Introduction

Normal human diploid fibroblasts have a finite life span in vitro. Fetal fibroblasts divide until near 50 population doubling levels (PDL) or over whereas fibroblasts from older persons exhibit reduced proliferative capacity and senesce after about 20 PDLs (Hayflick 1965). Several key molecules were shown to be involved in the molecular mechanisms of cellular senescence (Allsopp et al. 1992; Ferbeyre et al. 2000; Noda et al. 1994; Uhrbom et al. 1997). A protein named WAF1, CIP1, SDI1, or p21 inhibits both of the cyclin-dependent kinase 2 and PCNA (Chen et al. 1995), and the p21 mRNA level significantly increases in human senescent cells (Noda et al. 1994). Senescent cells, which have shortened telomeres, exhibit fewer doublings than cells with longer telomeres (Allsopp et al. 1992) and also overproduce p53 protein, which participates in G1-arrest in the cell cycle (Kulju and Lehman 1995). Senescent cells increase in cellular contents, but the amount of DNA remains at 2N complement in the majority of cells (Goldstein 1990). Although senescent cells overproduce p53 protein, the cells do not die due to the overproduced p53 and, rather, continue to live for a prolonged time. This means that senescent cells may modify p53 to the latent form or change the subcellular localization and avoid p53-dependent apoptosis. So far, subcellular localization of p53 of senescent cells has not been investigated. Some temperature-sensitive mutant p53 anchors with an intermediate filament vimentin in certain tumor cells (Klotzache et al. 1998). Now it is important to determine whether the majority of overproduced p53 is imported into the nuclei or retained in the cytoplasm. In the present study, we investigated the nuclear import and subcellular localization of p53 in human senescent skin fibroblasts. We found cytoskeletal anchoring of p53 and impaired nuclear import of p53.

It was reported that senescent human fibroblasts manifest large bundles of vimentin filaments with a low locomotive activity and enlarged flat cell shapes (Wang 1985). However, systematic analysis of cytoskeletal proteins of senescent cells has been fully performed, and senescence-associated alteration of the function and expression of cytoskeletal proteins was virtually unknown. Accordingly, we analyzed cytoskeletal proteins of adult senescent, presenescent, and fetal young fibroblasts from human skin and lung tissue. We previously reported a large accumulation of vimentin in senescent adult fibroblasts and an inducibility of cell shape to senescent-like morphology in young fibroblasts by transfection of vimentin cDNA (Nishio et al. 2001), and thereby indicated that the increased production of vimentin is related to senescent cell morphology. In the present study, we report senescence-associated alterations in the abundance of major cytoskeletal proteins and of the components of focal adhesions, and also the cytoskeleton anchorage of overproduced tumor suppressor p53 in senescent human fibroblasts.

Materials and methods

Cell lines and cell culture

Senescent human adult skin fibroblasts TIG101 at PDL of 25, fetal lung fibroblasts TIG3 at PDL of 20, 40, 50, or 60, fibrosarcoma HT-1080, and SV40-transformed fetal lung fibroblasts (WI38-VA13 sub 2 RA) were provided from the Japanese Collection of Research Bioresources Cell Bank (Tokyo, Japan). Fetal skin fibroblasts TIG3S at PDL20-25 were obtained from the Tokyo Metropolitan Institute of Gerontology (Tokyo, Japan). The cells were cultured in Eagle MEM medium supplemented with 10% FCS, 1 mM glutamine, and 60 μg/ml kanamycin and passaged at a split ratio of 1:2 or 1:4. Senescent fibroblasts TIG101 were fully senescent, and their division capacity was almost exhausted and had manifested flattened and enlarged or very elongated cell shapes.

