Introduction

Sedum L. is the largest genus in the family Crassulaceae and as currently circumscribed, includes about 430 species, with major centres of diversity in eastern Asia, the Mediterranean basin, and northern America and Mexico (’t Hart and Bleij 2003; Thiede and Eggli 2007). The genus appears to be paraphyletic and is consequently taxonomically rather problematic, and a large number of sectional names and segregate genera have been published (’t Hart and Bleij 2003; Carrillo-Reyes et al. 2009). Approximately 121 species (91 endemics) occur in China, which on the basis of morphological characters (gibbous carpels, spurred leaf bases and petal colour) have been assigned to three sections: sect. Filipes (Fröderström) S.H. Fu, sect. Oreades (Fröderström) K.T. Fu, and sect. Sedum (H. Ohba) S.H. Fu (Fu and Ohba 2001). Section Filipes includes eight species and is distributed in Bhutan, China, Japan, Myanmar, Nepal and Sikkim Province in India, with three species endemic to China; section Oreades contains about 67 species distributed in Bhutan, China, India, Myanmar, Nepal and Pakistan, with 64 species (54 endemic) in China; and section Sedum comprises more than 60 species, occurring mainly in Asia and Europe, with 49 species (34 endemics) in China.

In 2005, the senior author undertook extensive field research in Zhejiang Province and collected many specimens in a search for metal hyperaccumulator plants. Some unusual and isolated populations that superficially resembled S. alfredii Hance, but which produced 4-merous flowers, were found in Lin’an and Chun’an counties, together with four other species, S. alfredii, S. emarginatum Migo, S. hangzhouense K.T. Fu and G.Y. Rao and S. bailey Praeger, that were identified from the same areas. After comparison with the taxonomic accounts of Sedum in the Flora of China (Fu and Ohba 2001), the Flora of Zhejiang (He 1993), the Flora of Jiangsu (Jiangsu Institute of Botany 1982), the Flora of Anhui (Xue 1986), and the Flora of Jiangxi (Jiangxi Institute of Botany 2004), the authors found that the populations were distinctly different from S. alfredii and proposed that they should be recognized as a new species, Sedum plumbizincicola X.H. Guo et S.B. Zhou, in a brief report (without Latin or English description) in the Chinese journal Soils (Wu et al. 2006). The specimens were lodged in the Herbarium of Anhui Normal University, China (ANU!).

The identification of Sedum is traditionally based on macromorphological characters of vegetative and generative organs (Fu and Ohba 2001). However, micromorphological characters such as pollen morphology (Zheng 1997), leaf epidermis (Zheng and Gong 1999), stem anatomy (Zheng et al. 2001) and seed morphology (Jin et al. 2008) have also proved useful, whilst DNA characters have been used to reveal the relationships among Sedum species (Wu et al. 2008; Carrillo-Reyes et al. 2009; Li et al. 2010). The aim of this paper is to formally describe the new species S. plumbizincicola X.H. Guo et S.B. Zhou ex L.H. Wu, and to clarify the affinities between S. plumbizincicola and closely related taxa on the basis of geographical distribution, growth habit, phenology, macromorphological characters, stem and leaf anatomical features, seed micromorphology and nrDNA internal transcribed spacers (ITS) sequence data.

Materials and methods

Sixteen populations comprising S. hangzhouense (one population), S. alfredii (three populations), S. emarginatum (three populations), S. bailey (two populations) and S. plumbizincicola (seven populations) from Zhejiang Province, China were sampled during the summer of 2011 (Table 1), and more than ten individuals were sampled per population for morphological, anatomical and molecular research. Voucher specimens are deposited in the Herbarium of Anhui Normal University (ANU!), China. Fifty-six ITS sequences were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/: Table 2).

Table 1 Sedum material used in the present study
Full size table
Table 2 Accession information relating to internal transcribed spacers (ITS) sequences for 56 taxa downloaded from National Center for Biotechnology Information (NCBI)
Full size table

Eighteen quantitative macromorphological characters were measured in the sampled taxa (Table 3). Ten measurements were made for each population and then averaged at species level. Eight qualitative macromorphological characters, together with four habit, habitat and phenology characters were also determined. Seeds of S. plumbizincicola and S. alfredii were collected from mature capsules of living specimens. Dried seeds were arranged on stubs and sputter-coated with gold for observation by scanning electron microscopy (SEM). Seed micromorphology was photographed and morphometry of seeds was examined using an FEI Quanta 200 ESEM scanning electron microscope at Nanjing Forestry University. Ten measurements were made for each population, and then averaged at species level.

