Introduction

Endophytes are an important component of plant microbiota, residing in the living tissues of almost every plant and do so in a variety of relationships, ranging from symbiosis to balanced antagonism [9, 41]. They are indispensible mutualistic partners of higher plants that provide various benefits to their hosts. Endophytes are known to provide stress tolerance, both biotic and abiotic, to the plants thus helping them to adapt to different environmental conditions [36, 38, 42]. Further, the plant–endophyte interactions influence plant nutrition, growth rate, as well as plant survival and distribution [27, 40, 50]. In addition to their ecological significance, endophytes represent a huge resource for the isolation of novel biomolecules and biocatalysts for applications in medicine, agriculture, and industry [2, 28, 35]. Endophytic microorganisms undergo a constant process of strain development by passing through various stages of plant growth and development and by way of continued efforts to survive in the host tissues [28, 38, 53]. This fact, coupled with their ecological functions, contributes to their immense metabolic proficiency and advocates the ever increasing interest in such microorganisms for bioprospecting of potential natural products. The ubiquity of these cryptic symbionts is clear, but the scale of their diversity, host range, and geographic distributions are unknown. Some endophytes are host-specific while others are able to colonize multiple host species [17, 18, 38]. Owing to the overwhelming diversity of plants, we are still in the early stages of recognizing the functional roles of endophytes in nature and their real potential as a biological resource.

In this study, an effort was made to investigate the biodiversity of fungal endophytes associated with Pinus wallichiana (blue pine/Bhutan pine) and explore their antimicrobial potential. Conifers, including different species of Pinus, harbor diverse microorganisms as endophytes, varying with species as well as with geographical distribution. They seem to be reservoirs of enormous microbial wealth waiting to be characterized and explored for human welfare [5, 22, 26]. The Himalayan blue pine is native to the Himalayas of Nepal, Myanmar, Bhutan, China, India, Pakistan, and Afghanistan, growing at altitudes ranging from 1,500 to 3,400 m above the mean sea level [56]. In the Jammu and Kashmir state, a total of 20,230 km2 is under forest cover with conifers covering an area of 40.87 % of which 9.73 % is occupied by Pinus wallichiana (locally known as kɒ’yʊr) [3]. The wood of this plant is widely used as timber which is valued next to the wood of Cedrus deodara and is regarded as superior to that of Pinus roxburghii. It is one of the most dominant species of the forest ecosystem of the Kashmir Himalayas and has immense commercial, medicinal, and ecological importance [7, 15, 16]. Moreover, this species is a prominent source of oleoresin which is used for the production of turpentine oil, rosin, needle oil, and camphor. The essential oil of this treasured plant, which has been found to possess potential anticancer and antioxidant properties, comprises of β-pinene, α-pinene, myrecene, camphene, limonene, α-phellandrene, trans-caryophyllene, α-humulene, α-cadinol, and α-bisabolol. In addition, it also contains undecane, dodecane, tridecane, abietic acid, and isopimaric acid [14, 16]. Further, the dark-brown resinous substance (known locally as kɪllʊm/kɪllʌm), extracted from this species, is traditionally used by the farmers of Kashmir to protect their skin from insect bites, skin-cracks, and infections while working long hours in the water-logged rice fields.

The study of endophytes of this majestic Himalayan pine may give an insight into their diversity, distribution, and host affinity which, in turn, may guide to a better management of this plant. Such studies are also imperative to explore the bioactive potential of microorganisms associated with this species and achieve their conservation.

Materials and Methods

Sampling

Small cuttings (about 10 cm) of the stems or twigs of ten symptomless plants were collected from a specific location (34° 31′ 13″ N, 74° 22′ 55″ E) in the Western Himalayas of the Lolab Valley. The Lolab Valley is a Himalayan sub-valley and forms the northwestern corner of the Valley of Kashmir. Multiple numbers of samples from individual trees (n = 10) of Pinus wallichiana were collected in the month of May 2012. The plant materials were transported to the lab in an icebox and stored at 4 °C until processed.