Polyacrylamide gel electrophoresis and Western blotting

Cells harvested with ice-cold saline were washed in hypotonic buffer (10 mM Tris HCl, pH 7.5, 4 mM MgCl, 10 mM KCl, 1 mM DTT, 1 mM PMSF, 10 μg/ml pepstatin, and 7.5 μg/ml leupeptin), incubated for 20 min at 0°C, and homogenized in three volumes of the buffer with a dounce homogenizer. The post-nuclear supernatant obtained by centrifugation at 500 g for 10 min was centrifuged again at 12,000 g for 15 min to obtain the insoluble cytoskeleton. Whole-cell extracts or cytoskeleton pellets in 1xSDS sample buffer were sonicated and heated at 95°C and subjected to SDS-10% PAGE, Atto pageRun: 90 mm(W)×80 mm(H)×1 mm(D) or Compact PAGE:60(W)×60 mm(H)×0.75 mm(D) (Atto, Tokyo, Japan). The separated proteins were stained with Coomassie Blue or by immunoblotting using a PVDF membrane with appropriate primary and secondary antibodies and ECL reagents (Amersham Co.). Specific protein bands were estimated by densitometry with an IS-100 digital imaging system (Alpha Ionotech Corporation).

Antibodies

Primary antibodies used were: monoclonal antibodies of anti-vimentin clone V9 (MBL Co. Ltd. Japan), anti-PCNA clone PC10 (DAKO Japan Co. Ltd.), anti-actin clone AC-40, and anti-β-tubulin clone TUB2.1 (Sigma Chemical Co. Ltd.); anti-p53 Ab-3 OP29 (PAb240) (Oncogene Research Products); anti-p53 DO-1 (MBL Co. Ltd. Japan); anti-human vinculin clone hVIN-1 (Sigma Chemical Co.); and anti-β3-integrin subunit (no.119620), anti-FAK (focal adhesion kinase, F15020), anti-PI3-kinase (P13030), anti-paxillin (P13520), and anti-fibronectin (F14420) from Transduction Laboratory (USA). Goat anti-vimentin polyclonal antibody was obtained from ICN Biomedicals Inc. (USA). A goat anti-mouse IgG peroxidase conjugate (A-6782) and rabbit anti-goat IgG tetramethylrhodamine isothiocyanate (TRITC) conjugate (T-7028) from Sigma Chemical Co. Ltd. (USA) were used as secondary antibodies.

Immunocytochemistry

Subcellular localizations of p53, vimentin, actin, and proteins of focal adhesion complexes were observed by confocal laser scanning fluorescent microscopy (CLSFM) following indirect immunofluorescence staining. Cells grown on glass slips were fixed in 2% formalin for 10 min then in cold acetone at 0°C for 5 min and rehydrated with PBS. The cells were incubated with a primary antibody diluted in PBS containing 5 mg/ml BSA for 1 h. Bound antibodies were detected with fluorescein-conjugated goat anti-mouse IgG (MBL) diluted 1:150 or with TRITC-conjugated rabbit anti-goat IgG (Sigma Chemical Co.) diluted 1:40 in PBS for 1 h. Some of the preparations were counterstained with propidium iodide. The cells were analyzed by MRC1024 confocal laser scanning microscopy (Bio-Rad Laboratories Richmond, CA, USA).

Transfection

Human wild-type p53 cDNA (pProSp53 provided by Japanese Cancer Research Resources Bank, Tokyo) was amplified by PCR with a sense 5′CCAGACTGCCTTCAAGCTTACTGCCATGGAG3′ and an antisense 5′AAGAAGTGGAGGATCCCGGTCTGAGTCAGG3′ primers. The PCR product was digested with HindIII and BamH1 and subcloned into HindIII and BamH1 sites of pEGFP-C3 vector (Clontech) to construct pEGFP-C3-p53. Human embryonic (TIG3S at PDL 25) or senescent (TIG101 at PDL 25) skin fibroblasts were transfected with the expression vector pEGFP C3- p53. The cells in a well (eight-well culture slide) were transfected with 0.6 μg of the vector DNA and 3 μl of lipofectamine 2000 reagent (Life Technologies Inc., USA). The expressed p53-EGFP was identified by immunoblotting with anti-p53 PAb240. Cellular localization of p53-EGFP was analyzed by MRC1024 confocal laser scanning microscopy.

