Introduction

Clonorchis sinensis (Cs) is one of the most important trematode parasites that cause human clonorchiasis in China, Korea, Japan and Southeast Asia. The C. sinensis parasitizes in the biliary passages of humans, and is capable of destroying the biliary and hepatic tissues (Rim 1986). There are about 7 million people reported to be infected with C. sinensis in east Asian countries (Crompton 1999).

The ubiquitin-dependent proteolytic system is of great importance for the maintenance of homeostasis of a broad range of eukaryotic proteins. It is a major pathway for protein degradation in eukaryotes, and plays an essential role in the control of numerous cellular processes, including cell cycle progression (Tyers and Jorgensen 2000), signal transduction (Strous et al. 1997), transcriptional regulation (Hochstrasser et al. 1991), organelle biogenesis (Finley et al. 1989), and the inflammatory response (Chen et al. 1995).

The conjugation of ubiquitin (Ub) to a target protein is a cascade enzymatic reaction involving a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2 or UBC), and a ubiquitin–protein ligase (E3). Initially, ubiquitin is activated by the E1 in an ATP-dependent manner, resulting in the formation of a high-energy thiolester bond between the C-terminal glycine residue of ubiquitin and a conserved cysteine residue within E1. The activated ubiquitin is then transferred from E1 to the active-site cysteine residue of E2 by trans-thiol esterification. Finally, E2 donates ubiquitin monomers or multiubiquitin chains either directly or with the assistance of E3 to an ε-amino group of a lysine residue in the target proteins, where a covalent isopeptide bond is formed. The ubiquitinated proteins are subsequently delivered to and degraded by the 26S proteasome (Hershko and Ciechanover 1998).

In contrast to the single E1 ubiquitin-activating enzyme, E2 exists as a family of related isozymes. In S. cerevisiae, there are at least 13 different E2s (Hochstrasser 1996). Functions of E2s have been extensively studied in yeast, and they appear to play distinct roles in a variety of cell events. UBC2/RAD6 is a requirement for DNA repair, damage-induced mutagenesis, and sporulation (Jentsch et al. 1987). UBC3/CDC34 participates in the progression of the cell cycle from the G1 into the S phase (Goebl et al. 1988). UBC4 and UBC5 play important roles in the turnover of short-lived and abnormal proteins (Seufert and Jentsch 1990). UBC1 is able to functionally overlap with UBC4/5 but appears to act primarily in the early stages of growth after the germination of spores (Seufert et al. 1990). Members of E2 enzyme genes that are homologous to yeast have also been characterized in other species, such as humans (Koken et al. 1991b; Jensen et al. 1995), rabbits (Wing et al. 1992), Caenorhabditis elegans (Zhen et al. 1993), Drosophila melanogaster (Koken et al. 1991a), and many plants (Girod and Vierstra 1993; Girod et al. 1993; Feussner et al. 1997; Zhang et al. 2003).

In this study, we describe the cloning, sequence analysis, and the characterization of a cDNA encoding a ubiquitin-conjugating enzyme from Clonorchis sinensis. This is the first report of parasite E2 to be overexpressed in an active form.

Materials and methods

cDNA library construction and sequencing

Adult Clonorchis sinensis worms were collected from the livers of cats 5~10 months after oral infection with the metacercariae. An adult C. sinensis cDNA library was constructed in a modified pBluescriptIISK(+) vector. After mRNA extraction, double-strand cDNA was synthesized using the SMART cDNA Library Construction Kit (Clontech), following the manufacture’s instructions. After digestion with SfiI and size fractionation on a Sepharose CL-2B column, the cDNA fragments longer than 500 bp were ligated into SfiI A and SfiI B sites of the modified pBluescriptIISK(+) vector. Then, the constructs were transformed into E. coli DH5α cells. Individual clones were cultured overnight in LB broth with 100 μg/ml ampicillin, and plasmids were isolated using a QIAwell plasmid purification system (Qiagen). The cDNA inserts were sequenced on an ABI PRISM 377 DNA sequencer (Perkin-Elmer), using the BigDye Terminator Cycle Sequencing Kit and the BigDye Cycle Sequencing Kit (Perkin-Elmer).