Table 3 Macromorphological, phenological and ecological characters of five Sedum species
Full size table

Ten fresh leaves and stem sections of S. alfredii and S. plumbizincicola were fixed and preserved in formaldehyde–acetic acid–alcohol (FAA) solution (Stern and Judd, 2002). They were dehydrated in a graded ethanol series, embedded in paraffin and sectioned transversely to 8 μm with a KD-2508 Rotary Microtome (Zhejiang Jinhua Kedi Instrument Equipment Co., China). These sections were stained with methylene blue and fixed in neutral resin. Finally, all specimens were observed and photographed under an Olympus stereomicroscope (DP71) to compare the main anatomical characters.

Genomic DNA from 160 individuals belonging to 16 populations of five Sedum species (Table 1) was extracted from silica gel-dried leaves using the modified 2× hexadecyltrimethylammonium bromide (CTAB) method (Hellwig et al. 1999). ITS-F (TGAACCTGCGGAAGGATCAT) and ITS-R (GGTAGTCCCGCCTGACCTG) primers to the conserved domain of the ITS sequence were synthesized by the Beijing Genomics Institute. Each reaction solution contained 10 μl of 2× EasyTaq PCR SuperMix, 10 μmol μl−1 of each primer, and 1 μl of DNA template in a total volume of 20 μl. PCR amplifications were carried out on a TaKaRa PCR Thermal Cycler Dice using the following programme: 300 s of initial denaturation at 94 °C, followed by 34 cycles of 45 s denaturation at 94 °C, 45 s annealing at 58 °C and 90 s elongation at 72 °C, and finishing with 10 min elongation at 71 °C. PCR products were subcloned with the pEASY-T3 Cloning Kit (TransGen Biotech) according to the manufacturer’s instructions, and five colonies for each sample were screened. Products were sequenced at the Beijing Genomics Institute. The ITS sequence data for 16 populations, together with 56 ITS sequences downloaded from GenBank, were edited and aligned using Lasergene version 7.0 (Griffin and Griffin 1996) and DNAMAN version 6.0.40 (Altschul et al. 1990). Phylogenetic trees were inferred using maximum parsimony (MP) criteria as implemented in MEGA version 5.0 (Tamura et al. 2011). All positions containing gaps and missing data were eliminated. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) (Felsenstein 1985) was calculated. The MP tree was obtained using the Close-Neighbor-Interchange algorithm (Nei and Kumar 2000) with search level 3, in which the initial trees were obtained with the random addition of sequences (ten replicates).

Results and discussion

Description of the new species S. plumbizincicola

Type: China, Zhejiang Province, Hangzhou city, Chun’an county, Zitong town, 29°32′08″–29°37′00′′N, 118°34′48″–118°39′51″E, alt. 220 m, lead–zinc mining area, 10 June 2005, Bide05061028 (holotype ANU!; isotype IBK!).

Description: Sedum plumbizincicola X.H. Guo et S.B. Zhou ex L.H. Wu sp. nov. Perennial, light green, or yellowish green herb. Roots fibrous. Rhizomes slender and horizontal, yellowish brown or dark brown, to 7 cm long, ca. 4–8 mm diameter. Sterile stems several-branched, erect, 10–25 cm, densely caespitose. Leaves of foliage branches alternate, usually deciduous, crowded distally on stem; leaf blade ovate to obovate-spatulate, 1–5 × 0.5–1.5 cm, glabrous, apex blunted, base cuneate, pseudopetiolate; adaxial surface bright green, abaxial surface jade green, the midrib not convex abaxially. Inflorescence yellow, erect, much-branched, the peduncles up to 35 cm tall, ca. 0.8 cm in diameter. Cyme corymbiform, ca. 8 cm in diameter, many flowered, bracts linear to linear-lanceolate, 5–10 × 3–8 mm, apex blunted. Flowers sessile, unequally 4-merous. Sepals 4, narrowly triangulate, ca. 1–2 mm long apex blunted. petals 4, yellow, lanceolate, 4–6 × 1–1.5 mm, apex acute. Stamens 8, slightly shorter than the petals, antesepalous ones ca. 3.5–4.5 mm long, antepetalous ones ca. 3 mm long, inserted ca. 1 mm from petal base; filaments greenish, anthers oblong, yellow. Nectar scales inverted trapezia, ca. 0.3–1.0 × 0.8 mm. Carpels erect, ovoid-lanceolate, ca. 4–5 mm long, connate about one-third at base. Styles ca. 1 mm. Follicles split divergent, tetra-aristiform. Seeds numerous, brown, obovoid-oblong, ca. 0.7–1 mm long, mammillate. Flowering early June–August, fruiting July–September. See Figs. 1 and 2.