Results

Vimentin protein levels in senescent cells: overexpression of vimentin

Proteins of cytoskeleton fractions were resolved by SDS-PAGE and examined by staining with Coomassie Brilliant Blue R-250 (Fig. 1a, left panel). We showed previously that the 57-kDa protein is vimentin, and its over-expression from a transfected vimentin cDNA renders fetal young fibroblasts characteristic of senescent cell-like morphology (Nishio et al. 2001). As seen in Fig. 1A, the endogenous vimentin protein of embryonic lung fibroblast TIG3 cells increased according to senescence progression (PDL20, 40, 50, and 60). Fully senescent TIG101 cells contained a further large amount of vimentin: 2.34-fold and 1.60-fold more vimentin than TIG3 cells at PDL20 and PDL60, respectively. The TIG3 cells (PDL60) expressed an intermediate vimentin level between those of young cells and the fully senescent cells; the TIG3 cells (PDL60) may be regarded as near-senescent.

Fig. 1
figure 1

A SDS-PAGE of proteins from young and senescent human fibroblasts. Left panel: an equal amount (10 μg) of proteins of cytoskeletal fractions was subjected to SDS-10% PAGE, and the proteins were stained with Coomassie Blue. WI38VA, SV40 transformed fibroblasts; HT1080 human fibrosarcoma; TIG3 fetal lung fibroblasts at PDL 20, 40, 50, and 60; and TIG101 human senescent skin fibroblasts at PDL 25. Molecular weights of marker proteins are indicated on the left. An Arrow indicates vimentin protein of 57 kDa. Right panel: band intensity of vimentin (57-kDa protein) on each lane was estimated as percent of total and shown as the cellular content relative to that of TIG3 cells at PDL20. B Vimentin and actin proteins in young and senescent skin fibroblasts. The whole cell extracts (10 μg proteins) of fetal skin fibroblasts (TIG3S PDL22) and adult skin fibroblasts (TIG101 PDL25) were immunoblotted using antibodies specific for vimentin (left panel) and actin (right panel). The levels of p85 PI3 kinase of these whole cell extracts were quite similar by immunoblotting using anti-PI3 kinase (lower panel). Their relative band intensities were estimated by densitometry.

Full size image

Similar to the TIG3 embryonic lung fibroblasts, fetal skin fibroblasts TIG3S (PDL 22) expressed a significantly lower level of vimentin than senescent skin TIG101 fibroblasts, as shown in Fig. 1B (left panel). Noticeably, the young skin fibroblasts contained 6.6-fold more actin than senescent fibroblasts (right panel). In contrast, the levels of PI3 kinase (p85 subunit) of these fibroblasts were quite similar (lower panel). Therefore, PI3 kinase (p85 subunit) was used as a loading control to characterize the various protein levels in the young and senescent cells, as described later.

Down-regulations of actin and tubulin

Vimentin, actin, and tubulin are the major cytoskeletal components associated with various spatial and mechanical functions of the cell such as cell division and migration. Therefore, they are expected to change their abundance in accord with senescence progression where both the activities of cell division and migration become largely reduced. The cytoskeletal proteins as well as the proteins of PCNA and p53 were examined for their expression levels by immunoblotting. Each protein was detected as a single band with the estimated molecular weight. Senescent adult TIG101 fibroblasts expressed three times more vimentin, four times less actin, and two times less tubulin than the young TIG3 (PDL20) cells (Fig. 2A). The relative abundance of vimentin to actin (Vim/Ac) in senescent TIG101 cells and near-senescent TIG3 cells (PDL60) was 12.4 and 2.64 times as large as that of young TIG3 cells (PDL20), respectively. These high Vim/Ac values suggest that the cellular senescence entails alteration in the levels of these major cytoskeletal proteins.

Fig. 2
figure 2

Cell senescence-associated alterations in protein levels. An equal amount of proteins (10 μg) of whole cell extracts was separated by SDS-10% PAGE with the molecular weight markers and subjected to Western blotting using antibodies specific for each protein examined. Relative band intensities of each protein were estimated, as described in the legend to Fig. 1. A Vimentin, actin, tubulin, PCNA, and tumor suppressor protein p53 in young, presenescent, and senescent fibroblasts. Each protein was detected as a single band with the estimated molecular weight. B Various focal adhesion complex proteins and fibronectin. Relative band intensities were indicated for FAK, vinculin, p85 PI3 kinase, paxillin, c-Src, and fibronectin. The level of FAK, vinculin, and p85 PI3 kinase were invariant between the young (TIG3 pDL20), near-senescent (TIG3 PDL60), and senescent cells (TIG101 pDL25).

