Keywords

1 Introduction

Among the bewildering array of animal taxa, horseshoe crabs are unique in their genetic makeup and are commonly known as “Living Fossil”. An Intriguing characteristic of horseshoe crabs is that they are morphologically similar in look and having virtually unchanged genetic makeup which helped them in withstanding various environmental stresses for the past 150 million years (Rudkin and Young 2009; Kamaruzzaman et al. 2011). It is interesting to note that, within the impressive diversity and ecological range of extant chelicerate arthropods, only the xiphosurid horseshoe crabs retain a primitively obligate aquatic habit harking back to their distant genealogical roots. It was noted that the fossil record of the basic xiphosurid horseshoe crab body plan has been extended back to the late Ordovician Period, about 445 million years ago, demonstrating an origin that lies outside of the paraphyletic ‘synziphosurines’ (Obst et al. 2012).

Global distribution pattern of four extant species of horseshoe crabs showed restricted inhabitation of Limulus polyphemus along the American coastline especially in Gulf of Mexico, while other three Asian conspecifics such as Tachypleus tridentatus, T. gigas, Carcinoscorpius rotundicauda are inhabiting Indo-china coastal waters from Bay of Bengal up to South Philippines. In Malaysia, their distribution was noted in both east and west coast of Peninsular Malaysia with the restricted distribution of T. tridentatus in Borneo Island (Sabah and Sarawak) (Akbar John et al. 2011, 2012). During spawning time adult horseshoe crabs migrate from the offshore continental shelf to spawn on intertidal sandy beaches (in case of T. gigas) and sandy mud beaches and mangrove area (in case of C. rotundicauda) during full and new moon days (Zaleha et al. 2010).

Detailed morphological descriptions of the four species of horseshoe crabs were given by Mikkelsen (1988) and the comparisons of morphological differences between species were presented by Chiu and Morton (2003). Morphological characters, including the shape of the prosoma and telson, the shapes and numbers of claspers in the male and the shapes of marginal spines in the female, have been considered important in the classification of horseshoe crabs (Sekiguchi and Nakamura 1979; Mikkelsen 1988). Chiu and Morton (2003) had extensively discussed morphological variations between Tachypleus tridentatus and Carcinoscorpius rotundicauda using conventional morphometric approach. Yamasaki et al. (1988) had studied geographic variations in body sizes (maximum prosomal width) of the four extant horseshoe crab species and he proved significant variation in prosomal width of T. tridentatus and C. rotundicauda collected from different countries. These little morphological differentiations among horseshoe crab lineages have resulted in substantial controversy concerning the phylogenetic relationship among the extant species of horseshoe crabs, especially among the three species in the Indo-Pacific region. Earlier studies suggested that the three species constitute a phylogenetically irresolvable trichotomy (Xia 2000).

These discrepancies have attracted various researchers to concentrate on their genomic structure to differentiate the species at the gene level. Hence, the present study was aimed to revise the existing molecular phylogeny of horseshoe crabs and to predict their possible ancestry using universal barcode gene (mitochondrial Cytochrome Oxidase C subunit 1 gene) as a benchmark reference.

2 Materials and Methods

2.1 Sample Collection, Preparation and Larval Rearing

Matured horseshoe crabs (Tachypleus gigas) were collected from Balok and Pekan nesting grounds and a female T. gigas sample was collected from Pulau Gaya, Sabah, Eastern Malaysia. Mangrove horseshoe crab (Carcinoscorpius rotundicauda) samples were collected from Sitieu mangrove forest (Terengganu, East coast of Malaysia) during May and August 2010. All the samples were identified to the species level using conventional taxonomic keys (Yamasaki et al. 1988; Chiu and Morton 2003) Fertilized eggs of T. gigas were sampled from Pekan and immediately transported to Institute of Aquatrop (University Malaysia Terengganu) in an aerated condition. Eggs were kept in filtered sea water (salinity 33 ± 2 ppt) under aerated condition in a larval rearing tank for 30 days. After a month, Pretrilobite stage of T. gigas swimming in the amniotic fluid were sampled and preserved in 95 % ethanol for DNA sequencing. In next 2 weeks, free swimming trilobite stage was sampled from larval rearing tank and preserved in 95 % ethanol as mentioned above. Precautions were taken to avoid fungal attack on developing eggs by constantly changing the filtered sea water in every 3 days. Simultaneously matured female crabs were dissected out using sterilized scissors and forceps to collect Apodeme tissue and Immatured eggs. Samples such as immatured egg, matured egg, flesh (Apodeme), pretrilobite larvae and trilobite larvae were collected in 1.5 ml Eppendorf tube containing 95 % ethanol for DNA isolation. Prior to this, all the samples were photographed for future reference. The sample details and coordinates of sampling locations are given in Table 1.

