Introduction

Camelpox is an important wide-spread viral skin disease of camels, which is mainly characterised by skin lesions or systemic infections depending upon the virus strain and the immune status of the animal (Kaaden 2002; OIE 2014). The disease causes considerable loss to camel farmers in terms of morbidity, mortality, loss of weight and reduction in milk yield (Bhanuprakash et al. 2010). The characteristic skin lesions first appear on the head, eyelids, nostrils and the ears, and later may spread to the neck, legs, genitalia, mammary glands and perineum (Wernery et al. 1997). In the systemic form, pox lesions may cover the entire body including the mucous membranes of the mouth and respiratory tract (Wernery and Kaaden 2002; OIE 2014). The camelpox virus (CMLV) is secreted in milk, saliva and nasal and ocular secretions of the infected camels, and the transmission usually occurs by direct or indirect contact through inhalation or skin abrasions (OIE 2014).

Sporadic outbreaks of camelpox have been reported among camels in India and other countries in the recent past (Bhanuprakash et al. 2010; Kachhawaha et al. 2014; Dahiya et al. 2017), Iraq (Gatie 2016), Iran (Mosadeghhesari et al. 2014) and Sudan (Motalab and Ahmed 2014; Khalafalla and Abdelazim 2017). However, detailed clinicopathological studies in infected camels during these outbreaks are lacking. This is the first systematic study that documents haematological and serum biochemical parameters associated with natural infection of camelpox.

Material and methods

In the month of December 2014, an outbreak of camelpox was reported in an organised dromedary camel farm having total herd strength of 323 camels. This farm was situated at Bikaner district of Rajasthan, India which is having tropical climatic conditions. During the outbreak, the infected camels were observed for clinical signs, and blood samples were collected from ten infected and ten non-infected camels for haematological and serum biochemical analysis. Blood samples were analysed immediately after collection for haematological parameters, viz., haemoglobin (Hb), total red blood cell count (RBC), total white blood cell count (WBC) and differential leucocyte count (DLC). Sera samples were subjected to biochemical parameters, viz., total protein, albumin, calcium, cholesterol, triglycerides, alkaline phosphatase, lactate dehydrogemnase (LDH), aspartate aminotransferase (AST) and alanine transaminase (ALT) using the commercial kits (Span diagnosics™).

The scab samples were collected from affected camels in 10% formal saline for histopathology and also in sterile vials for DNA extraction and PCR. The formalin fixed tissue samples were embedded in paraffin, cut into 4–5 μ sections and stained with haematoxylin and eosin stain using the standard procedure.

Total genomic DNA was extracted from collected scab samples using PureLink® Genomic DNA Kit (Invitrogen, USA). The genomic DNA was used to amplify the haemagglutinin (HA) gene of camelpox virus (CMLV) by using the primers designed and based on CMLV gene sequences (GenBank accession No. DQ853384) forward primer (HA-F) (5’ CGGTGGGGATCCATGGCACGATTGTCAATA 3′), reverse primer (HA-R) (5’ TGGCAG CTCGAGTTATGTTTTGTATTTACG 3′) (Nagarajan et al. 2013). Reaction volumes for the PCR of 50 μl were used and contained 5 μl of 10× buffer with 15 mM MgCl2, 10 mM of each dNTPs, 100 pmol of each oligonucleotide primer, 100 ng of DNA sample and 3 U Taq DNA polymerase. The reaction mixture was subjected to initial denaturation of the template at 94 °C for 5 min in thermal cycler (Eppendorf, Germany). Cycling conditions for PCR were 35 cycles each at 94 °C for 60 s, 50 °C for 60 s and 72 °C for 60 s, followed by a final extension for 10 min at 72 °C. The PCR amplified products were checked in 1% agarose gel. The size of the PCR product, specific for camelpox virus, was approximately 948 bp. The primers specific for topoisomerase gene of contagious ecthyma were used as negative control for differential diagnosis (Nagarajan et al. 2011).

The data obtained for haematological and biochemical parameters were expressed as mean ± standard deviation, and analysed by t test using SPSS16 statistical software (SAS Institute Inc., Cary, North Carolina, USA).

Results

The total incidence of camelpox in the herd was recorded as 17.02% (n = 55). The camels of age ranging from 1 to 13 years of either sex were found infected with significantly more incidence in camels of age group 1 to 3 years (61.81%) than camels of age group more than 3 years (38.18%). There was no significant difference in incidence of camelpox infection in male (n = 24) and female (n = 31) camels. No mortality was reported in any of the infected camel. The symptoms in infected camels were anorexia, fever, lacrimation and pustular skin lesion on skin of lips, mouth, nostrils, head, neck, abdomen, inguinal region, thighs and legs (Fig. 1). In addition to these lesions, one camel also showed sign of corneal opacity and pustules on tongue and buccal cavity (Fig. 2). These pustular lesions later progressed into dry and scaly scabs which tend to bleed when removed.

