Introduction

Historically, the use of resistance genes in wheat has been the most effective, cost-efficient, and environmental-friendly approach to control infestations of Hessian fly (Hf), Mayetiola destructor (Say) (Diptera: Cecidomyiidae), one of the most destructive pests of wheat (Triticum aestivum L.) worldwide (Cox and Hatchett 1994; Ratcliffe and Hatchett 1997). So far, over 30 major Hf resistance genes have been identified (Ratcliffe and Hatchett 1997; McIntosh et al. 2003; Williams et al. 2003; Liu et al. 2002). Among these genes, H13, H22, H23, H24, and H26 originated from Aegilops tauschii Coss. [syn. Ae. squarrosa L.; T. tauschii (Coss.) Schmal.], the diploid progenitor, and donor of the D genome of common wheat, and an important source for pest resistance (Hatchett and Gill 1981; Gill and Raupp 1987; Ratcliffe and Hatchett 1997). H13 is a dominant resistance gene expressing a very high and stable level of antibiosis against a wide range of Hf biotypes and geographic populations (Hatchett et al. 1981; Gill et al. 1987; Ratcliffe and Hatchett 1997; El Bouhssini et al. 1999). The H13 resistance was traced to KU2076 (TA2452) of a synthetic hexaploid (2n=42), KU221-19, formed from an interspecific cross between KU138, an accession of T. persicum L. var. stramineum Zhuk. (tetraploid, 2n=28) and KU2076, an accession of Ae. tauschii (diploid, 2n=14) (Tanaka 1961; Hatchett et al. 1981). Previously, H13 was mapped to wheat chromosome 6D using monosomic analysis, and further mapped to 6DL, 35.0±8.0 recombination units from the centromere by telocentric analysis (Gill et al. 1987). H22, H23, H24, and H26 are located on chromosomes 1D, 6D, 3D, and 4D, respectively (Raupp et al. 1993; Cox and Hatchett 1994).

Significant advances in molecular genetics and genomics recently have produced many molecular markers that are being employed increasingly to facilitate identification and mapping of resistance gene (Yencho et al. 2000; Sourdille et al. 2004), marker-assisted selection (MAS) in molecular breeding (Melchinger 1990; Gupta and Varshney 2000), and map-based cloning of resistance genes (Huang et al. 2003; Feuillet et al. 2003; Yahiaoui et al. 2004).

Marker-based mapping and MAS are much more accurate and effective than conventional cytological mapping and phenotype-based breeding. A variety of molecular markers has been identified to map Hf resistance genes in wheat. Ma et al. (1993) identified restriction fragment length polymorphism (RFLP) markers linked to the H23 gene on chromosome 6DS and H24 on 3DL. Dweikat et al. (1994, 1997, 2002) developed random amplified polymorphic DNA and sequence-tagged site (STS) markers associated with H3, H5, H6, H9-H14, H16, and H17. Williams et al. (2003) mapped H31 on chromosome 5BS with AFLP and STS markers. Most recently, we identified several microsatellite [or simple sequence repeat (SSR)] markers that were tightly linked to a Hf resistance gene (temporarily named Hdic) on wheat chromosome 1AS (X.M. Liu et al., unpublished data; http://maswheat.ucdavis.edu/protocols/HF/index.htm). In general, SSR markers are very promising for genetic mapping as well as for MAS, because they are abundant, highly polymorphic, reliable, and chromosome locus specific (Rafalski and Tingey 1993; Röder et al. 1998; Pestsova et al. 2000).

The objectives of this study were to identify SSR markers linked to H13 and determine its precise chromosome map position and the linkage relationships with other resistance genes in order to facilitate the efficient use in breeding programs and the positional cloning of H13.