Full size image

Down-regulation of PCNA and overexpression of p53

In contrast to increased vimentin, senescent fibroblasts expressed less PCNA, which is a reliable marker of cell proliferation (Fig. 2A). Increased mRNA and protein levels of p53 is another reliable marker for cell senescence (Kulju and Lehman 1995). In fact, the near-senescent (TIG3, PDL60) and senescent adult fibroblasts (TIG101, PDL25) produced 1.6 and 3.3 times more p53 protein, respectively, than young cells (PDL20) (Fig. 2A).

Protein levels of the components of focal adhesion complex, fibronectin, and c-Src

Senescent adult fibroblasts manifest impaired migration and adhere more strongly to culture substrata (data not shown). Accordingly, focal adhesion complex proteins were examined in the cell senescence. The fibroblasts expressed the 92-kDa isoform of β3-integrin at significantly lower levels in accord with senescence progression (Fig. 2B). The transmembrane receptor protein integrins localize to the focal adhesions and link extracellular matrix (such as vitronectin) and cytoplasmic actin fibers through multiple focal adhesion complex proteins. Reduced expression was also found with another component of focal adhesion complex, paxillin, and c-Src whereas other components such as FAK, vinculin, and p85 PI3 kinase subunit were almost at the same levels among the fibroblasts (Fig. 2B). The levels of p85 PI3 kinase especially were quite similar among the young and senescent fibroblasts. Although the reason is not clear in the present study, p85 PI3 kinase is a useful loading control to compare the various proteins between young and senescent fibroblasts. Senescent adult fibroblasts expressed one third and one fifth of paxillin and c-Src proteins, respectively, compared with those of young cells. The patterns of protein levels in senescent cells are divided into three groups: group 1, increased protein levels of vimentin and p53 in senescent TIG101 cells; group 2, decreased protein levels of tubulin, actin, PCNA, paxillin, and c-Src (growth-associated proteins); and group 3, invariable protein levels of the high molecular weight isoform of β3-integrin and PI3 kinase (p85 subunit) or slightly lower levels of FAK and vinculin in senescent cells.

Senescent fibroblasts expressed fibronectin to a lower extent than the young embryonic fibroblasts (PDL 20). The extracellular matrix protein fibronectin is involved in cell-substratum adhesion by binding to integrins. The structure of extracellular fibronectin network of senescent cells was considerably different from that of young cells, as shown below.

Confocal laser scanning fluorescence microscopy (CLSFM) of vimentin filaments, actin stress-fibers, and fibronectin

The cytoskeletal alterations in senescent cells were examined by CLSFM. Overexpression of vimentin in senescent adult skin fibroblasts was evident when compared with embryonic cells (Fig. 3A, a and b). Young fibroblasts showed small cell shapes and short and thinner vimentin filaments while senescent adult fibroblasts exhibited a significantly dense vimentin network with numerous thick and long vimentin filaments. This characteristic difference was confirmed with lung fibroblasts at different PDLs, young cells at PDL20, and near-senescent cells at PDL60: thicker and denser vimentin filaments in the latter cells were evident (Fig. 3B, a and b). Importantly, senescent fibroblasts from the skin and lung showed similar thick and long vimentin filaments irrespective of their different tissue origins (Fig. 3A, b and B, b). In addition, young fibroblasts (PDL 20) with compact cell shapes showed short and prominently thick stress fibers (Fig. 4,a1 and a2). However, senescent adult fibroblasts formed only a few actin fiber (Fig. 4,c1) or thinner actin fibers along the axis of the cell body, which became often discrete and elongated (Fig. 4,c2). Thus, the increased vimentin and decreased actin observed in senescent fibroblasts in immunoblotting (Figs. 1B, and 2A) were consistent with the filament abundance and thickness: denser, thicker, and long filaments with vimentin and fewer and thinner fibers with actin in senescent cells.