Endophytic Fungal Isolation

Endophytic fungi were isolated as described previously by Ezra et al. [20] and Arnold and Lutzoni [6]. Plant materials were thoroughly washed with running tap water, cut under sterile conditions into small pieces (2–3 cm), and surface-sterilized with 1 % sodium hypochlorite for 2–5 min for needles and stems, respectively, followed by 70 % ethanol for 1 min. Before the treatment with alcohol, traces of sodium hypochlorite were removed by washing with sterile distilled water. After drying under the sterile laminar air flow and briefly passing through the flame, the outer tissues of the stem cuttings were removed. The tissues were cut into smaller segments of around 0.5 cm each. A total of 210 segments (from stems and needles) were evenly plated on different microbiological media such as water agar, potato dextrose agar, and Kenknight and Munaier’s medium (dextrose 1 g, KH2PO4 0.1 g, NaNO3 0.1 g, KCl 0.1 g, MgSO4.7H2O 0.1 g, agar 15.0 g, distilled water 1,000 ml, pH 7.2) supplemented with streptomycin (50 mg l−1) to suppress bacterial growth. The effectiveness of the surface sterilization was confirmed by making imprints of disinfected plant fragments on PDA plates from which no fungal growth was observed [45]. The plates were incubated at 25 °C for 3–4 weeks. Hyphal tips of fungi, emerging out of the plant tissues, were picked and grown on potato dextrose agar in pure culture. After the proper incubation of the plates, 15-day-old cultures were preserved by placing pieces of hyphal growth in 30 % glycerol at −70 °C and also by lyophilization. All the media and chemicals were obtained from Hi Media (India). The cultures were also submitted to the CSIR-IIIM Microbial repository.

For morphological analyses, microscopic slides of each endophyte were prepared by staining with lactophenol cotton blue [10, 30] and were examined under light microscope (Olympus, USA). Based on mycelial characteristics, representative of all unique phylotypes were selected for molecular analysis.

Genomic DNA Extraction

Each endophytic fungus was cultured in PD broth at 25 °C with constant shaking for 7 days. The fungal mycelia were freeze-dried, and the genomic DNA was extracted by the cetyltrimethylammonium bromide (CTAB) method [8]. Briefly, 500 mg of fungal mycelia was vigorously crushed in liquid nitrogen to make a fine powder. The cells were lysed in 10 ml of extraction buffer (50 mM Tris–HCl pH 8.0, 50 mM EDTA, 0.7 M NaCl, 2 % cetrimide, 1 % SDS, and 50 μl β-mercaptoethanol), mixed thoroughly, and incubated at 65 °C for 30 min with continuous shaking. The lysate was extracted with an equal volume of chloroform/isoamyl alcohol (24:1) and centrifuged at 10,000×g for 10 min at 4 °C. The aqueous phase was transferred to a sterile tube; the genomic DNA was precipitated in a 2× volume of chilled isopropanol and centrifuged at 4 °C for 10 min at 10,000×g. The resulting pellet was washed twice with 70 % ethanol, air-dried, and dissolved in 20 μl of sterile Millipore water.

