Quantitative PCR Analysis of Mitochondrial DNA Content in Patients with Mitochondrial Disease

Abstract

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-tune quan-titative polymerase chain reaction (PCR) method. Copy numbers were calcu-lated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5′TTACCGGGCTCTGCCATCT3′-TAMRA and VIC-5′AGCAATAACAGGTCTGTGATG3′-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5–20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.