The least studied class I region of the MHC in rat and mouse is the 1-Mb M region (Takada et al. 2003). Its central 30-kb part encodes three class I genes: M6, M4, and M5. Based on the conserved genes flanking this region, the map position of these genes is homologous to the 380-kb stretch around HLA-A, -G, and -F in the human MHC (Lambracht et al. 1995; Yoshino et al. 1998; Jones et al. 1999). Recently, new functions have been discovered for class Ib proteins encoded in the proximal M region, which associate with the V2R pheromone receptors of the vomeronasal organ (Loconto et al. 2003).

The class I genes of the central H2-M region in the BALB/c mouse (H2d) were considered to be silent because M4 and M6 are pseudogenes, and no transcripts were detected for M5, which has an open reading frame (ORF) (Wang and Fischer Lindahl 1993). The analysis of this region in the closely related rodent, the rat, shows us a different status for these genes. RT1.M4, M5, and M6 have ORFs, and transcripts were detected in several tissues (D. Lambracht-Washington, Y.F. Moore, K. Wonigeit, and K. Fischer Lindahl, manuscript in preparation). H2-M4 and -M6 are pseudogenes due to single nucleotide changes; for verification of the pseudogene status, we have analyzed M4 exon 3 in nine mouse and ten rat strains and M6 exon 4 in 14 mouse strains.

H2-M4 d carries an early stop codon in exon 3 (Wang and Fischer Lindahl 1993). Generally, exons 2 and 3 of class Ia genes exhibit the most nucleotide differences, yet these exons of M4 show a high degree of similarity, even between species (Fig. 1). To see whether the stop codon is conserved in the mouse, exon 3 was analyzed in nine strains and seven haplotypes (Fig. 1). The mouse M4 alleles show only minor differences, with conservation of the in-frame stop codon at the beginning of exon 3 in all strains analyzed, even in the three haplotypes from wild mice of different species: cas3, sh1, and sp2. The RT1.M4 exon 3 sequences all showed a change from the in-frame stop codon of the mouse to TGG (tryptophan). Due to a nucleotide insertion, RT1 haplotypes l and lv3 carry a different stop codon at the end of exon 3, whereas all other analyzed RT1 haplotypes possess an ORF for this exon. Exon 2 was also sequenced in haplotypes c and n and found to be an ORF as well and identical to exon 2 of l.

Fig. 1
figure 1

Comparison of exon 3 of M4 in various H2 and RT1 haplotypes and in Peromyscus leucopus (p). The exon 3 sequence is divided into three fragments, and for each fragment the strains carrying a given sequence are indicated on the left. Only the exon sequence is shown. Potential stop codons are underlined and boxed. An arrow marks the nucleotide insertion in RT1.M4 causing the stop codon in haplotypes l (LEW) and lv3 (LEW.1LV3). Asterisks indicate alignment gaps. Analyzed were nine mouse strains: m1 BALB/c (H2 d), m2 DBA/2 J (H2 d), m3 BALB-B2mw3/Kfl (H2 d), m4 C3H/HeJ (H2 k), m5 B10.SH1(R27)/Kfl (H2 sh1), m6 C57BL/10SnJ (H2 b), m7 A.CA/J (H2 f), m8 B10.SP2(R40)/Kfl (H2 sp2), and m9 B10.CAS3/Kfl (H2 cas3); and ten rat strains: r1 LEW (RT1 l), r2 LEW.LV3 (RT1 lv3), r3 F344 (RT1 lv1), r4 LEW.1 N (RT1 n), r5 BN (RT1 n), r6 BN.1B (RT1 r37), r7 LEW.1C (RT1 c), r8 PVG (RT1 c), r9 DA (RT1 av1), and r10 BDE (RT1 u). For the exon 2 and 3 sequences of LEW, a cosmid clone (Lambracht et al. 1995) and genomic DNA were analyzed in parallel. The published H2-M4 sequence (L14278) is derived from cosmid clones of a BALB/c subline (Wang and Fischer Lindahl 1993). The sp2 haplotype comes from Mus spretus, the cas3 haplotype from M. m. castaneus, and the sh1 haplotype from a wild mouse from Shanghai (Fischer Lindahl 1994). Exon 3 of M4 was amplified by PCR. The forward exon 3 primer (from intron 2), 5′CTCAAGGATCCATAGAACTACCC3′, was identical for mouse and rat; the reverse primers (from intron 3) were mouse, exon 3 reverse: 5′GGACATGGAATTCACCACTTTGGC3′; and rat, exon 3 reverse: 5′GGACACGGAATTCACCTCTTTGG3′. Primers were designed with recognition sites for restriction enzymes (italics) to facilitate cloning of the PCR products into M13 in both directions. The PCR cycle protocol was as follows: 5 min denaturation at 94°C, followed by 30 cycles of 3 min annealing and polymerization at 65°C and 1 min denaturation at 94°C. To minimize PCR errors, five to ten clones were pooled for DNA isolation, and at least two independent PCRs were done and sequenced for each M4 allele