Materials and methods

Hessian fly populations

The Hf biotype GP originated from a laboratory colony collected from Ellis County, Kansas (Gagne and Hatchett 1989). The insects were maintained on wheat seedlings of the Hf-susceptible cultivars (Karl 92 or Newton). A biotype L culture was supplied by S.E. Cambron, USDA–ARS, West Lafayette, Ind., USA. The insects were maintained on seedlings of cultivars Ike (H3), Magnum (H5), Caldwell (H6), and Seneca (H7H8) sequentially. The Hf pupae together with infested wheat plants were stored at 4°C until Hf adults were needed.

Plant materials and DNA isolation

Molly (PI 562619) is an H13-containing wheat germplasm with the pedigree of Newton-207*7/3/KU221-19/Eagle//KS806 (Patterson et al. 1994) and is a near-isogenic line of Newton-207. KS89WGRC03 (PI535766) is an H23-containing wheat germplasm derived from the cross TA1642 × 2*Wichita (Gill et al. 1991a). KS89WGRC04 (PI535767) is a wheat germplasm containing an unnamed H gene (H WGRC4 ) developed from the cross TA1695 × 3*Wichita (Gill et al. 1991b). To map the H13 gene in Molly, a mapping population consisting of 192 F2:3 families was developed from the cross PI 372129 × Molly. PI 372129 is an Hf-susceptible wheat germplasm containing Dn4, a gene conferring resistance to biotype A of Russian wheat aphid, Diuraphis noxia (Mordvilko).

Seeds of Molly, Newton-207, and PI 372129 were provided by Dr. H. Ohm, Department of Agronomy, Purdue University, Ind., USA, and the USDA–ARS National Small Grains Research Facility in Aberdeen, Idaho. Wichita, KS89WGRC03, KS89WGRC04, and Ae. tauschii-resistant sources TA2452 (KU2076, H13), TA1642 (H23), and TA1695 (H WGRC4 ) were provided by the Wheat Genetics Resource Center (WGRC) at Manhattan, Kansas. Wheat genetic stocks used for marker localization including cultivar Chinese Spring (CS), CS nullisomic-tetrasomic (N6DT6B, Sears 1966), ditelosomic (Dt6DS, Dt6DL, Sears 1954), and deletion lines (del6DS-2, del6DS-4, and del6DS-6, Endo and Gill 1996), were also kindly provided by the WGRC. Wheat genomic DNA was extracted from leaf tissue of each F2 plant according to the modified CTAB procedure as described by Gill et al. (1991c). The DNA concentration was quantified spectrophotometrically.

Evaluation of Hf resistance

Parents, F1 plants, some F2 plants, and the F2:3 population were evaluated for phenotypic reaction to Hf infestation as described previously (Hatchett et al. 1981; Maas et al. 1987) with modification. Briefly, approximately 15–20 seeds of each wheat line or family were planted in uniformly spaced rows (12 rows or 24 half-rows per flat) in flats (52 × 36 × 10 cm) containing a mixture (1:1) of soil and vermiculite in growth chambers at 18±1°C with 14:10 h (light/dark) photoperiod. Seedlings at the one-leaf stage were infested by confining ~200 newly mated Hf females in each flat within a cheesecloth tent. Three weeks after infestation, the seedlings were examined to identify susceptible and resistant phenotypes. Susceptible plants were stunted with dark green leaves and harbored live larvae (or pre-pupae). Resistant plants grew normally (unstunted), with light green leaves, and contained dead larvae between the leaf sheaths. Chi-square (χ2) tests were conducted to determine the goodness of fit of plant segregation ratios to theoretical mendelian segregation ratios.

Microsatellite (SSR) analysis

Molecular markers selected from wheat chromosome 6D were screened for linkage to H13 by bulked segregant analysis (Michelmore et al. 1991) as well as by evaluation of the near-isogenic lines Molly and Newton-207. Two DNA bulks were assembled, using equal amounts of DNA from five homozygous resistant and five susceptible progeny lines, respectively. The DNA samples of resistant and susceptible near-isogenic lines, parents, and bulks were evaluated for polymorphisms with SSR primers. Once a primer pair amplified polymorphic fragments between two bulks and between near-isogenic lines, they were further used to determine the genetic linkage between the Hf resistance gene and the markers with the entire mapping population.

