. The robustness of the clades was assessed using bootstrap analysis with 1000 replicates (Felsenstein 1985). The GenBank/EMBL/DDBJ accession numbers of the strain IBRC-M 30238T for the sequences of the ITS, LSU and the SSU genes are KU659140, KU659141, and KU659142 respectively. The accession numbers for the sequences of the ITS and the LSU genes of IBRC-M30239 are KY352042 and KY352043 respectively.

Results and discussion

Species delineation and phylogenetic placement

A total of 31 yeast strains were isolated from 10 different soil samples during an investigation on the biodiversity of yeasts associated with the soil samples from caves. We isolated IBRC-M 30238T and IBRC-M 30239 from two separate cave soil samples, which were 5 m from each other. These two strains were representatives of a new species based on the sequence similarity in the D1/D2 and ITS regions, and their physiological, morphological, and phylogenetic properties were studied. From the soil samples, the following additional fungal and yeast isolates were found: Naganishia adeliensis (two), Naganishia uzbekistanensis (one), Basidioascus sp. (two), Candida albicans (two), Candida powellii (three), Candida restingae (one), Candida tropicalis (two), Sarocladium kiliense (six), Sarocladium strictum (three), Sarocladium oryzae (one), Rhodotorula mucilaginosa (one), Rhodotorula lactosa (two), Exophiala jeanselmei (two), and Exophiala exophialae (one).

The two strains, IBRC-M 30238T and IBRC-M 30239, share identical D1/D2 sequences and differ sufficiently from the genetically closely related species in the Trichomonascus/Blastobotrys clade, so they were considered to be a separate species (Fig. 1). The comparison of the D1/D2 large subunit rRNA gene sequence of the new species with entries in the dataset revealed the closest match in terms of the pairwise sequence identity to be the type strains of Trichomonascus ciferrii NRRL Y-10943IT (DQ442681) by 1.5% divergence (9 nt substitutions in 583 nt), Candida allociferrii IFO 10194T (AB041003) by 2% divergence (12 nt substitutions in 577 nt) and Candida mucifera IFO 10918T (AB041006) by 1.75% divergence (10 nt substitutions in 577 nt) (Fig. 1).

Fig. 1
figure 1

Phylogenetic placement of Blastobotrys persicus IBRC-M 30238T and some related species based on the maximum likelihood analysis of D1/D2 LSU rRNA gene sequences. Schizosaccharomyces pombe and Zygoascus hellenicus were designated as the out-group species for this analysis. GenBank accession numbers are shown in parentheses. Numbers at branch points are bootstrap percentages derived from 1000 replicates

Full size image

A comparison of the ITS sequences revealed that the new species differed from the type strains Trichomonascus ciferrii NRRL Y-10943IT (KY105703.1), Candida allociferrii IFO 10194T (LC158134.1), and Candida mucifera IFO 10918T (EF568082.1) by 3.82% (17 nt substitutions out of 445 nt), 5% (25 nt substitutions out of 500 nt), and 4% (20 nt substitutions out of 494 nt) nucleotide substitutions respectively.

The sequence data and phylogenetic analysis of the D1/D2 large subunit rRNA suggested that the new species belongs to the subclade that contains T. ciferrii, C. allociferrii, C. mucifera, Blastobotrys chiropterorum, and Blastobotrys terrestris (bootstrap value, 97%) (Fig. 1). The presented phylogenetic tree demonstrated an arrangement of the species that is similar to the multigene sequence tree introduced by Kurtzman and Robnett (2007).

Ueda-Nishimura and Mikata (2002) investigated nine strains of the T. ciferrii complex and separated them into three groups in accordance with their sequences and the presence of Group I intron in SSU gene. The DNA similarity values showed that each group represented a separate species. Based on this classification, Group A was designated as C. allociferrii. In this group, the SSU sequences had no introns and the strains could not form asci by themselves. Group B comprised T. ciferrii, C. ciferrii, and Sporothrix catenata, all containing one Group I intron, Sc1506-1, at position 1506 in the SSU gene. Group C included strains of C. mucifera and they contain two Group I introns, Sc943 at position 943, and Sc1506-2 at position 1506 (Ueda-Nishimura and Mikata 2002). The SSU sequence analysis of the here introduced new Blastobotrys species showed no intron at positions 943 and 1506 (KY510967). Considering the difference of the LSU and ITS sequence analysis between the new Blastobotrys species and C. allociferrii, and according to the intron group classification by Ueda-Nishimura and Mikata, this new species should be considered as a new member of Group A along with C. allociferrii.