PCR Amplification and Sequencing of ITS (ITS1–5.8S–ITS2) Region

Phylogenetic analyses of the endophytes were carried out by the acquisition of the ITS1–5.8S–ITS2 ribosomal gene sequencing. The ITS regions of the fungi were amplified with the universal ITS primers, ITS4 (5′TCCTCCGCTTATTGATATGC3′) and ITS5 (5′GGAAGTAAAAGTCGTAACAA3′) [58], using the polymerase chain reaction (PCR). The 50-μl reaction mixture contained 1× PCR buffer, 200 μM each dNTP, 1.5 mM MgCl2, 10 pmol of each primer, 1–5 ng of DNA, and 2.0 U of Taq DNA polymerase. A negative control, using deionized water instead of template DNA, was included in each batch of the PCR. The PCR conditions used were as follows: initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 15 s, 55 °C for 30 s, 72 °C for 45 s, and a final extension at 72 °C for 7 min. The amplified products (5 μl) were visualized on 1 % (w/v) agarose gel to confirm the presence of a single amplified band of approximately 600 bp. The amplicons were purified by Amicon Ultra columns (Millipore, USA), and 20–40 ng was used in a 10-μl sequencing reaction using the Big Dye Terminator sequencing kit (v. 3.1). The forward or the reverse primer (2 pmol) was used in the cycle sequencing reactions. Twenty-five cycles of 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min were performed, and the extension products were purified by ethanol precipitation, dissolved in 10 μl of HiDi formamide, incubated at 95 °C for 5 min, and loaded on ABI Prism 377 Genetic Analyzer (Perkin-Elmer) for sequencing. All the reagents for sequencing were from Applied Biosystems, USA. The amplified products were sequenced and aligned with the sequences in the GenBank by BLASTN program [1] to find out the sequence homology with closely related organisms. Sequences from the closely related organisms were downloaded to construct the phylogenetic trees using MEGA software version 4.0 [55]. The neighbor-joining (NJ) method was used to infer the evolutionary history of the fungal isolates, and the bootstrapping was carried out using 1,000 replications. The ITS1–5.8S–ITS2 DNA sequence for each strain was submitted to the GenBank. Accession numbers of the respective strains are provided in Supplementary material Table 1.

Statistical Data Analysis

The colonization frequency (CF) was calculated as the total number of segments colonized by endophytic fungi divided by the total number of incubated segments. The relative species frequency (RF) was calculated as the number of isolates of one species divided by the total number of isolates [59].

The similarity of endophytic fungal assemblages among both tissues was compared using the following similarity indices: Sorensen’s index of similarity (QS), QS = 2a/(2a + b + c), where a is the number of common species in both endophytic populations, while b and c are the number of species specific to stem and needles, respectively [37]. Jaccard’s index of similarity (JS) was calculated using the formula: JS = a/(a + b + c), where a is the number of common species in both mycopopulations, while b and c are the number of species specific to leaf and stem, respectively. Simpson’s diversity was calculated as D = 1 − Ʃpi2, where pi = ni/N, ni being the total no. of isolates of the species i and N being the total no. of isolates of all the species [48]. It gives the probability that two individuals selected at random will belong to the same species. The Shannon–Weaver diversity index (H′) [46] was used to show diversity of the endophytic fungal species and was calculated as: H′ = −Ʃpi (ln pi). Shannon evenness (E) was calculated as H′/H max, where H max = ln(S), with S as the total number of species in the sample. The Shannon evenness index ranges from 0 (when one species is dominant) to 1 (when all species are equally abundant). Species richness was calculated as S/√N, where S = total number of species. The “effective number of species” was calculated as exp (H) where H = Shannon–Weaver diversity index [33].

Antimicrobial Activity of Endophytic Fungal Extracts

All endophytic cultures were cultured at 25 °C for 15 days in 200 ml of PD broth with constant shaking. The fermented broth of each endophyte was homogenized with 10 % methanol, extracted thrice with methylene chloride, concentrated, and dissolved in dimethyl sulfoxide (DMSO) at a concentration of 10 μg/μl. The extracts prepared from the endophytes were evaluated for antimicrobial activity against Escherichia coli ATCC 25922 (Gram negative), Staphylococcus aureus ATCC 29213 (Gram positive), and Candida albicans MTCC 4748 (fungal pathogen). Stock solutions of each culture were prepared in normal saline solution (0.85 % NaCl (w/v)) at a concentration of 108 cells/ml. Two hundred-microliter Mueller–Hinton broth (for Escherichia coli and Staphylococcus aureus) and PD broth (for Candida albicans) were added to each well in the first column, and 100 μl of corresponding media was added to the rest of the wells. Extracts of different endophytes were added to the first row at a concentration of 100 μg/ml and serially diluted to make concentrations of 50, 25, 12.5, and 6.25 μg/ml. Each well was inoculated with 104 cells of the relevant test organism and incubated at 37 °C for 24 h. Each plate had a set of controls: a column with broad-spectrum antibiotics (ciprofloxacin and nystatin) as positive controls, a column without the test extract, and one without the relevant test organism. Absorbance was measured spectrophotometrically at 620 nm, and IC50 of the extracts was calculated from the average percent inhibition of three replicates of each concentration. The percent inhibition by the fungal extract was calculated as [(X − Y)/X] × 100, where X is the change in OD of the control and Y is the change in OD of treated broth. IC50 values were calculated from the graph obtained by plotting the % inhibition against different concentrations of the extract. The cutoff IC50 value was taken as 100 μg/ml [19].