Fig. 1
figure 1

Sedum plumbizincicola in its vegetative (a) and flowering (b) states in the original habitat (Wu et al. 2006)

Full size image
Fig. 2
figure 2

Sedum plumbizincicola. a flowering states, b vegetative states, c leaf, d petal with two stamens, e sepal, f sepal at frutescence, g two of four carpels, h two of four follicles, i bract, j squama (scale bars a, c 10 mm, b 6 mm, d, i 5 mm, e–g 2 mm, h 4 mm, j 0.5 mm). Illustration by Shoubiao Zhou

Full size image

Ecology, distribution and importance: This new species is only known from the type locality, Zitong town (lead–zinc mining areas) northwest of Hangzhou city, in western Zhejiang Province of eastern China (see Fig. 3). Annual rainfall varies from 980 to 2,000 mm and occurs mainly in the summer, with a mean annual temperature of 15–18 °C. Soils in this area are usually sandy, acidic, highly leached and often shallow (http://baike.baidu.com/view/2341.htm). This species has a strong ability to hyperaccumulate zinc and cadmium, and is a promising taxon in the restoration of metal-polluted soils by phytoremediation.

Fig. 3
figure 3

Distribution map of Sedum plumbizincicola

Full size image

Etymology: The specific epithet ‘plumbizincicola’ refers to the plant’s distribution in the lead and zinc mining areas of western Zhejiang Province, China.

Diagnosis: S. plumbizincicola is placed in sect. Sedum according to the adaxially gibbous carpels and follicles. S. alfredii, S. emarginatum, S. hangzhouense and S. bailey are also distributed in the same areas as S. plumbizincicola, but they produce 5-merous flowers while the latter bears 4-merous flowers. S. tetractinum Fröderström, S. hakonense Makino and S. dongzhiense D.Q. Wang and Y.L. Shi in sect. Sedum also bear 4-merous flowers, but they differ from S. plumbizincicola in leaf blade shape (oblanceolate in S. hakonense and S. dongzhiense, orbicular in S. tetractinum, and ovate to obovate-spathulate in S. plumbizincicola) and in their habitats.

Additional collections: China. Zhejiang Province: Chun’an county, Zitong town, alt. 250 m, 10 June 2011, Y.j.Liu 201106021(ANU!); ibid., 251 m, Y.j.Liu 201106022(ANU!); ibid., 234 m, Y.j.Liu 201106023(ANU!); ibid., 258 m, Y.j.Liu 201106024(ANU!); Zhejiang province: Chun’an county, Panjia town, alt. 134 m, Y.j.Liu 201106025(ANU!); ibid., 188 m, Y.j.Liu 201106026(ANU!); ibid., 199 m, Y.j.Liu 201106027(ANU!).

Affinities between S. plumbizincicola and closely related taxa

Because we found that S. plumbizincicola mostly resembled S. alfredii and that S. hangzhouense, S. emarginatum and S. baileyi were distributed in the same areas as these two species, our research work focused on the relationships among these five taxa.

Macromorphological, phenological and ecological characters of the five Sedum species are listed in Table 3. Macromorphological characters show that S. plumbizincicola is differentiated from S. alfredii and other similar Sedum species by its 4-merous flowers and thick sterile stems. Its restriction to metalliferous mining areas and low altitude in distribution also support recognition of S. plumbizincicola as a distinct taxonomic entity.

The leaf and stem anatomical characters of S. alfredii and S. plumbizincicola are shown in Table 4 and Fig. 4. Leaves of S. plumbizincicola are thicker than those of S. alfredii. The stems of S. alfredii are narrower than those of S. plumbizincicola, whilst S. alfredii stems have more cortical parenchyma cells and fewer pith cells than S. plumbizincicola. Sedum plumbizincicola produces more vascular bundles and has a higher ratio of xylem to phloem cross-sectional area than S. alfredii. The leaf and stem anatomical data support S. alfredii and S. plumbizincicola as separate taxa.