The sequences of SSR primers were obtained from the GrainGenes Database at http://wheat.pw.usda.gov/ggpages/ggtabledefs.html. Specific information on primers and PCR protocols with the prefixes listed herein can be found in the respective references—WMS (or GWM): Röder et al. 1998; PSP: Stephenson et al. 1998, Devos et al. 1995; GDM: Pestsova et al. 2000; BARC: R. Ward et al. (http://www.scabusa.org/pdfs/BARC_SSRs_011101.html); WMC: Gupta et al. 2002; and CFA and CFD: P. Sourdille (http://wheat.pw.usda.gov/ggpages/SSRclub/Sourdille/), Guyomarc’h et al. 2002; Sourdille et al. 2004. Because H13 was known to be located on wheat chromosome 6D, a total of 52 SSR primer pairs specific to wheat chromosome 6D were evaluated for genetic linkage to H13.

The PCR amplification was performed in a volume of 25 μl, as described by Röder et al. (1998), with minor modifications. The reaction mixture contained 0.2 mM of each dNTPs, 1.8–2.0 mM MgCl2, 1 U Taq DNA polymerase (Promega, Madison, Wis., USA), 1X Thermophilic DNA polymerase buffer (10 mM Tris-HCl, 50 mM KCl, and 0.1% Triton X-100), 0.4 μM each of the forward and reverse primers, and 100 ng of template DNA. The PCR amplifications were performed in an MJ Research PTC-200 Thermal Cycler (Watertown, Mass., USA) programmed at: 94°C for 3 min, followed by 40 cycles of 94°C for 1 min, 50–60°C (based on primer’s annealing temperature) for 1 min, and 72°C for 2 min, and then a final extension step at 72°C for 10 min before cooling to 4°C. Particularly, PCR annealing temperature for primers CFD132 and GDM136 is 55°C. The primer sequences (from 5′ to 3′) are CFD132F: CAAATGCTAATCCCCGCC, CFD132R: TGTAAACAAGGTCGCAGGTG; GDM36F: ATGCAAAGGAATGGATTCAA, and GDM36R: CAAATCCGCATCCAGAAAAT. PCR-amplified fragments were separated on 3% agarose gels (Sigma, St. Louis, Mo., USA) under electrophoresis at 5 V/cm in 1X TAE buffer. The DNA banding patterns were visualized under UV light with ethidium bromide staining.

Genetic and physical mapping

A genetic linkage map was constructed by converting recombination frequencies to genetic map distance (centiMorgans) with the Kosambi mapping function (Kosambi 1944) using MAPMAKER software, version 3.0 (Lander et al. 1987), at LOD>3.0.

To determine the physical location of the SSR markers, genomic DNA from euploids, aneuploids, and deletion lines of CS wheat were amplified using SSR primers of the H13-linked markers. The presence or absence of a specific fragment amplified from a deletion stock indicates that the corresponding marker is located proximal or distal to the breakpoint of the tested deletion stock. In this manner, the markers and linked genes were physically localized into chromosome interval regions (bins) within the chromosome arm.

Results and discussion

Inheritance and phenotypic expression of H13

Segregation ratio of F2:3 families confirmed that Hf resistance in Molly is controlled by a single dominant gene (H13), which was consistent with the previous report of Hatchett et al. (1981). All the tested seedlings of the resistant parent Molly and F1 plants derived from the cross PI 372129 × Molly exhibited complete and consistent resistance to both Hf biotypes GP and L. The observed segregation of 47 homozygous resistant, 87 segregating (heterozygous), and 58 homozygous susceptible F2:3 families fit a one gene segregation ratio 1:2:1 (χ2=2.948, df=2, P=0.235>0.05).