Antimycotic Activity of the Endophytic Fungi

All the endophytes were tested against several plant pathogenic fungi to assess the antifungal potential of their extrolites. Briefly, small plugs (ca. 3 mm diameter) of each test fungi were placed a centimeter away from the edge of a 7-day-old endophytic culture. The plates were wrapped with parafilm and incubated at 25 °C for 24–48 h. Inhibition of the test pathogens was reported as % inhibition as compared to their relevant controls. The diameter of the pathogens was observed after 24 and 48 h to analyze the percentage inhibition of growth as compared to the control plates. The percent growth inhibition (%GI) was calculated as GI (%) = [(KR − R1)/KR] × 100, where KR represents the distance (measured in mm) from the point of inoculation to the colony margin on the control dishes and R1 is the distance of fungal growth from the point of inoculation to the colony margin on the treated dishes in the direction of the antagonist [31].

Results

Diversity and Phylogenetics of Endophytic Fungi

Endophytic fungi were isolated from healthy and symptomless stem and needle segments of Pinus wallichiana to determine the diversity and bioactive potential of these endophytes. A total of 130 endophytic fungal species belonging to 38 different genera were isolated from 210 segments of both needle and stem tissues of the host (Supplementary material Table 1). Three different media were used for the isolation of endophytic fungi, and maximum number of endophytes was obtained from potato dextrose agar (40 %) followed by water agar (30.7 %) and Kenknight and Munaier’s agar (29.2 %), respectively. The molecular identification was supported by the morphological characteristics of the cultures that produced spores under the growth conditioned used in this study. However, many of the endophytes did not sporulate; thus, molecular identification was the only option to ascertain their identity. Among the total number of endophytic fungi (n = 130), isolated from the host, only a single isolate P8S4 (Tritirachium oryzae) belonged to the Phylum Basidiomycota whereas all other isolates belonged to Ascomycota. A total of 49.2 % of isolates belonged to Dothideomycetes followed by Sordariomycetes (33.8 %), Eurotiomycetes (6.9 %), Leotiomycetes (4.6 %), and Pezizomycetes (3.8 %). Thus, the most abundant class of fungi obtained was Dothideomycetes represented by the orders Pleosporales, Capnodiales, and Botryosphaeriales. Sordariomycetes were mostly isolated from needle tissues and represented by the orders Xylariales, Diaporthales, Sordariales, Hypocreales, and Trichosphaeriales. The least abundant classes were Eurotiomycetes represented by the order Eurotiales, Leotiomycetes represented by the orders Rhytismatales and Helotiales, and Pezizomycetes represented by the order Pezizales. The dominant fungi observed were Alternaria spp., Pestalotiopsis spp., Preussia spp., and Sclerostagonospora spp. In the needle tissues, Alternaria spp. (7.6 %) showed the highest isolation frequency followed by Preussia spp. (4.6 %) and Sclerostagonospora spp. (4.6 %) while in the stem tissues, Pestalotiopsis spp. (5.3 %) showed the highest isolation frequency (Table 1). The common species found in both tissue segments were Alternaria spp., Sclerostagonospora spp., Epicoccum spp., Preussia spp., Coniochaeta spp., Trichoderma spp., Pestalotiopsis spp., Phoma spp., Truncatella spp., and Aspergillus spp. Endophytic fungi isolated only from the stem tissues were Cladosporium spp., Rachicladosporium spp., Leptosphaeria spp., Microdiplodia spp., Neurospora spp., Lophiostoma spp., Therrya spp., Lophodermium spp., Glomerella spp., Penicillium spp., Tritirachium spp., and Phomopsis spp. whereas those that were restricted only to the needles were Anthostomella spp., Tricharina spp., Paraconiothyrium spp., Coniothyrium spp., Thielavia spp., Sordaria spp., Lecythophora spp., Rosellinia spp., Pseudoplectania spp., Nigrospora spp., Fusarium spp., Xylaria spp., Sporormiella spp., Cadophora spp., Geopyxis spp., Cochliobolus spp., and Fimetariella spp. (Table 1).