Fig. 3
figure 3

Cell shapes and vimentin network structures of young and senescent fibroblasts. A Human fetal skin fibroblasts TIG3S at PDL 25 (a) and senescent adult skin fibroblasts TIG101 at PDL25 (b), or B fetal lung fibroblastsTIG3 at PDL 20 (a) and at PDL 60 (b) were cultured and processed for immunofluorescence staining of vimentin filaments. Single images of the sections (512×512 pixels; 40×objective; pixel size 0.31 μm) of FITC-fluorescence (vimentin) were observed by confocal laser scanning fluorescent microscopy (CLSFM) (Kalman method, N:4). Bars: 50 μm

Full size image
Fig. 4
figure 4

Immunofluorescence analysis of actin fibers and fibronectin in young and senescent fibroblasts. Human fetal lung fibroblasts TIG3 at PDL 20 (a1, a2, b) and senescent adult skin fibroblasts TIG101 at PDL 25 (c1, c2, d) were processed for immunofluorescence staining of actin fibers (a1, a2, c1, c2) and fibronectin (b, d). The confocal images of FITC fluorescence were obtained as described in the legend to Fig. 3. N nucleus. Bars: 50 μm. Young cells expressed the prominent actin fibers along the long axis of the cell body. The enlarged or elongated senescent cells expressed a few actin fibers or poor and discrete actin fibers, indicated by arrow heads.

Full size image

Cells assemble a fibrillar fibronectin at their basal cell surface. Fibronectin secretion and binding to cell surface receptors initiated fibronectin matrix formation and followed assembly and reorganization of the cell-surface-associated fibronectin into fibrils. Young and senescent fibroblasts showed different extracellular network structures of fibronectin (Fig. 4,b and d). Young cells formed a prominent reticulum network of thick fibronectin fibers, but senescent cells formed thin fibers being aligned in parallel around the periphery of the cells and nonfibrillar and amorphous fibronectin structure around the nucleus. This staining pattern may reflect intracellular localization of fibronectin due to retardation of the secretion.

Alteration in size and localization of focal adhesions

When observed by CLSFM, focal adhesion attachment proteins such as β1-integrin, β3-integrin, FAK, vinculin, and paxillin all localized similarly in thick and large focal adhesions in young embryonic fibroblasts, as shown here with vinculin (Fig. 5,a, b and c). Whereas senescent fibroblasts expressed numerous and smaller focal contact sites near the periphery of the cytoplasm (Fig. 5,d and e). The shapes and sizes of these focal adhesions of young (arrows in Fig. 5,f and g) are clearly different from those of senescent fibroblasts (arrow heads in Fig. 5,h, i and j).

Fig. 5
figure 5

Focal adhesions of young and senescent fibroblasts. Focal adhesions of human fetal lung fibroblasts TIG3 at PDL 20 (a), fetal skin fibroblasts TIG3S at PDL 22 (b, c), and senescent adult skin fibroblasts TIG101 at PDL 25 (d, e) are shown by staining with an antivinculin antibody. The cell nuclei (b, c) were counterstained with propidium iodide. Confocal images (40× objective) were obtained, as described in the legend to Fig. 3. Young fibroblasts exhibit large focal adhesions (a, b, c), and senescent cells exhibit numerous smaller focal adhesions or nonapparent focal adhesions (d, e). Bars: 50 μm. In the close-up views under the same magnification, the shapes and sizes of the focal adhesions are surrounded with a broken box (in panels a, c, d, e) were compared between young (f, g) and senescent cells (h, i, j).

