Introduction

Plants deploy a variety of active defense responses when challenged by pathogens or elicitors. One of the active defense mechanisms is rapid cell death, also known as the hypersensitive response (HR) (Dangl et al. 1996; Greenberg and Yao 2004; Lamb and Dixon 1997), which contributes to pathogen limitation.

It is now apparent that one of the earliest events during plant HR is a rapid oxidative burst, caused by the release of reactive oxygen species (ROS) by elicited plant cells (Lamb and Dixon 1997; Levine et al. 1994). Pharmacological, molecular, and genetic studies strongly support the idea that the primary source of ROS is a superoxide (O2 −) generating membrane-bound NADPH oxidase. Diphenylene iodonium (DPI), which is an inhibitor of NADPH oxidase, blocks the fungal elicitor-stimulated oxidative burst in plant cells (Desikan et al. 1996; Lamb and Dixon 1997).

Harpin protein HrpNEa coding by the hrp gene clusters secreted by Erwinia amylovora via its type III secretion system (T3SS) was one of the first bacterial elicitors characterized as inducing activation of MAPK cascades, cell death and systemic acquired resistance (SAR) (Desikan et al. 1999, 2001; Dong et al. 1999; Jang et al. 2006; Reboutier et al. 2007; Wei et al. 1992). Recently, Sinn et al. (2008) reported that the C-terminal half of HrpNEa plays a specific role in its secretion by the T3SS and in its virulence and avirulence activities while the N-terminal half of the protein was sufficient for cell-free elicitor activity. Transcription study showed that harpin may be involved in regulation of cell wall biogenesis, cellular communication in Arabidopsis (Livaja et al. 2008). Several studies have suggested the role of salicylic acid (SA) and ethylene-mediated signaling pathway in harpin-induced plant growth and defense response (Chuang et al. 2010; Dong et al. 1999; Liu et al. 2010; Peng et al. 2003; Samuel et al. 2005). Additionally, Methyl jasmonate treatment inhibited the harpin-induced cell death, H2O2 generation and phenylalanine ammonia-lyase (PAL) gen expression (Andi et al. 2001).

Harpin treatment also leads to H2O2 accumulation during HR in Arabidopsis and tobacco. It is now apparent that this oxidative burst is mediated by an NADPH oxidase-like enzyme in Arabidopsis and tobacco (Desikan et al. 1996; Zhang et al. 2009). In several previous studies, DPI treatment inhibited harpin-induced H2O2 accumulation (Ichinose et al. 2001; Xie and Chen 2000). It is also reported that harpin-induced H2O2 production is also from the chloroplasts and mitochondria, and H2O2 production by the mitochondrial electron transfer chain is less than chloroplastic H2O2 generation in photosynthetic tissues. However, several papers have previously reported that mitochondrial H2O2 has more important role rather than H2O2 generation from NADPH oxidases and H2O2 accumulation in the chloroplasts in harpin-induced cell death in Arabidopsis and tobacco (Garmier et al. 2007). Furthermore, alternative oxidase (AOX), a mitochondrial superoxide production oxidase, activity and transcripts level have been observed in plant during elicitor-induced cell death (Simons et al. 1999; Vidal et al. 2007). However, the relationships between H2O2 production and the cell death have never been established. A study with inhibitors has suggested that the accumulation of H2O2 is not necessary for harpin-induced cell death in tobacco suspension culture (Ichinose et al. 2001).

To our knowledge, the previous reports of the effect of HrpN mainly focus on dicotyledons, such as Arabidopsis and tobacco, there is no study showing the effect of purified HrpN in monocotyledons. In this study, we aimed to investigate the effect of purified HrpN on cell death and H2O2 production in maize leaves. The present data indicates that HrpN induces HR and SAR genes, but does not lead to H2O2 accumulation in maize leaves.

Materials and methods

Plant material and treatments

Maize seedlings (Zea mays L. cv. Zhengdan 958) were cultured in Hoagland’s solution (pH 6.0) under hydroponics greenhouse condition at 22/26°C (night/day) with a photosynthetic active radiation of 200 μmol m−2 s−1 and a photoperiod of 14/10 h (day/night) for 2 weeks at 3-leaf stage. Tobacco (Nicotiana tabacum cv. NC 89) plants were grown for 6 weeks in soil under controlled environmental condition at a photoperiod of 16/8 h (day/night) at a temperature of 20/25°C (night/day).