Table 1 Relative frequency of endophytic fungi isolated from stem and needle tissues of Pinus wallichiana
Full size table

The ITS1–5.8S–ITS2 sequences of some nearest neighbors of the endophytic fungal isolates were retrieved from GenBank (NCBI) to construct the phylogenetic tree. The sequences displayed diverse taxonomic affinities among the isolated endophytes. BLAST and NJ analyses placed the sequences into various groups of Ascomycota belonging to five different classes of Dothideomycetes, Sordariomycetes, Eurotiomycetes, Leotiomycetes, and Pezizomycetes (Fig. 1). Eight isolates P1N13 (Coniothyrium carteri), P4S11 (Therrya fuckelii), P1N6 (Anthostomella conorum), P1S14 (Leptosphaeria sp.), P6N9 (Preussia intermedia), P5N1 (Preussia sp.), P3N33 (Pseudoplectania nigrella), and P6N18 (Cadophora malorum) showed a sequence similarity of less than 95 % with known organisms in the GenBank (Supplementary material Table 1). These endophytes could likely be from novel fungal lineages.

Fig. 1
figure 1

Phylogenetic position of the endophytes of the Himalayan blue pine. The evolutionary history was inferred using the neighbor-joining method [44]. The optimal tree with the sum of branch length = 0.96703271 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown next to the branches [21]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the maximum composite likelihood method [54] and are in the units of the number of base substitutions per site. All positions containing alignment gaps and missing data were eliminated only in pairwise sequence comparisons (pairwise deletion option). Phylogenetic analyses were conducted in MEGA4 [55]. The basidiomycete isolate and endophytes, P3N33, P6N9, and P6N18, showing <90 % homology with known fungi were excluded from this phylogenetic tree

Full size image

The biodiversity analysis showed that colonization of endophytic fungi was greater and more diverse in needles (66.9 %) than in stem tissues (53.7 %) (Table 2). The diversity of the endophytic community isolated from both tissues was compared using indices of α-diversity (Shannon–Wiener index and Simpson’s diversity index) and their components, i.e., species richness and evenness (Table 3). The concentration of dominance or Simpson’s dominance of endophytic fungi was almost identical in the foliar (0.041) and stem tissues (0.043). Simpson’s diversity indices of 0.95, in both the tissues, indicate a high diversity of endophytes harbored by the host plant. Shannon–Wiener diversity indices were slightly higher in fungal endophytes of the needle tissues (2.48) than in the stem tissues (2.23). There was a higher species richness of endophytic fungi colonizing the foliar (2.19) than the stem tissues (1.84). Species evenness was uniform in both the tissues (Table 3). Shannon effective number of species was found to be 11.9 in case of the needle tissues and 9.3 in the stem tissues. This is the true diversity of the community in question. These diversity indices reflect the richness of phylotypes in Pinus wallichiana (Table 3). Jaccard’s (Jc) and Sorenson’s similarity indices between the endophytes of both tissues were 0.26 and 0.41 %, respectively (Table 4). This indicates that the biodiversity of fungal endophytes in stem and needle tissues of Pinus wallichiana is quite significant.

Table 2 Colonization frequency (%CF) of endophytic fungi isolated from stem and needle tissues of Pinus wallichiana
Full size table
Table 3 Diversity indices of endophytic fungi colonizing needle and stem tissues of Pinus wallichiana
Full size table
Table 4 Jaccard’s (Jc) and Sorenson’s similarity indices for endophytic fungi of Pinus wallichiana
Full size table