SSR markers linked to H13

Of the 52 pairs of 6D SSR primers tested, no markers with loci on the long arm of the chromosome detected polymorphisms between Molly and the susceptible near-isogenic line Newton, or between the resistant and susceptible bulks. On the other hand, the 6DS primers CFD132, GDM36, CFD213, CFD42, and GDM141 amplified DNA fragments (with the expected sizes similar to those from CS wheat) polymorphic between Molly and Newton-207 (Table 1). The primer pairs CFD132, GDM36, CFD42, GDM141, GDM132, CFD75, and BARC173 amplified DNA fragments polymorphic between Molly and PI 372129 as well as between the resistant and susceptible bulks. Evaluation of the entire F2:3 mapping population indicated that these SSR markers from the short arm of chromosome 6D are linked to H13.

Table 1 The DNA fragments (base pair size) amplified from wheat parents and related sources with microsatellite primers of H13-linked markers
Full size table

Marker Xcfd132 co-segregated with H13 in the population consisting of 192 F2:3 families and is completely linked to Hf resistance. The CFD132 primer pair amplified a 160-bp DNA fragment from the resistant parent Molly and all the homogenous resistant F2:3 families, and a 120-bp fragment DNA from the susceptible parent PI 372129 and susceptible progeny. Both the 160- and 120-bp fragments are present in the heterozygous (segregating) progeny (Fig. 1).

Fig. 1
figure 1

DNA fragments amplified with simple sequence repeat primer CFD132. The DNA samples were prepared from KU2076 (K), Newton-207 (N), Molly (M), PI372129 (P), and F2 plants from the cross PI372129 × Molly. R Hessian fly (Hf)-resistant (homozygous), S Hf-susceptible, and H heterozygous progeny (segregating in F2:3 families). L25 25-bp DNA ladder. H13 is 100% co-segregating with Xcfd132

Full size image

In addition to Xcfd132, four other co-dominant markers are linked to H13 at various distances. Marker Xgdm36 is located 2.7 cM distal to H13 (Fig. 2). The GDM36 primer pair amplified a 170-bp DNA fragment associated with H13 resistance (a 120-bp fragment was not related), and a 130-bp DNA fragment from the susceptible parent PI 372129 and susceptible progeny. Both the 170- and 130-bp fragments are present in the heterozygous progeny (Table 1). Xcfd42 is linked to H13 at a distance of 5.8 cM. The CFD42 primer pair amplified a 180-bp DNA fragment associated with the resistance in Molly (H13), and a 170-bp DNA fragment from the susceptible parents PI 372129 and susceptible progeny. Both the 180- and 170-bp fragments are present in the heterozygous progeny (Table 1). Markers Xgdm141 and Xbarc173 are located 6.0 cM and 15.3 cM, respectively, distal to H13 in Molly. The GDM141 and BARC173 primer pairs detected polymorphism between Molly and PI 372129 as shown in Table 1.

Fig. 2
figure 2

Linkage map of H13 and an arthropod-resistant gene cluster on wheat chromosome 6DS. The dark region of the chromosome represents the Aegilops tauschii KU2076 (TA2452) segment containing H13 in common wheat Molly (PI562619). The light region represents the Newton background. The gray region may be derived from cultivars either Eagle or KS806. Markers or genes in parentheses were cited for comparison. The breakpoints of the deletions are indicated with arrows

Full size image

In addition to the co-dominant markers described as above, Xgdm132 and Xcfd75 are dominant markers linked to H13 in the coupling phase at the same distance of 14.4 cM (Table 1; Fig. 2). These two markers were completely linked in the mapping population of 192 F2:3 families. A genetic linkage map (Fig. 2) of H13 and the linked SSR markers was constructed using MAPMAKER (Lander et al. 1987).