Full size image

H2-M6 d is a pseudogene due to a single nucleotide deletion in exon 4 (Wang and Fischer Lindahl 1993). We sequenced that exon in 13 other strains. As the nucleotide deletion is conserved in all haplotypes analyzed, we confirmed the pseudogene status of H2-M6 (Fig. 2). The overall sequence for the exon encoding the α3 domain showed variability among the 12 haplotypes (a, b, bac1, cas2, cas3, d, f, k, k2, r, sh1, sp2), which was not seen in the two H2-M6 sequences (d, bc) in the database. Only the sequences of strains B6 (M6 b) and DBA/2 (M6 d) were identical to the database sequences. Strains A.CA (M6 f) and the Asian haplotypes of B10.SH1(R27) (M6 sh1) and B10.BAC1 (M6 bac1) had identical sequences, which showed a number of nucleotide changes relative to the database sequences. In B10.SP2(R40) (M6 sp2), the consensus splice site in the beginning of exon 4 was missing. B10.BR (M6 k2), C3H (M6 k), LP.RIII (M6 r), B10.CAS2 (M6 cas2), B10.CAS3 (M6 cas3), and A/J (M6 a) carried an early stop codon after 8, 14, 15, or 16 amino acids. This variability in the generally conserved exon 4 is consistent with the pseudogene status of M6 in the mouse.

Fig. 2
figure 2

Comparison of exon 4 of M6 in various H2 haplotypes with RT1.M6-1 of the LEW rat. The exon 4 (capital letters) and surrounding intron (lower case letters) sequences are divided into four fragments, and for each fragment the strains carrying a given sequence are indicated on the left. An arrow marks the nucleotide deletion in H2-M6 that causes a stop codon. Potential stop codons are underlined and boxed. Analyzed were 14 mouse strains: those of Fig. 1, except BALB-B2m w3/Kfl (m3), and in addition the following strains: m10 B10.CAS2/Kfl (H2 cas2), m11 C57BL/6 J (H2 b), m12 A/J (H2 a), m13 B10.BAC1(H2 bac1), m14 B10.BR (H2 k2), and m15 LP.RIII/J (H2 r). The LEW sequence is derived from an RT1.M6-1 genomic cosmid clone (Lambracht et al. 1995). For amplification of H2-M6 exon 4, we used the primer pair H2-M6 ex4 forward (5′CTCATCTTGATTCTCCTGTTCATT3′) and H2-M6 ex4 reverse (5′CCTAGCACAGACTCTACT3′), located in introns 3 and 4, respectively, and the following PCR protocol: an initial DNA denaturation step for 3 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 54°C, and 1 min at 72°C, and a final amplification step for 10 min at 72°C. The PCR products were analyzed by gel electrophoresis and cloned by TA cloning into the pCR1 vector (Invitrogen, Carlsbad, Calif.). DNA was extracted from four to ten clones, and the individual clones were sequenced automatically

Full size image

In a related rodent, Peromyscus leucopus, the M4 gene is intact in all inbred lines analyzed and exhibits intra-species genetic polymorphism (Crew and Bates 2003). Peromyscus and Mus separated 40–60 million years ago; Mus and Rattus separated 10–20 million years ago. The frame-shift mutation in exon 3 of all H2-M4 alleles examined represents an insertion of a single nucleotide relative to the Peromyscus sequence. The presence of the same insertion in two of ten RT1.M4 alleles suggests that M4 was functional in primitive rodents that gave rise to Mus, Rattus, and Peromyscus (Crew and Bates 2003), and that it was already dimorphic for the frame-shift mutation in the Mus/Rattus precursor population. Subsequent to the split of Rattus and Mus, the H2-M4 gene acquired additional single-base mutations, insertions, and deletions, which further distanced the gene from functionality. Several of these mutations appear in some haplotypes but not others; for example, a dinucleotide insertion is present in three of nine H2 haplotypes (Fig. 1). For H2-M6 we propose a similar scenario. The deletion of a single nucleotide in exon 4 caused the loss of functionality. Subsequently, additional deletions and nucleotide insertions occurred which are all, except two, located in the poly-C stretch in the beginning of the exon (Fig. 2). These alterations caused the appearance of additional stop codons in exon 4, further silencing the gene.