Full size image

Cytoplasmic localization of p53 protein in cell senescence

Senescent adult fibroblasts (TIG101 at PDL25) markedly increased the abundance of p53. It is known that senescent human fibroblasts increase in mRNA and protein levels of p53 (Kulju and Lehman 1995). However, its subcellular localization in human senescent cells was not fully investigated. Young fibroblasts showed a weak cytoskeletal staining with an anti-p53 antibody PAb240 (Fig. 6A, a). In senescent cells, this antibody did not stain nuclear p53 but did strongly p53 associated with the cytoskeletal structure that appeared to be vimentin filaments (Fig. 6A, b). This differential staining in immunofluorescence is due to the specificity of antibody PAb240: it selectively reacts with p53, having a variant conformation (Cho et al. 1994). In contrast, other anti-p53 antibodies, PAb421 and DO-1, preferentially stained nuclear p53 but not that on the cytoskeleton in senescent cells (data not shown), thereby confirming the specificity of the antibody PAb240. That the p53-associated cytoskeleton is vimentin filaments was shown by double-immunofluorescent staining of senescent cells with anti-p53 PAb240 and an anti-vimentin antibody, which showed almost perfect overlapping of the green fluorescence (p53) and red fluorescence (vimentin) (Fig. 6B, a, b), thereby indicating that senescent cells anchor the p53 protein to vimentin filaments. Cell fractionation showed that only a low level of p53 was cytoplasmic in young TIG3S cells whereas more than 90% of p53 protein was so in senescent TIG101 cells (Fig. 7A, left panels). To confirm the cytoskeletal anchorage of p53 protein, senescent or young fibroblasts were transfected with a p53-EGFP expression vector, and the localization of expressed p53-GFP was tested. The p53-EGFP localized in the nuclei in young cells (Fig. 7B, a); in senescent cells, however, the p53-EGFP significantly remained in the cytoplasm (Fig. 7B, b). Under the same conditions, the reference EGFP-tagged histone H2B localized exclusively in the nuclei in senescent cells (data not shown). In addition, the fluorescence distribution of overexpressed GFP-p53 in TIG101 cells (Fig. 7B, b) is different from the patterns of the endogenous p53 (Fig. 6B, a). The reason for the difference is not clear in the present study. A possible explanation is that senescent TIG 101cells might accumulate the modified p53 protein that easily or firmly associates with the vimentin filaments and saturates the p53 binding sites on the cytoskeleton. Thereby, the overexpressed GFP-p53 cannot displace the endogenous p53 protein bound on the cytoskeleton. In young cells, GFP-p53 could be transported to the nuclei. In contrast, the majority of the expressed GFP-p53 remained in the cytoplasm of senescent cells. Therefore, the nuclear import or export system of p53 might be specifically impaired or altered in senescent cells.

Fig. 6
figure 6

Localization of p53 protein on vimentin cytoskeleton in senescent fibroblasts. A Fetal skin fibroblasts TIG3S at PDL 25 (a) and senescent adult skin fibroblasts TIG101 at PDL25 (b) were stained with a mouse monoclonal anti-p53 (PAb240) (a, b). PAb240 is specific for a conformation variant of p53 protein. B Senescent TIG101 cells were double-stained with PAb240 (a) and a goat anti-vimentin polyclonal antibody (b) followed by a secondary anti-mouse antibody (green) and a secondary anti-goat antibody (red). The p53 localizes on vimentin cytoskeleton, as seen in the merged image (c). Bars: 50 μm.

Full size image
Fig. 7
figure 7

Cytoplasmic localization of p53 in senescent fibroblasts. A Total cell extracts (total) and vimentin-cytoskeleton fractions (cyto) were prepared from human fetal skin fibroblasts TIG3S at PDL 25 and senescent adult skin fibroblasts TIG101 at PDL25 and analyzed by immunoblotting using an anti-p53 antibody (DO-1), an anti-PI3 kinase antibody, or an anti-vimentin antibody. Numbers are the ratios of band intensities. B Young TIG3S fibroblasts (a) and senescent TIG101 fibroblasts (b) were transfected with a p53-GFP expression vector (pEGFPC3/p53). Twenty-four hours later, expressed p53-GFP was observed by confocal laser scanning fluorescent microscopy (CLSFM). Bar: 50 μm.