Antibacterial and Antifungal Activities of Endophytic Fungal Extracts

Endophytic fungal extracts from Pinus wallichiana were tested for antibacterial and antifungal activities by the micro-titer plate assay against the representatives of Gram-positive and Gram-negative bacteria (Staphylococcus aureus ATCC 29213 and Escherichia coli ATCC 25922) and a fungal pathogen (Candida albicans MTCC 4748). A total of 34 extracts were found to possess significant antibacterial and antifungal activity against one or more pathogens (Table 5). Extracts from fungal isolates, P1N10 (Tricharina hiemalis), P1N13 (Coniothyrium carteri), P1S1b (Epicoccum nigrum), P2N8 (Thielavia subthermophila), P4S6b (Truncatella betulae), P7N10 (Cochliobolus australiensis), and P8S4 (Tritirachium oryzae), exhibited significant activity against the tested pathogens. P1N13 (Coniothyrium carteri), P2N8 (Thielavia subthermophila), P4S6b (Truncatella betulae), P7N10 (Cochliobolus australiensis), and P8S4 (Tritirachium oryzae) were significantly active against Candida albicans with IC50 of 17, 14, 19, 19, and 26 μg/ml, respectively. Several extracts (n = 25) of the endophytic fungi displayed antimicrobial activity against Staphylococcus aureus with IC50 values less than 100 μg/ml. Especially, four of them, P1N10 (Tricharina hiemalis), P1S2 (Alternaria sp.), P1S1b (Epicoccum nigrum), and P8S4 (Tritirachium oryzae), inhibited Staphylococcus aureus strongly, with IC50 values of 10, 5, 4, and 7 μg/ml, respectively. In contrast, only 16 extracts displayed antimicrobial activity against the Gram-negative bacterium, Escherichia coli, with IC50 values less than 100 μg/ml wherein the lowest IC50 values of 20, 19, 31, and 7 μg/ml were obtained with the extracts prepared from P1S1b (Epicoccum nigrum), P3N33 (Pseudoplectania nigrella), P1N10 (Tricharina hiemalis), and P8S4 (Tritirachium oryzae), respectively. Broad spectrum of antimicrobial activities was obtained with the extracts of P8-S4 (Tritirachium oryzae) and P5-N26 (Coniochaeta gigantospora) that were potentially active against the Gram-positive and Gram-negative bacteria as well as the fungal pathogen, Candida albicans.

Table 5 Antimicrobial activity of dichloromethane extracts of the endophytes against the bacterial strains, Escherichia coli, Staphylococcus aureus, and Candida albicans
Full size table

Antagonistic Activity Against Plant Pathogens

Representative strains were screened for antagonistic activity against eight fungal pathogens. Antimycotic activities of 17 endophytic fungi that showed 50 % or more inhibition against one or more pathogens are presented in Table 6. Three endophytes, P1N13 (Coniothyrium carteri), P5N20 (Fusarium larvarum), and P5-N31a (Truncatella spadicea), displayed broad range of antimycotic activity, inhibiting at least five pathogens by 50 % or more. The most susceptible pathogen was Ceratocystis fimbriata (MTCC 2281) whose growth was inhibited more than 50 % by the endophytic fungi P1-N1 (Alternaria brassicae), P1-S7b (Sclerostagonospora spp.), P1-S14 (Leptosphaeria sp.), P5-N20 (Fusarium larvarum), P5-N31a (Truncatella spadicea), and P8-S4 (Tritirachium oryzae).

Table 6 Antimycotic activity, represented as the percent growth inhibition, of several plant pathogens by endophytes
Full size table

Discussion

Endophytes play vital ecological roles, thus influencing plant growth, development, disease resistance and adaptation to unique niches, etc. [38, 40, 50]. Furthermore, the intimate association of endophytism may modulate the biosynthetic pathways of the plant, thus shaping its secondary metabolism [43, 57]. Given the large number of plant species growing in diverse environmental niches on our planet and lack of genuine laboratory models, many aspects of endophytism like host specificity, geographical distribution, phylogenetic affinities, as well as the phenomena mentioned above have been poorly understood; thus, we have limited knowledge about various factors influenced by endophytism and vice versa. Moreover, despite continued efforts to characterize and preserve endophytes, much of this natural treasure is unexplored owing to the amplitude of their diversity and wide distribution.