Phenotypic and growth characteristics

The strains IBRC-M 30238T and IBRC-M 30239 were examined for sporulation. No signs of conjugation and the formation of asci or ascospores in any of the tested media were observed. In both strains, yeast colonies are white and somewhat raised. Budding cells were formed by multilateral budding, and the production of true hyphae was not observed (Fig. 2). Different physiological properties, such as sugar consumption and growth at 42 °C, were investigated. The results for T. ciferrii NRRL Y-10943IT (DQ442681), C. mucifera IFO 10918T (AB041006), and C. allociferrii IFO 10194T (AB041003) were compared with that for Blastobotrys persicus IBRC-M 30238T and summarized in Table 1.

Fig. 2
figure 2

Photomicrographs of Blastobotrys persicus IBRC-M 30238T. a Butyrous, glistening, white-colored colony on YPG medium at 28 °C after 72 h of incubation. b Budding cells. c Short chains of blastoconidia. d Formation of protuberances, indicating the early stage of germ-tube production on YPG agar after 7 days’ incubation at 25 °C. Bars = 10 μm and valid for figures a–d

Full size image
Table 1 Physiological and growth characters that can distinguish Blastobotrys persicus from its closest relatives
Full size table

Description of Blastobotrys persicus H. Nouri, S. Nasr and H. Moghimi, sp. nov

Blastobotrys persicus (per’ si.cus. L. masc. adj. persicus of Persia, present Iran, refer to the location where the type strain of the species was isolated). Growth on YPG agar: after 72 h at 28 °C, the streak culture is butyrous, glistening, and white-colored with a smooth surface (Fig. 2a). Colony margins are entire (Fig. 2a). The cells range from being spherical to ovoid (3–4 × 2.5–4 µm); they occur singly, in pairs, or in small clusters. Budding is multilateral (Fig. 2b). Pseudohyphae are rare on YPG, PDA and cornmeal agar. Protuberances as potential early stage of germ-tube production (Fig. 2d) and short chains of blastoconidia (Fig. 2c) are formed. Production of ascospores was not observed on Gorodkowa, cornmeal, malt 5%, and YM agar after 6 weeks neither at 15 °C nor at 28 °C. Fermentation is absent. Glucose, galactose, sucrose, maltose, α,α-trehalose, d-xylose, cellobiose, l-arabinose, l-rhamnose (weak), ribitol, melibiose (slow or weak), raffinose, melezitose (weak), salicin (weak), arbutin, n-hexadecane (weak), myo-inositol, glycerol, dl-lactate (weak), and ethanol (weak) are assimilated; no growth occurs on d-ribose, d-mannitol, d-arabinose, starch, lactose, methanol, succinate, and citrate.

Ethylamine hydrochloride, l-lysine, cadaverine dihydrochloride, creatinine (weak), and glucosamine (weak) are assimilated as nitrogen sources, while potassium nitrate, sodium nitrite, creatine, and imidazole are not assimilated. The formation of amyloid material is negative. Growth is weak at 15 °C. Growth occurs at 25, 30, 34, 37, 40, and 42 °C. Growth at 4, 10, and 45 °C is negative.

Growth with 0.01 and 0.1% cycloheximide is negative. Growth is present on 50% (w/w) glucose–yeast extract agar. Growth is weakly positive on 60% (w/w) glucose–yeast extract agar. No growth occurs on 1% acetic acid. Growth is present on 5 and 10% NaCl. No growth occurs on 16% NaCl. Urea hydrolysis and color reaction with diazonium blue B are negative.

The holotype strain is IBRC-M 30238T isolated from Abdanan, Ilam, Iran. The holotype is permanently preserved in a metabolically inactive state at the Iranian Biological Resource Center (IBRC), Iran, as IBRC-M 30238T and an ex-type culture is deposited in the CBS yeast collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands, as CBS 14259T.

Strains examined

IBRC-M 30238T (CBS 14259T); IBRC-M 30239.