Sequence analysis of the C. sinensis ubiquitin-conjugating enzyme (CsUBC) gene

DNA and the deduced protein sequence comparisons were carried out using the BLASTN and BLASTP at the NCBI Web Server (http://www.ncbi.nlm.nih.gov/blast). Sequence alignment was carried out using GeneDoc software.

Expression of CsUBC cDNA in E. coli

Primers were designed according to the putative open reading frame (ORF) of the C. sinensis ubiquitin-conjugating enzyme (CsUBC). The sense primer was 5′CGGGATCCATGTCCACTCCGGCCCAAC3′, and the anti-sense primer was 5′CCGCTCGAGTTACATGTCATCTTCCTCCTC3′, with a BamHI site and an XhoI site incorporated, respectively. PCR was carried out for 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s. The reaction was continued for 10 min at 72°C after the last cycle. The amplified PCR fragment was digested with BamHI/XhoI and cloned into the expression vector pGEX4T1. The ligation mixture was transformed into E. coli BL21 (DE3). After being cultured overnight in an LB plate containing 100 μg/ml ampicillin, plasmids were isolated and sequenced to confirm the correct insertion of the cDNA fragment. After sequencing, a correct transformant was selected and cultured at 37°C in LB media containing 100 μg/ml ampicillin. Induction was carried out by final concentration of 1 mmol/l IPTG when the bacterial cells grew to OD600=0.4~0.6, and continuously cultured for 3 h.

Purification of recombinant CsUBC

A single transformant was inoculated into 2 ml LB media containing 100 μg/ml ampicillin and cultured overnight. Then, the overnight culture was diluted into 200 ml LB containing 100 μg/ml ampicillin, and grew at 37°C for 3 h. The bacterial cells were induced with 1 mmol/l IPTG for 3 h before harvesting at 5,000 g for 10 min at 4°C. The cell pellets were resuspended in PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4) containing 0.5 mM PMSF and 2 mM β-mercaptoethanol, for sonication for 10×1 min with 1-min pauses. The homogenate was centrifuged at 12,000 g at 4°C for 15 min, and the supernatant was collected and loaded onto glutathione Sepharose 4B resin (Ambion Biotech). GST–CsUBC fusion protein was cleaved with 2U thrombin (Phamacia) at 22°C overnight. The cleaved protein was loaded again onto the glutathione Sepharose 4B resin for the purified CsUBC protein. Protein concentration was determined using the Bradford method (Bradford 1976)

Thiolester formation and histone ubiquitination assays

CsUBC activity was assessed with some modifications according to a previously described approach (Sun et al. 1997). The thiolester formation reaction mixture contained 1 μg purified recombinant CsUBC, 0.3 μg rabbit E1 (Calbiochem), and 1 μg ubiquitin His·tag (Calbiochem) incubated in a total volume of 20 μl of 50 mM Tris-HCl, pH 7.5, 0.2 mM DTT (dithiothreitol), 5 mM ATP, and 5 mM MgCl2 at 37°C for 30 min. The reaction was stopped with Laemmli sample buffer without β-mercaptoethanol. Protein samples were separated on 12% SDS-PAGE (SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis), and transferred to a nitrocellulose membrane. The membrane was incubated in PBST (0.1% Tween-20 in PBS) supplemented with 0.5% (w/v) commercial skim milk powder overnight at 4°C, washed twice with PBST on a rocker platform, and incubated for 2 h at room temperature with mouse anti-penta histidine monoclonal antibody (Qiagen), 1:2,000 diluted. After three washes with PBST, the membrane was incubated for 2 h at room temperature with goat anti-mouse IgG labeled with horseradish peroxidase (Santa Cruz), 1:2,000 diluted. After washing the membrane with PBST three times, we added ECL plus Western blotting detection reagents (Amersham Pharmacia Biotech) onto the membrane surface and incubated for 5 min at room temperature, then wrapped the membrane with a fresh piece of SaranWrap and exposed it to an X-ray film for 10~30 min. Thiolester linkage was confirmed by the observed instability of the product after boiling the sample prior to electrophoresis for 5 min in 4% β-mercaptoethanol.

To monitor ubiquitination of histone H2A, 3 μg of H2A was added to the thiolester formation reaction mixture, and we continued to incubate at 37°C for 30 min. Samples were boiled for 4–5 min in the presence of β-mercaptoethanol, and resolved on a 12% SDS-polyacrylamide gel. Ubiquitination of histone H2A was also determined by the method of Western blotting plus ECL as above.