This study represents the first report of the diversity and bioactivity of endophytes associated with the Himalayan blue pine, particularly from the Kashmir valley. The total number of endophytes isolated (n = 130) from ten trees represented 38 different genera. This implies an average of about four different genera from each plant, thus indicating that the magnitude of diversity harbored by the blue pine is quite significant. The endophytic community was dominated by Dothideomycetes followed by Sordariomycetes, representing 83 % of the isolates, collectively. Similarly, Dothideomycetes was the most prevalent class of endophytes hosted by Pinus halepensis from Spain [11]. Sordariomycetes was the second most abundant class in our study frequently isolated from the foliar tissues (Table 1). It has been previously reported as the dominant class in the foliar endophytes [5].

Most of the fungi isolated in this study from Pinus wallichiana corresponded with those recorded in previous studies of Pinus spp. [5, 11, 12]. However, some species such as Anthostomella conorum, Tricharina hiemalis, Microdiplodia spp., Thielavia subthermophila, Therrya fuckelii, and Tritirachium oryzae were isolated for the first time from Pinus sp. Pestalotiopsis spp., described as endophyte of pines and isolated only from needles in previous studies [24], was isolated from both stems and needle tissues of Pinus wallichiana. Eurotiomycetes and Pezizomycetes constitute the least abundant classes in this study (Table 1) which is in agreement with the previous studies on endophytes of other plants [4].

Furthermore, in contrast to the endophytic community hosted by Pinus monticola from northern Rocky Mountains of the USA, where 95 % of the foliar endophytes belonged to the Rhytismataceae [23], we obtained only four isolates from this family (two belonging to the genus Lophodermium and the other two closely related to Therrya spp.) (Supplementary material Table 1). Lophodermium is regarded among the most common endophytes isolated from Pinus, Abies, and Picea [52] although one species, Lophodermium seditiosum, is regarded as a major pathogen causing needle cast of pines [34, 49]. The striking difference in the endophytic communities between the Pinus spp. may be due to species specificity of the endophytes as well as the conditions provided by the two different ecological niches. Further, a clear differentiation was observed in the community structure of endophytes in the stem and foliar tissues, with the latter supporting a wider diversity of endophytes. Interestingly, several of the endophytes found in the needles did not colonize the stems and vice versa. Thus, tissue specificity was evident among the endophytes of the Himalayan blue pine. These tissues represent two distinct micro-environments consequently shaping their microbiota differently.

A total number of eight isolates displayed less than 95 % sequence (ITS1–5.8S–ITS2) similarity with known organisms. Thus, these may represent novel species. The taxonomic novelty of such organisms may also correspond to chemical novelty of their secondary metabolites [32]. Further, several of these fungi have not been explored for their natural products. Thus, these microbes, along with those that displayed bioactivity, will be given priority for characterization of their secondary metabolites to isolate novel molecules with bioactivity. After further exploration, endophytic cultures showing prominent antimycotic activities may be use to control root rot and other microbial diseases, particularly in the pine seedlings.

Natural products remain a consistent source of drug leads with more than 40 % of new chemical entities (NCEs) reported from 1981 to 2005 having been derived from microorganisms [13, 29, 47]. In comparison to other natural sources like plants, microorganisms are highly diverse but narrowly explored. Studies based on estimation of microbial populations have revealed that only about 1 % of bacteria and 5 % of fungi have been characterized and the rest remain unexplored for their contribution to the human welfare [25, 51]. Further, fungi are proficient producers of bioactive metabolites and drug-like molecules [28]. This is not surprising in the light of their evolution over millions of years in diverse ecological niches and natural habitats.

We have obtained these data on plants growing at a single site, but endophytic communities may differ along the latitudinal gradient [6]. Further, in a previous study, we observed that some conifers from the same sampling site harbored novel bioactive endophytes [32, 39]. Therefore, concerted efforts are needed to study the endophytic diversity of the Himalayan blue pine and other conifers growing at the same site as well as along the latitudinal gradient to understand their distribution, host specificity, and phylogenetic affinity in the northwestern Himalayas. When compared to the endophytes of conifers from other biogeographic regions, the geographic distribution of these endophytes can also be understood. It is also important to tap these endophytes and conserve them ex situ for bioprospecting.