To determine the physical locations of the H13-linked markers, DNA samples of CS, N6DT6B, Dt6DS, Dt6DL, del6DS-2 [fraction length (FL)0.45], del6DS-4 (FL0.79) and del6DS-6 (FL0.99) were amplified using primer pairs of each SSR markers. The deletion mapping results demonstrate that Xbarc173, Xcfd75, Xgdm132, Xgdm141, and Xcfd42 are physically located distal to the breakpoint of 6DS-6 in the terminal 1% of the 6dS chromosome arm. The completely linked marker Xcfd132 and the very tightly linked marker Xgdm36 together with Xcfd213 and Xbarc54 are physically located in bin 6DS4-0.79-0.99. The physical intervals of Xbarc173 and Xgdm141 are consistent with those of Sourdille et al. (2004) and R. Ward et al. (http://www.graingenes.org/dbs_images/graingenes/ BARC_1A.jpg). The exact physical bins for the other linked markers were newly established in this study. Considering the very small genetic distance from H13 to Xcfd42, H13 is located proximal and very close to the breakpoint of 6DS-6 (FL0.99).

Although Xcfd213 could not be mapped using our mapping population, it can be placed proximal to Xcfd132 based on its physical location described as above and the fact that Xcfd213 detected polymorphisms between Molly and Newton, WGRC3 and Wichita, and WGRC4 and TA1695 (Table 1). The Xcfd213 is located proximal to Xcfd132 at 0.55 cM ( http://www.grs.nig.ac.jp/wheat/komugi/maps/markerMap.jsp?, Chromosome = 6) or 1.1 cM (http://wheat.pw.usda.gov/ggpages/SSRclub/Sourdille/18). Another SSR marker, Xbarc54, is located proximal to Xcfd132 at a distance of 12 cM (Somers et al. 2004).

The present molecular mapping of H13 on 6DS is consistent with the previous monosomic mapping result that H13 is on chromosome 6D, but contrary to the previous ditelosomic arm mapping results that placed H13 on 6DL arm (Gill et al. 1987). The original ditelosomic stocks of Dt6DS and Dt6DL must be correct, as they have been used in numerous mapping studies, and no anomalous results have been reported. Most probably, the previous crosses may have been mislabeled or there was an error in crossing as the identities of the diteosomics Dt6DL and Dt6DS was not verified independently.

Size of the Ae. tauschii KU2076-derived chromosomal segment in common wheat Molly

The origin of the chromosomal segments carrying H13 in Molly can be tracked by comparing the marker polymorphisms among the donor line KU2076 (or KU-221-19), the recipient line Newton-207, and Molly. According to the marker polymorphisms (Table 1) and marker order (Fig. 2), a very small intercalary chromosomal segment (proximal to the breakpoint of del6DS-6-FL0.99), carrying H13 along with Xgdm36, Xcfd132, and Xcfd213, was introgressed from the original H13 source KU2076 (dark region, Fig. 2). A small intercalary chromosomal fragment (around the breakpoint of del6DS-6-FL0.99) carrying Xgdm41 and Xcfd42 loci might derive from either cultivars Eagle or KS806 (gray region, Fig. 2). The chromosomal region distal to and including Xgdm132 and the region proximal to and including Xbarc54 derived from the recipient (recurrent) parent Newton (light region, Fig. 2).

A cluster of arthropod resistance genes in the distal region of 6DS

The linked markers identified in this study facilitate the exact mapping of H13 gene on the distal gene-rich region of wheat chromosome arm 6DS instead of 6DL, and provide new information about the genetic relationship between H13 and other resistance genes on wheat chromosome 6DS that will facilitate their rational use.

Previous genetic analysis indicated H23 and H13 were linked at a distance of 25±5.0 map units (Raupp et al. 1993). Ma et al. (1993) used RFLP markers to map H23 15.6 cM distal to XksuG48a on chromosome 6DS. Pestsova et al. (2000) located XksuG48a between markers Xgdm132 and Xgdm141. The unnamed gene in KS89WGRC04 (here as referred to as H WGRC4 ) is either tightly linked or allelic to H23, because no recombination or segregation was observed between these two genes (S. Singh, personal communication). In addition, Li et al. (1999) mapped a defense response gene Ppo for polyphenol oxidase, with close linkage and proximal to XksuG48a. Malik et al. (2003) mapped the wheat curl mite, Aceria tosichella Keifer, resistance gene Cmc4 between XksuG48a and Xgdm141.