Table 4 Comparison of leaf and stem anatomy of S. alfredii and S. plumbizincicola
Full size table
Fig. 4
figure 4

Leaf (a, b) and stem (c, d) transverse sections of S. alfredii (a, c) and S. plumbizincicola (b, d). The organs of the two species were of comparable developmental age

Full size image

The seed micromorphological characters of S. alfredii and S. plumbizincicola are displayed in Fig. 5 and their comparisons with S. hangzhouense, S. emarginatum and S. baileyi are listed in Table 5. The epidermal cells of S. alfredii and S. hangzhouense seeds are uplifted, whereas those of the other three species are not. The surfaces of S. alfredii and S. plumbizincicola seeds are both loosely mammillate, but the mammillae differ in shape. Those of S. alfredii are spherica,l whereas those of S. plumbizincicola are prolate-spheroidal. The seed micromorphological characters also suggest that S. alfredii and S. plumbizincicola are different species.

Fig. 5
figure 5

Seed morphology (a, b) and surface detail (c, d) of S. alfredii (a, c) and S. plumbizincicola (b, d)

Full size image
Table 5 Seed micromorphology of S. plumbizincicola and S. alfredii compared to S. baileyi, S. emarginatum and S. hangzhouense
Full size table

The nrDNA ITS sequences of 16 populations of S. plumbizincicola, S. alfredii, S. emarginatum, S. hangzhouense and S. baileyi (Table 1) were determined. These ITS sequence data, together with 56 ITS sequence data of Sedum species and three outgroups downloaded from NCBI (Table 2), were used to reconstruct a nrDNA ITS phylogeny for these taxa using maximum parsimony. The sequence alignment consisted of 682 characters, of which 443 were variable sites and 352 were parsimony-informative sites. Twenty equally parsimonious trees were obtained (length = 1852, consistency index = 0.42, retention index = 0.78), of which one is shown in Fig. 6. The seven S. plumbizincicola accessions (top of Fig. 6) form a strongly supported monophyletic clade (99 % bootstrap support) sister to S. alfredii. Together, S. plumbizincicola and S. alfredii form a strongly supported clade (99 % bootstrap support) sister to a monophyletic S. emarginatum. Thus, the nrDNA ITS phylogeny supports the concept of S. plumbizincicola as a monophyletic entity.

Fig. 6
figure 6

nrDNA ITS maximum parsimony tree for 69 Sedum accessions with three outgroups (Hylotelephium verticillatum, Kalanchoe beharensis and Rhodiola rosea). Numbers associated with nodes are percentage bootstrap support values; nodes where values are not shown received <50 % support

Full size image

At the infrageneric level, there is still uncertainty about taxonomic relationships within Sedum. Praeger (1921) recognized ten sections within the genus Sedum, whereas Berger (1930) recognized 22, of which ten have now been transferred to other genera (Carrillo-Reyes et al. 2009). Fu and Ohba (2001) assigned the Chinese species of Sedum to three sections, i.e. sect. Filipe and sect. Oreades (Fu 1965, 1974) and sect. Sedum, the largest in the genus (’t Hart 1991; Carrillo-Reyes et al. 2009). Figure 6 shows that the 69 accessions of 49 Sedum species can be split into two strongly supported clades (99 % bootstrap support): the upper one in Fig. 6 comprises 24 accessions of 7 species from China, 11 accessions of 11 species from Japan, and four accessions of four species from Nepal, whereas the lower one contains 30 accessions of 29 species from Mexico. This result suggests that Sedum species in East Asia are phylogenetically distinct from those in Mexico. Among the 39 East Asia accessions, S. oreades (Decaisne) Raym.-Hamet and S. trullipetalum J.D. Hooker and Thomson belong to sect. Oreades, while all the other accessions belong to sect. Sedum (Fu and Ohba 2001). Figure 6 does not support a sister-group relationship between S. oreades and S. trullipetalum, although relationships are not well resolved in this part of the tree. Nevertheless, this result lends weight to the view that the phylogeny of Sedum inferred from nucleotide sequence data does not accord with classifications of the genus based on morphological characters (Carrillo-Reyes et al. 2009). Greater taxon sampling and additional markers will be required to arrive at a more definitive consensus on infrageneric relationships within Sedum, but we place the new species S. plumbizincicola in sect. Sedum on the basis of its adaxially gibbous carpels and follicles.

In summary, the ecological, macromorphological, micromorphological and molecular data show that S. plumbizincicola should be recognized as a new species in sect. Sedum.