HarpinEa protein was a gift from Dr Han-song Dong, and it was prepared and purified as described (Dong et al. 1999). The first fully expanded leaves of maize, and the third and fourth fully developed leaves of tobacco at 6-week-old were infiltrated with different concentrations of HrpN in TE buffer (10 mM Tris, pH 7.5, 0.1 mM EDTA) using a 1-ml hypodermic syringe without a needle. The infiltrated zones were either observed for necrosis development or harvested using a scalpel and stored at −80°C for further analysis.

Detection of cell death in maize leaves using Evans blue staining

Cell death was detected in the leaves by staining with Evans blue according to the method described by Liu et al. (2008). Leaves were taken at the indicated times and soaked in 10 ml of 0.25% Evans blue. They were then washed briefly in 10 ml of water. Leaves were destained in boiling 96% ethanol for 10 min. Then the leaves were transferred to a 60% glycerol solution.

Histochemical detection of H2O2

The H2O2 was visually detected in the plant leaves using 3,3-diaminobenzidine (DAB) as a substrate. Briefly, the leaves were infiltrated with HrpN and then immersed overnight in a 1 mg ml−1 solution of DAB (pH 3.8). The leaves were then decolorized by boiling in ethanol (96%) for 10 min. After cooling, the leaves were extracted at room temperature with 60% glycerol and photographed.

Determination of H2O2 content in leaf extracts

The content of H2O2 was measured by monitoring the absorbance at 415 nm of the titanium peroxide complex following the method described by Jiang and Zhang (2001).

RNA extraction and semi-quantitative RT-PCR analysis

Total RNA was isolated from leaves with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Totally, 3 μg of RNA was reverse transcribed into cDNA by a Revert Aid First Strand cDNA Synthesis Kit (200 units per reaction; Fermentas) at 42°C for 60 min followed by heat inactivation at 70°C for 10 min. PCR amplifications was for pre-denaturation at 94°C for 5 min, 25 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The cDNA was amplified by PCR using the following primers: ZmRbohA, forward GCTAAAAACGGCGTGGATA and reverse GGGCAGAAAGACTGAAAAGAGA; ZmRbohB, forward GGAAGGAGATGCTCGGTCAG and reverse TTGGTGGTCTGGTTCATTTAGG; ZmPR1, forward TGGGTGTCCGAGAAGCAGT and reverse CACAAATCGCCTGCATGGT; ZmPR5, forward ATCTCGGTCATCGACGGCT and reverse GCACACAAATCCAGCTACGT; and ZmACTIN, forward ATTCAGGTGATGGTGTGAGCCACAC and reverse GCCACCGATCCAGACACTGTACTTCC. The PCR products were separated in a 1% agarose gel and stained with ethidium bromide. The expression level of each sample was estimated based on the intensity of the band.

SA measurements

HrpN-infiltrated areas were pooled and 0.5 g of tissue was used for measuring the total SA, as described previously (Bowling et al. 1994).

Results

HrpN induces cell death in maize leaves

Maize leaves were infiltrated with 25 μg ml−1 HrpN, a concentration sufficient to cause cell death when infiltrated into tobacco leaves (Fig. 1a). As shown in Fig. 2a, cell death of the infiltrated zone appeared about 24 h after HrpN application, followed by complete drying of the infiltrated zone at 72 h post-infiltration (pi). This rapid dehydration event is believed to play an important role in plant resistance (Dangl et al. 1996; Ren et al. 2002).

Fig. 1
figure 1

Induction of cell death and H2O2 by HrpN in tobacco. a Leaves were infiltrated with buffer and HrpN (25 μg ml−1), and the infiltrated areas are shown at 48 h after buffer infiltration (Bf) and HrpN infiltration (N). b Histochemical detection of H2O2 production with DAB staining at 4 h after buffer infiltration (Bf) and HrpN infiltration (N). Infiltrated leaf areas are indicated by circles

Full size image
Fig. 2
figure 2

HrpN-induced cell death in maize. a Leaves were infiltrated with HrpN (25 μg ml−1), and the infiltrated areas are shown at 24 h after buffer infiltration (Bf) and 24, 48, and 72 h after HrpN infiltration (N). Infiltrated leaf areas are indicated by red boxes. b Leaves were stained with Evans blue at 24 h after buffer infiltration (Bf) and 4, 12, 24, and 48 h after HrpN treatments. Cell death is indicated by a blue color (color figure online)

Full size image

To determine whether HrpN-induced cell death in maize leaves, we used Evans blue staining to detect cell death. Cell death was first observed at 12 h pi of maize leaves, leading to complete necrosis at 48 h pi (Fig. 2b). Infiltration of the leaves with buffer alone did not produce any cell death symptoms (Fig. 2a, b). Furthermore, concentrations of HrpN greater than 25 μg ml−1, such as 100, 250 and 500 μg ml−1, did not result in a significant increase in the cell death of maize leaves (data not shown).