Full size image

Discussion

Cytoskeletal proteins are major cellular components and play many roles, such as in protein synthesis, signal transduction, cell motility, and cell division. We found that senescent human adult gingival fibroblasts accumulate vimentin protein up to approximately 25% of total cellular protein (Nishio et al. 2001). It seems that the levels of cytoskeletal proteins alter in the progression of cell senescence and that their changes must affect cellular functions. Senescent cells show transcriptional repression of various genes, many of which are involved in cell proliferation (Seshadri and Campisi 1990; Stein et al. 1991; Dimri and Campisi 1994 Dimri et al. 1994;). On the other hand, expression of other genes, such as type 1 collagen, fibronectin, and insulin-like growth factor-binding protein 3, becomes high in senescent cells (Murano et al. 1991). However, senescence-associated changes in the expression of other proteins participating in cell migration and cell shapes, in particular, were not fully elucidated. From the results of the present study, we would like to emphasize that cellular senescence is accompanied by wide changes in the abundance of cytoskeleton proteins.

Extraordinary accumulation of vimentin in senescent fibroblasts

Senescent adult fibroblasts extraordinarily produce vimentin protein. Inversely, actin level becomes several-fold less than that of young cells. The actin gene promoter is growth-regulated (Onyia et al. 1995). In accord with the levels of PCNA, young fibroblasts grew fast, senescent cells grew slowly (data not shown), and actin levels became high in young cells and low in senescent cells. Young cells show thick and short stress fibers, which are known to be important in determining the cell shape and the direction of cell movement and are characteristic of actively proliferating cells. In contrast, actin fibers become significantly thin and long in senescent cells.

The molecular mechanisms of senescence-associated increase in the expression of vimentin are not known. High expression of vimentin may be regulated transcriptionally: transcription factor NF-κB activates the key regulatory element of the human vimentin promoter (Lilienbaum and Paulin 1993). Transcriptional activation by NF-κB with bound coactivator p300 is stimulated by CDK-inhibitor p21 through inhibition of the p300-associated CDK (Perkins et al. 1997). It is also known that a large increase in the p21 mRNA is associated with cellular senescence in human fibroblasts (Noda et al. 1994). Similarly, NFκB was shown to activate the p53 promoter (Wu and Lozano 1994). Hence, the senescence-associated increase in the synthesis of vimentin and p53 may be brought about by NF-κB through transcriptional activation in collaboration with CDK inhibitor p21. It is well known that cataract formation in the lens is one of the aging-associated syndromes. Overexpression of chicken vimentin gene in transgenic mice interferes with normal differentiation of lens fibers and leads to cataract formation (Capetanaki et al. 1989). The age of the cataract appearance and extent of abnormality directly correlate with increased vimentin levels. These results together with our findings suggest that in cellular senescence, augmented vimentin production occurs and that overproduced vimentin may promote senescence-related pathogenesis.

Focal adhesion complex proteins

Senescent and presenescent fibroblasts did not show significant alterations in the protein levels of FAK, β3-integrin, vinculin, and p85 regulatory subunit of PI3 kinase. However, senescent cells expressed a reduced level of paxillin and c-Src proteins. In actively growing cells, c-Src activates its tyrosine kinase, associates with FAK and paxillin, and phosphorylates them (Clark and Brugge 1995; Kaplan et al. 1994). Therefore, the observed down-regulation of c-Src is consistent with the cell senescence: the reduced c-Src is thought to result in tyrosine hypophosphorylation of FAK and paxillin and contribute to the lowered signal transduction, leading to the impaired capacity in cell proliferation and migration of senescent cells. Integrins mediate extracellular signals from the matrix to the inside of the cells and are involved in the assembly of focal adhesions. Young embryonic skin fibroblasts show prominent clustering of β1 and β3 integrins and the recruitment of FAK, paxillin, tensin, and the additional focal adhesion proteins of talin, α-actinin, and vinculin to the large focal adhesions (Gilmore and Burrige 1996; Ridley and Hall 1992). Such focal adhesions were similar to the images shown by the vinculin immunofluorescence staining in Fig. 5. In contrast, senescent fibroblasts developed numerous smaller focal contacts and recruited vinculin to the numerous small focal adhesions at the periphery of the cytoplasm. Because of these numerous small focal adhesions, migration of senescent cells may be reduced. This argument of impaired migration of senescent cells is consistent with the reduced levels of actin, paxillin, and c-Src, which were, in fact, observed in the present study. Fibronectin plays important roles in cell adhesion and migration, wound healing, and inflammation. Extracellular fibronectin fibrils seem to affect the assembly of focal adhesions. Fibronectin secretion and binding to cell surface receptors are important steps to the formation of fibronectin fibrils. A recent investigation reports that fibronectin secretion is growth signal dependent in airway smooth muscle cells (Kazi et al. 2004). The distribution and cellular localization of fibronectin are different between young (Fig. 4b) and senescent fibroblasts (Fig. 4d). The nonfibrillar and amorphous fibronectin structure around the nucleus may reflect the intracellular accumulation in the senescent cells.