Fig. 1
figure 1

Pock lesions on skin of inner thigh and legs (arrow)

Full size image
Fig. 2
figure 2

Pustular lesions on the mouth, lips and nostrils. Also note corneal opacity

Full size image

The haematological parameters revealed significantly reduced haemoglobin in infected camels compared to non-infected camels (P < 0.05) (Table 1). The other haematological parameters showed no significant difference between infected and non-infected camels (Table 1). The serum biochemical parameters revealed significantly reduced total protein in infected camels as compare to non infected camels (P < 0.05) (Table 2). The other serum biochemical parameters showed no significant difference between infected and non-infected camels. The histopathological examination of the collected scab samples revealed hydropic degeneration of the keratinocytes and presence of characteristic intracytoplasmic eosinophilic inclusion bodies (Fig. 3). In several cases, the epidermis also revealed hyperplasia and underlying haemorrhages along with infiltration of mononuclear cells (Fig. 4). The PCR revealed amplification of HA gene of CMLV in all the scab samples collected from infected camels.

Table 1 Haematological parameters in camelpox infected and non-infected control camels
Full size table
Table 2 Serum biochemical parameters in camelpox infected and non-infected control camels
Full size table
Fig. 3
figure 3

Hydropic degeneration of the keratinocytes in the epidermis (HE × 400)

Full size image
Fig. 4
figure 4

Hyperplasia of epidermis with infiltration of mononuclear cells and haemorrhages (HE × 200)

Full size image

Discussion and conclusion

In the present study, higher incidence of camelpox was recorded in camels of less than 3 years age than adults or older animals. This finding is in agreement with a previous study which reported that the disease frequently affect young camels with severe form and high mortality (Nothelfer et al. 1995). However, in the present study, no mortality was reported in any of the infected camels, and mild lesions were observed in majority of the camels. This variation in disease manifestation may be due to the difference in virulence of the infecting virus strain and the immune status of animals (Kaaden 2002). The present outbreak occurred in mid December which is a dry and cold month in the Bikaner region of India. Several studies have reported that the incidence of camelpox outbreaks increases in rainy season with more severe form, whereas milder form was observed during the dry season (Wernery et al. 1997; Wernery and Kaaden 2002; Kachhawaha et al. 2014). Septicemia due to secondary bacterial infections is the major cause of mortality in infected camels (Wernery and Kaaden 2002). Since the camels of the present study were from an organised herd where infected camels were timely and appropriately treated, hence the spread of lesions was limited and no mortality was reported.

In the current study, typical symptoms of camelpox such as anorexia, fever, lacrimation and pustular skin lesions were observed which coincided with several reports by other investigators (Wernery and Kaaden 2002; Kachhawaha et al. 2014; Motalab and Ahmed 2014; Mosadeghhesari et al. 2014; Gatie 2016; Aregawi and Feyissa 2016). The histopathological lesions were also found characteristic to the camelpox infection and in agreement with previous studies (Motalab and Ahmed 2014; Dahiya et al. 2017).

Similar to the findings of the present study, anaemia and hypoproteinemia was frequently reported in camelpox infection (Hussein and Al-Mufarrej 1999), sheep pox infection (Issi et al. 2008) and other viral skin diseases akin to camelpox such as camel papillomatosis (Barakat et al. 2013) and camel contagious ecthyma (Narnaware et al. 2015). The anaemia and hypoproteinemia is mainly attributed to the marked decrease in food intake due to the painful lesions in the mouth and inappetance during the course of the disease. However, in the present study other haematological and serum biochemical parameters did not alter. Similar haematological findings were reported in a case of camelpox in India (Kachhawaha et al. 2014). This can be attributed to the supportive treatment and supplementary feed provided to the infected camels of the present study during the initial stages of the disease.

In agreement with a previous study, the PCR for amplification of HA gene of CMLV from scab samples was found to be a rapid and sensitive assay for detection of camelpox infection in the initial stage of the disease (Nagarajan et al. 2013). This assay was also reported to be useful in distinguishing orthopoxvirus from all other pox viruses (Nagarajan et al. 2013).

In conclusion, understanding the blood profile picture of camel affected by camelpox will give further insight into the pathogenesis of the disease and can help clinicians in the effective management of the disease.