Table 1 Sample details and coordinates of each sampling locations
Full size table

2.2 DNA Extraction, PCR and Sequencing

Salting out procedure was adopted to extract the DNA from the samples (Ajmal Khan et al. 2010; Akbar John et al. 2010; Prasanna Kumar et al. 2011). Approximately 570 bp of COI gene from mitochondrial DNA was amplified using Forward (Fish F2_t1: TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC) and Reverse primer (FishR2_t1: CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA) under the PCR condition of an initial step of 2 min at 95 °C followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 54 °C and 1 min at 72 °C, followed in turn by 10 min at 72 °C and then held at 4 °C. PCR products were visualized on 2 % China Agarose gel and the photographed using Gel imager Under UV light. Products were labeled using Qiagen sequencing kit and sequenced unidirectionally using a MegaBace capillary sequencer at Bioserve biotechnologies pvt. Ltd. Hyderabad, India. Generated sequences were edited using Chromas Pro 2.33v. Sequences were deposited in NCBI under the Genbank ID JF896105-JF896114 (Table 2).

Table 2 Details of sequences and corresponding developmental stages submitted in National Centre for Biotechnological Information (NCBI)
Full size table

2.3 Software Analysis

DNA sequences generated in this study together with the horseshoe crab and predicted sister taxa sequences (retrieved from public DNA data banks were run in Clustal X 2.0.6v for multiple sequence alignment under default setting (Larkin et al. 2007). Nucleotide composition was determined using BioEdit 7.0.9v (Hall 1999). Molecular Evolutionary Genetics Analysis (MEGA) beta 4.1v was used to generate phylogram using distance matrix methods such as Neighbor Joining (NJ) method and Un-weighted Pair Group Method with Arithmetic Mean (UPGMA) (Tamura et al. 2007). Kimura 2 Parameter (K2P) was used as a distance model to generate phylogenetic tree in both the methods (Kimura 1980). Genetic Distance (GD) data were also retrieved at each codon position using the same K2P distance model.

3 Results

3.1 Neighbor Joining (NJ Method)

Phylogenetic tree was constructed using Neighbor Joining method to verify the efficiency of cox1 gene in delineating closely related and morphologically cryptic species of horseshoe crabs (Fig. 1). Phylogram was constructed with 36 sequences (horseshoe crabs = 21; Insects = 5; Scorpion = 8 and out groups = 2). The out groups used were Portunus pelagicus (Class: Malacostraca) and Artemia franciscana (Class: Branchiopoda) distinctly segregated in separate branch in phylogram proving its reliability besides the higher bootstrap values in the internal branch nods. Four distinct clads were found in the phylogram having horseshoe crabs in Clad 1, Scorpions in Clad 2, Insects in Clad 3 and out group organisms in Clad 4. The phylogeographical signals were apparent in Clad 1, segregating T. gigas collected from Pulau Gaya (Borneo) from the very species sampled in East coast of Malaysia (Balok and Pekan). The efficiency of cox1 gene in species level identification of various developmental stage of T. gigas was noted but it was inefficient in sex determination and precise identification of various developmental stages. The constructed phylogram proved the monophyletic nature of T. gigas with T. tridentatus. Atlantic horseshoe crab (L. polyphemus) was genetically distinct from other species of horseshoe crabs. Insects were clumped together in Clad 3 which shared a common branch node with horseshoe crabs proving their closer genetic relatedness with horseshoe crabs. Terrestrial scorpion species used in this analysis were clumped together in Clad 2 indicating their distant genetic relatedness with horseshoe crab species. Among the horseshoe crabs, L. polyphemus had comparatively higher GC content than the other species of horseshoe crabs. Average GC content in L. polyphemus was 38.02 % followed by C. rotundicauda 36.49 %, T. gigas (33.55 %) and T. tridentatus (32.78 %).