HrpN induces SAR gene expression

In addition to inducing cell death in Arabidopsis and tobacco, harpin induces expression of PR genes (Peng et al. 2003), which are normally induced during the development of SAR. Therefore, we assayed the expression of ZmPR1 and ZmPR5 in maize leaves treated with HrpN. The results showed that these two genes had similar expression profiles after HrpN treatment (Fig. 3a). As shown in Fig. 3a, the expression of ZmPR1 and ZmPR5 was very low within 4 h, and significant increased at 8 h, which was maximized at 12 h and remained high for 48 h after HrpN infiltration.

Fig. 3
figure 3

Accumulation of PR mRNAs and SA in leaf areas infiltrated with HrpN. a ZmPR1 and ZmPR5 expression determined by RT-PCR. Lane 1 buffer 24 h; lane 2 HrpN 1 h; lane 3 HrpN 2 h; lane 4 HrpN 4 h; lane 5 HrpN 8 h; lane 6 HrpN 12 h; lane 7 HrpN 24 h; lane 8 HrpN 48 h. b Leaves were infiltrated with buffer (Bf) and HrpN (N) for various times and the infiltrated areas were harvested and analyzed for SA accumulation by HPLC. a Experiments were repeated at least five times with similar results. b The values are the means of at least three independent experiments

Full size image

Salicylic acid plays a central role in plant defense against pathogens, most prominently as an essential agent in the establishment of SAR. Previous results suggested that induction of SAR by harpin in challenged plant cells requires the participation of SA (Peng et al. 2003; Samuel et al. 2005). Therefore, we measured the total SA accumulation in maize leaves following infiltration with a HrpN concentration (25 μg ml−1) that led to cell death over a period of 24–72 h. The leaves after infiltration displayed a high level of SA accumulation over a period of 24 h (Fig. 3b), and the level of SA is also increased after 8 h, which is sufficient to induce the expression of ZmPR1 and ZmPR5. These results clearly suggest that HrpN induces SAR genes and SA accumulation in maize leaves.

HrpN does not induce H2O2 accumulation in maize leaves

Previous studies have shown that harpin-induced cell death was accompanied by rapid generation of hydrogen peroxide (H2O2), one of the ROS (Desikan et al. 1996; Zhang et al. 2009). Harpin-induced H2O2 production in leaf extracts was examined using histochemistry with DAB staining and spectrophotometry; DAB reacts with H2O2 in the presence of peroxidases to produce a detectable brown polymerization product. Treatment with HrpN-induced significant H2O2 accumulation at 4 h pi of tobacco leaves (Fig. 1b). Surprisingly, a time-course analysis of DAB staining showed that treatment with HrpN did not lead to H2O2 accumulation in the infiltrated zones over a period of 12 h but that the color mainly appeared in the major veins of the leaves (Fig. 4a). Spectrophotometry was used to quantify the content of H2O2 in the maize leaves. HrpN did not lead to H2O2 accumulation in maize leaves within 12 h after HrpN treatment (Fig. 4b).

Fig. 4
figure 4

H2O2 generation after HrpN elicitation. a Histochemical detection of H2O2 production with DAB staining. b H2O2 was assayed by spectrophotometry as described in “Materials and methods”. c Expression of ZmRbohA and ZmRbohB in leaf areas infiltrated with HrpN as analyzed by RT-PCR. Lane 1 buffer 2 h; lane 2 HrpN 1 h; lane 3 HrpN 2 h; lane 4 HrpN 4 h; lane 5 HrpN 6 h; lane 6 HrpN 8 h; lane 7 HrpN 12 h. a, c Experiments were repeated at least five times with similar results. b The values are the means of at least three independent experiments. Means denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple range test. Bf buffer; N HrpN; Control 4 h after 100 mM H2O2 infiltration

Full size image

Genetic evidence shows that H2O2 generated by NADPH oxidase plays important roles in elicitor-induced HR and that harpin-induced H2O2 accumulation is inhibited by DPI, an inhibitor of the NADPH oxidase (Desikan et al. 1996). Therefore, we analyzed the expression of ZmRbohA and ZmRbohB after HrpN treatment using semi-quantitative RT-PCR. ZmRbohA was constitutively expressed at a very low level, whereas ZmRbohB was not induced within 12 h in the presence of HrpN (Fig. 4c). These results suggest that HrpN does not induce H2O2 accumulation in maize leaves during cell death.