The assembly of new stress fibers, clustering of integrins, and formation of focal adhesions depend on the activation of the small GTP-binding protein Rho. RhoA binding kinase (ROK), an effector of RhoA, is not only involved in the reorganization of actin fibers but also binds and phosphorylates vimentin and inhibits the assembly of vimentin filaments (Sin et al. 1998). In addition, Rho activates PtdIns-5-OH kinase, which elevates phosphatidylinositol-4,5-bisphosphate (PtdInsP2). PtdInsP2 interacts with vinculin, unmasks its talin- and actin-binding sites, and stimulates assemblies of focal adhesions and stress fibers (Gilmore and Burrige 1996). Thus, the levels of active Rho and ROKα in senescent fibroblasts may become too low to induce vimentin disassembly and to translocate vinculin for the assembly of large focal adhesions.

Cytoskeletal localization of p53 protein

Although the anti-p53 antibodies PAb421 and DO-1 predominantly stained p53 in the nucleus in senescent cells (data not shown), the antibody PAb240 stained p53 on vimentin filaments in the cytoplasm but not the nuclear p53 (Fig. 6A, b). In fact, immunoblotting indicated a significant amount (>90%) of p53 protein in the senescent cytoskeleton fraction. PAb240 binds specifically to a conformationally altered or a partially denatured p53 (Cho et al. 1994). By mutation or posttranslational modification that exposes the buried epitope, p53 becomes to be recognized by PAb240 (Greenblatt et al. 1994). Senescence-associated phosphorylation occurring at specific sites in the C-terminal region of p53 is known to reduce or increase markedly bindings by C-terminally directed antibodies (Webley et al. 2000). Such senescence-associated posttranslational modification may be responsible for the epitope exposure for the antibody PAb240. It is also known that a temperature-sensitive p53 mutant takes a wild-type conformation at 32°C and localizes in the nuclei, but it remains in the cytoplasm with a varied conformation at a nonpermissive temperature at 37°C (Akakura et al. 2001; Knippeschild et al. 1996). Furthermore, cytoplasmic retention of p53 protein was observed in several cell types (Klotzache et al. 1998; Knippeschild et al. 1996), tumor cells (Giannakakou et al. 2000; Nikolaev et al. 2003), and senescent cells (present work). The present results indicated that the abundance of p53 is increased in senescent cells and anchored to vimentin filaments in the cytoplasm. The EGFP-tagged wild-type p53 expressed by transfection was also retained in the cytoplasm. It is likely that a mechanism is brought about in senescent fibroblasts, which alters the wild-type p53 to a structure recognizable by the antibody PAb240 and results in the retention of the modified p53 to vimentin filaments. Cytoplasmic anchorage of p53 may prevent the inherent action of p53 in the nucleus. The possible effects of this may not only affect p53-dependent apoptosis but also an acceleration of carcinogenesis enhanced by the lowered DNA-repair activity of senescent cells. The mechanism of the cytoplasmic p53 anchorage in senescent cells is an important question but awaits further study to be clarified. This study demonstrated that in cell senescence progression, a significantly wide alteration occurs in the abundance of major components of cytoskeleton: overexpression of vimentin; development of the dense vimentin filament network; down-regulation of actin, paxillin, 92-kDa isoform of β3-integrin, and c-Src; appearance of numerous small focal adhesions; and cytoskeletal anchorage of p53 protein on vimentin filaments. Whether these alterations of cytoskeletal structures are general phenomena in other types of senescent cells is an interesting question. Cytoplasmic anchorage of p53 protein may promote carcinogenesis in senescent cells.