Fig. 1
figure 1

Neighbor-Joining (NJ) phylogenetic tree was constructed to determine the evolutionary history of horseshoe crabs with related sister taxa (Saitou and Nei 1987)

Full size image

3.2 Unweighted Pair Group Method with Arithmetic Mean (UPGMA) Method

UPGMA method was adopted to construct hierarchical clustering Phylogram to infer genetic relatedness of selected group of species (Fig. 2). This method strictly follows the molecular clock hypothesis (constant rate of evolution) and hence useful in verifying the information obtained through NJ-method. Same sequence file used for NJ method was also used for phylogram construction. As observed in NJ method, the out groups used were clearly segregated in separate branch in phylogram proving its reliability besides the higher bootstrap values in the internal branch nods. Four distinct clads were noted in the phylogram having horseshoe crabs in Clad 1, Insects in Clad 2, out group organisms in Clad 3 and Scorpions in Clad 4. Unlike the NJ method, UPGMA method could not show more apparently the phylogeographical signals in the constructed phylogram. However, similar to NJ method, UPGMA method also proved the efficiency of cox1 gene in species level identification of various developmental stage of T. gigas but it was inefficient in sex determination and precise identification of various developmental stages. The constructed phylogram also proved the monophyletic nature of T. gigas with T. tridentatus and their closer genetic relatedness. Atlantic horseshoe crab (L. polyphemus) was genetically distinct from other species of horseshoe crabs. Insects were clumped together in Clad 2 which shared a common branch node with horseshoe crabs proving their closer genetic relatedness with horseshoe crabs. As observed in NJ method, UPGMA method also segregated terrestrial scorpion species into a separate clad (Clad 4). Depth analysis of horseshoe crab phylogene using cox1 gene as a reference sequence clearly showed the closer genetic relatedness of T. gigas with T. tridentatus and their monophyletic origin which other molecular markers failed to address (Fig. 3).

Fig. 2
figure 2

Un-weighted Pair Group Method with Arithmetic Mean (UPGMA) phylogenetic tree was constructed to determine the evolutionary history of horseshoe crabs with related sister taxa (Saitou and Nei 1987)

Full size image
Fig. 3
figure 3

Monophyletic origin of Tachypleus gigas with T. tridentatus was determined using UPGMA phylogenetic tree

Full size image

Genetic Distance Data Analysis

Mean genetic distance within L. polyphemus at 1st, 2nd and 3rd codon position was 0.006, 0 and 0.048 respectively. Intra-species genetic distance among T. gigas and C. rotundicauda at 1st, 2nd and 3rd codon position were 0.016, 0.03 and 0.064 (T. gigas) and 0.003, 0 and 0.05 (C. rotundicauda) respectively. T. tridentatus showed no variation in GD value in all the codon positions. Among the Asian horseshoe crab species T. gigas showed closer genetic relatedness (lower GD value) with T. tridentatus with GD values of 0.037, 0.017 and 0.307 at 1st, 2nd and 3rd codon position respectively. This observation clearly revealed their monophyletic origin. The genetic distance values between C. rotundicauda and T. gigas were 0.053, 0.017 and 0.395 at 1st, 2nd and 3rd codon position respectively. Calculated genetic distance data showed higher genetic distance value in third codon position than its corresponding first and second codon positions. The GD data also proved the distance of genetic relatedness of L. polyphemus with Asian horseshoe crabs (Table 3).