Results

Cloning and analysis of the C. sinensis UBC gene

During the large-scale cDNA sequencing of the adult C. sinensis cDNA library, a novel C. sinensis cDNA was obtained with an open reading frame of 471 bp that encodes a protein of 156 amino acids (Fig. 1). DNA sequence analysis using BLASTN showed that no DNA sequence was found being highly homologous to the C. sinensis cDNA, while the protein sequence analysis using BLASTP showed that many E2s of different species were found being highly homologous to the putative CsUBC. It has 77% amino acids identity with the human ubiquitin-conjugating enzymes HHR6A and HHR6B, and 64% identity with S. cerevisiae RAD6. There are three in-frame stop codons upstream of the ORF, and a polyadenylation signal at the 3′-end of the sequence. Comparison of the CsUBC protein with some other members of this family showed that the conserved amino acids in other species were also conserved in C. sinensis UBC (Fig. 2). The putative molecular mass of the deduced peptide of the CsUBC was calculated to be 17.76 kDa, and the isoelectric point to be 4.33.

Fig. 1
figure 1

Nucleotide sequence and the deduced amino acid sequence of the C. sinensis UBC cDNA. The putative translation start codon is in bold letters and the stop codon is indicated by an asterisk. The three stop codons in the 5′-flanking region are in italics, and the polyadenylation signal at the 3′-end is underlined

Full size image
Fig. 2
figure 2

Amino acid sequence comparison of Clonorchis sinensis E2 (CsUBC) with other members of E2 proteins from humans (HHR6A and HHR6B), Saccharomyces cerevisiae (ScRAD6), Caenorhabditis elegans (CeUBC1), Drosophila melanogaster (Dhr6), and Arabidopsis thaliana (AtUBC1). Highly conserved amino acids are represented by shaded type. The putative active cysteine is marked with an arrowhead

Full size image

Expression and purification of the CsUBC protein

The putative CsUBC cDNA ORF was amplified by PCR and cloned into the expression vector pGEX4T1 (Fig. 3). A recombinant pGEX4T1 containing CsUBC cDNA was sequenced with pGEX4T1 forward primer, and revealed that the ORF of the CsUBC was in frame to the Sj26GST (Schistosoma japonicum 26-kDa glutathione S-transferase) tag of the vector. The recombinant CsUBC was induced by IPTG and overexpressed as a fusion protein to Sj26GST in E. coli BL21 (DE3). The fusion protein, with a molecular mass of about 43 kDa, was purified to homogeneity with a single round of glutathione Sepharose 4B affinity chromatography. After digestion with thrombin, a pure recombinant CsUBC was produced. The concentration of the purified protein was 0.93 mg/ml, and it was used for the analysis of the UBC enzymatic activity.

Fig. 3
figure 3

Expression and purification of recombinant C. sinensis UBC. Proteins were resolved on 12% SDS-PAGE and stained with Coomassie blue. Lane 1 Protein marker, lane 2 uninduced pGEX–CsUBC fusion, lane 3 pGEX–CsUBC fusion induced for 3 h, lane 4 soluble fraction of the induced fusion, lane 5 fusion protein purified with glutathione sepharose column, lane 6 recombinant CsUBC digested with thrombin

Full size image

Thiolester and conjugation assays

The activity of the purified recombinant CsUBC was detected by its ability to accept a ubiquitin from a ubiquitin-activating enzyme (E1), forming a thiolester bond with a conserved cysteine residue, and transferring the ubiquitin to either a substrate or a cognate ubiquitin protein ligase (E3). The ubiquitin we used here was a fusion with 6×His tag, so the protein bonds containing ubiquitin could be detected using anti-penta-histidine antibody. The thiolester linkage is stable under nonreducing conditions but is cleaved under reducing conditions. As can be observed in Fig. 4a, the reaction mixture containing all the UBC, E1 and ATP treated with Laemmli sample buffer without β-mercaptoethanol results in the formation of the thiolester bond in E1–Ub and E2–Ub, while the thiolester bond of E2–Ub could not be formed in the absence of either E1 or ATP, because the formation of E1–Ub is ATP-dependent.