To confirm the potential relationships among H13, H23, and H WGRC4 , H13-linked markers were used to detect H23 in KS89WGRC03, which derived from the cross TA1642 × 2*Wichita, and H WGRC4 in KS89WGRC04 with pedigree TA1695/3*Wichita. Microsatellite polymorphism detected among KS89WGRC03, TA1642 (Ae. tauschii, H23 donor) and Wichita (Table 1) indicated that a small terminal chromosomal segment distal to Xbarc54 was derived from TA1642 and may carry H23 in KS89WGRC03 (Fig. 2). Polymorphism among KS89WGRC04, TA1695 (Ae. tauschii, H WGRC4 donor), and Wichita (Table 1) also revealed that a small intercalary chromosomal segment between Xcfd75 and Xbarc54 was derived from TA1695 and may carry H WGRC4 in KS89WGRC04 (Fig. 2). Further investigation is needed to clarify whether H13, H23, and H WGRC4 are allelic.

Our present results and those of others indicated that H13, H23, H WGRC4 , Cmc4, and a Ppo defense response gene are clustered in a small distal region on the short arm of chromosome 6D. This gene cluster in wheat may provide useful clues that demonstrate common characteristics of their evolution to those of disease resistance genes. Race-specific disease resistance genes in plants are commonly clustered in a linked array, and most likely evolved from the same progenitor resistance gene through duplication and diversification (Richter and Ronald 2000). Polyphenol oxidases play a defensive role in plant–pest interactions, and the Ppo genes possess both constitutive and inducible defensive modes. The Ppo gene is currently the only defense response gene that has been mapped to the distal region of wheat chromosome arm 6DS. The close proximity of H13, and several other insect-resistance genes, to Ppo, suggests the possible involvement of polyphenol oxidase in insect resistance or the possibility of allelic relationship between the H and Ppo genes.

The potential use of H13-linked markers

Rapid breeding and deployment of Hf-resistant wheat cultivars are critically needed to control Hf for the sustaining wheat production. Conventional plant breeding depends upon phenotypic selection for Hf resistance through bioassays or selection based on morphological or agronomic traits. All of these practices are labor-intensive, time-consuming, and sometimes inconclusive. In contrast, molecular breeding employs molecular markers linked to resistance genes for MAS, through which the accurate detection of specific resistance genes and efficient selection of desirable resistant genotypes can be achieved (Melchinger 1990; Yencho et al. 2000). As MAS is unaffected by environmental conditions or plant developmental stages, it can facilitate the selection of target genes or favorable genotypes at the seedling stage in early segregating generations. It is also practicable to use molecular markers to select against unwanted chromosomal segments, thus reducing linkage drag and accelerating cultivar development.

H13 expresses a very high level of antibiosis against a wide range of Hf biotypes, including biotype L, the most virulent population known (Ratcliffe and Hatchett 1997; Ratcliffe et al. 2000). Linked markers identified in this study will be very useful in wheat breeding programs for MAS and gene pyramiding. The completely linked marker Xcfd132 and several tightly linked markers can be used to tag and track H13, and to select accurately for H13. We used the H13-linked markers and the previously identified Dn4-linked markers (Liu et al. 2002), selected 15 F2:3 families homozygous for both Hf resistance and Russian wheat aphid resistance among 192 families of a mapping population. Work is currently in progress to pyramid these and other resistance genes using MAS.

Results in this study revealed that H13 is located in a distal gene-rich region (which has a potentially high rate of recombination) on wheat chromosome arm 6DS. The absence of recombination between H13 and the co-segregating marker Xcfd132 in a highly recombinagenic telomeric region (Sourdille et al. 2004) suggests that their physical distance should be small enough within a feasible range to allow a map-based cloning approach to isolate H13.

In summary, H13 is completely or tightly linked to several SSR markers and is located in a cluster of arthropod resistance and defense response genes in the distal region of wheat chromosome 6DS. These linked markers are not only very useful for molecular breeding (MAS) and molecular mapping, but may also provide a good opportunity for the map-based cloning of H13.