Discussion

The aim of this study was to determine the disease resistance induced by E. amylovora HrpN in maize. In previous work, harpin was shown to induce cell death and SAR genes in Arabidopsis and tobacco (Peng et al. 2003), and our data confirm that HrpN does induce HR in tobacco (Fig. 1a). The results of the present study showed that HrpN not only induced HR, but also induced the expression of ZmPR1 and ZmPR5 in maize leaves (Figs. 2, 3a), suggesting that HrpN can lead to induced HR and SAR both in dicotyledons and monocotyledons.

The role of SA in the induction of cell death has been clearly established by both gain- and loss-of function data (Raffaele et al. 2006; Samuel et al. 2005). Harpin-induced cell death does not occur in NahG transgenic Arabidopsis and tobacco, which do not accumulate SA (Peng et al. 2003; Samuel et al. 2005). Our results showed that SA accumulation preceded cell death following HrpN infiltration (Fig. 3b), partially supporting the requirement for SA in harpin-induced cell death in maize.

Plant cells challenged with HR-inducing pathogens or elicitors display two peaks of H2O2 generation. The first rapid but weak transient burst of H2O2 production is not specific to HR. The second increase of H2O2, which occurs between 3 and 6 h after inoculation, precedes the onset of HR cell death and is specific for HR-inducing pathogens or elicitors (Lamb and Dixon 1997). Harpin treatment leads to H2O2 accumulation in tobacco and Arabidopsis, and our data also shows that treatment with 25 μg ml−1 HrpN for 4 h leads to H2O2 accumulation in infiltrated areas of tobacco (Fig. 1b). Intriguingly, a time-course analysis showed that treatment with HrpN did not lead to H2O2 accumulation in maize leaves or increased expression of ZmRbohA and ZmRbohB (Fig. 4). In studies by Xie and Chen (2000) and Ichinose et al. (2001), DPI, an inhibitor of the oxidative burst, failed to inhibit harpin-induced hypersensitive cell death. Several papers have previously reported that the rapid alternation of mitochondrial function and low levels of ATP play very important roles in harpin-induced hypersensitive cell death and that H2O2 is not the direct cause for harpin-induced inhibition of ATP (Garmier et al. 2007; Krause and Durner 2004; Vidal et al. 2007; Xie and Chen 2000). It is not clear whether low levels of ATP serve as a signal for the induction of HR cell death. However, these results indicated that generation of H2O2 after harpin treatment is not required for cell death induced by harpin or other elicitors. In addition, Delledonne et al. (1998) also reported that H2O2 alone does not induce cell death in soybean cells, which is in agreement with our studies in maize (our unpublished data). Moreover, harpin and exogenous H2O2 have different effects on defense gene expression in Arabidopsis suspension cultures, as harpin led to increased H2O2 generation and expression of PAL, glutathione S-transferase (GST) and anthranilate synthase (ASA1) mRNA, and H2O2 only led to increased PAL and GST mRNA (Desikan et al. 1998). These results suggest that both H2O2-dependent and H2O2-independent pathways are involved in HR cell death signaling in plants. Our results indicated that HrpN induces an H2O2-independent rather than an H2O2-dependent pathway in HR cell death in maize leaves.

Furthermore, in a previous study, active MAPKKs induce cell death and ROS production in tobacco and Arabidopsis (Ren et al. 2002). More recently, it has been reported that OsMKK4DD-induced cell death without extracellular ROS production in rice cells, while OsMKK4DD-induced cell death and ROS production in Nicotiana benthamiana (Kishi-Kaboshi et al. 2010). This is consistent with our observation that HrpN induces cell death and H2O2 production in tobacco, while HrpN induces cell death without extracellular H2O2 production in maize leaves. However, further studies needed to investigate the mechanism of the different process of HrpN-induced cell death in dicotyledons and monocotyledons. Taken together, HrpN-induced cell death in maize leaves may be not the result of the generation of H2O2.