Fig. 4a, b
figure 4

Thiolester bond and histone conjugation assays. a Thiolester bond formation between recombinant CsUBC and His tag ubiquitin was at 37°C for 30 min in a 20-μl mixture containing rabbit E1, recombinant CsUBC (E2), and ATP under reducing and nonreducing conditions (lanes 7, 8). Control reactions were performed in the absence of E1 (lanes 1, 2), ATP (lanes 3, 4) or E2 (lanes 5, 6), to verify that the emergence of the CsUBC–ubiquitin (E2–Ub) band depends on the presence of all three of these components. As seen, no band corresponding to E2–Ub forms when any of these components is missing. Samples were heated to 100 °C for 5 min in Laemmli sample buffer with (lanes 1, 3, 5, 7) or without (lanes 2, 4, 6, 8) β-mercaptoethanol prior to resolution on SDS-PAGE. b Histone–ubiquitin conjugation reaction was carried out at 37 °C for 30 min with (lane 1) or without (lane 2) 3 μg bovine histone H2A. As indicated in lane 1, monoubiquitination and multiubiquitination of histone H2A were formed in the reaction (uH2A adducts of ubiquitin and histone H2A)

Full size image

Addition of histone H2A to the thiolester reaction mixture showed that CsUBC can ubiquitinate histones in vitro. This reaction does not require additional factors (such as E3) but depends on the E1 and ATP. The results can be seen in Fig. 4b—both the monoubiquitinated and the multiubiquitinated histones were detected.

Discussion

A cDNA encoding a ubiquitin-conjugating enzyme was cloned from Clonorchis sinensis by a cDNA library construction and large-scale sequencing. This is a rapid and efficient procedure for generating a C. sinensis EST database, and cloning cDNAs of great importance in growth and development. We determined the E2 sequence from many different clones. In the sequence analysis of E2, we obtained different results with the DNA and protein homologous research. Further analysis of the open reading frame of C. sinensis cDNA and human HHR6A showed that their different bases mostly lie in the third position of codons (data not shown). This suggests that C. sinensis and humans have different codon preferences for the same amino acid in the evolution progress.

Although representing different sizes, structures and functions, all E2s identified have a conserved domain of roughly 16 kDa (called the UBC domain). This domain exhibits at least 35% sequence identity in all known E2 enzymes, and includes a centrally located cysteine residue required for ubiquitin–enzyme thiolester formation (Jentsch 1992). There are three cysteines in the positions 25, 88, and 144 of the CsUBC sequence. Based on the homology to the E2 active-site motif HXN(I/V)X3/4GX(I/V/L)C(I/L)X(I/V), Cys88 is most likely to be the active site where the thiolester bond between ubiquitin and CsUBC forms (Fig. 2). The amino acids sequence surrounding the putative active-site cysteine residue is highly conserved. It is indicated that this region may form a conserved domain for accepting ubiquitin from E1–Ub thiolester adducts.

Histone ubiquitination is an important mechanism of regulating the cell cycle. Our results showed that the recombinant CsUBC expressed in E. coli has the ability to form a thiolester linkage with ubiquitin, as well as to transfer ubiquitin to histone H2A in an E3-independent manner. Previous studies showed that some E2s could transfer ubiquitin to the model substrate histone in vitro without the participation of E3s, such as yeast RAD6/UBC2 and CDC34/UBC3, because the highly acidic C-terminus of the two enzymes is required for this in vitro activity (Sung et al. 1988; Goebl et al. 1988). Studies on human UBCH2 also revealed that its C-terminal acid domain was responsible for interacting with substrate proteins (Kaiser et al. 1995). For UBC8, however, the homolog of human UBCH2 in yeast with a C-terminal acidic extension, the amino-terminal residues are required for the ubiquitination of histones in vitro (Kaiser et al. 1994). C. elegans UBC1 is a ubiquitin-conjugating enzyme homologous to yeast RAD6/UBC2. Despite its possession of an acidic carboxy-terminal tail, it is unable to transfer ubiquitin to histone H2B in vitro (Leggett et al. 1995). These structure differences in the ubiquitination of histones may be explained by different E2s having their own individual sites for substrate recognition.

In conclusion, we isolated a gene encoding a new member of ubiquitin-conjugating enzymes. The high homology between the UBC in Clonorchis sinensis and human RAD6 suggests that they may have a similar role in vivo. Our results demonstrate that the CsUBC has the basic functions of thiolester formation and histone ubiquitination, which are consistent with the properties of E2s in other species.