Table 3 Average genetic distance (GD) between four available species of horseshoe crabs observed in only 1st, 2nd and 3rd codon positions
Full size table

Mean GD value within the four species of horseshoe crabs was 0.132, 0.053, 0.019 and 0.405 at 1st, 2nd and 3rd codon position respectively (at 1st + 2nd + 3rd + Noncoding gene). Average GD value between representative Insects and horseshoe crabs at 1st, 2nd and 3rd codon position were 0.207, 0.077 and 0.718 respectively. On the other hand mean GD values between representative Scorpion and horseshoe crabs at 1st, 2nd and 3rd codon position were 0.217, 0.063 and 1.264 respectively (Table 4). These observations proved the closer genetic relatedness of horseshoe crabs with insects than with scorpions.

Table 4 Mean genetic distance (GD) values of different groups of organisms with reference to horseshoe crab at all the possible codon position indicating 3rd codon position shows higher GD value
Full size table

Nucleotide diversity between horseshoe crab species was comparatively smaller (π = 0.150633) than between related sister group taxa and horseshoe crabs. Positive Tajima test statistic values of overall and within horseshoe crabs population signified low levels of both low and high frequency polymorphisms in the sequences (Table 5).

Table 5 Results from Tajima’s Neutrality test calculated for 36 sequences (including horseshoe crabs, insects and scorpions) and 24 sequences (only horseshoe crabs)
Full size table

Nucleotide substitution pattern observed among the test organisms (including horseshoe crabs, insects, scorpions and common crabs) clearly showed that transitional substitutions are very common in the gene sequence than transversional substitutions with transition/transversion bias value R = 0.988. The transition/transversion rate ratios were k 1  = 2.243 (for purines) and k 2  = 2.414 (for pyrimidines) (Table 6).

Table 6 Pattern of Nucleotide substitution observed among the test organisms (including horseshoe crabs, insects, scorpions and common crabs) calculated using Maximum Composite Likelihood method
Full size table

Nucleotide substitution pattern observed within the horseshoe crabs also showed that transitional substitutions are very common in the gene sequence than transversional substitutions with transition/transversion bias value R = 1.711. The transition/transversion rate ratios were k 1  = 4.143 (for purines) and k 2  = 4.375 (for pyrimidines) (Table 7).

Table 7 Pattern of Nucleotide substitution observed within horseshoe crabs, calculated using Maximum Composite Likelihood method
Full size table

4 Discussion

4.1 Phylogenetic Study on Horseshoe Crab

Earlier studies on the serology of Atlantic species, (L. polyphemus) and Indo-Pacific conspecifics (Shuster 1962), phylogenetic analyses of amino acid sequences of coagulogen and the fibrinopeptide-like peptide C (Shishikura et al. 1982; Srimal et al. 1985; Sugita and Shishikura 1995), immunological comparisons of hemocyanins (Sugita 1988), two-dimensional electrophoresis of general proteins (Miyazaki et al. 1987), interspecific hybridization experiments (Sekiguchi and Sugita 1980), cladistic appraisals of morphological characters (Fisher 1984), and mtDNA genes (Avise 1994) had clearly proved the sister taxon status of L. polyphemus to Indo-Pacific conspecifics. However, these molecular tools failed to address the monophyletic origin of Tachypleus gigas with T. tridentatus. Instead, all these molecular tools clumped T. gigas with C. rotundicauda and showed lower genetic distance between T. gigas and C. rotundicauda than between T. gigas and T. tridentatus (Kamaruzzaman et al. 2011). It was strongly believed that these three species constitute a phylogenetically irresolvable trichotomy (Xia 2000). However, all the previous studies failed to address the sampling size used in the phylogenetic tree construction. Ward et al. (2005) proved the importance of sampling size in determining and identifying the species using inter and intra species genetic distance data analysis. Recent studies on horseshoe crab phylogeny (Xia 2000; Kamaruzzaman et al. 2011) have a serious drawback due to the sample size they used to evaluate the topology of the phylogenetic tree. In this study, considerable number of sample (only horseshoe crabs N = 21) size gave substantial amount of information on the monophyletic origin of T. gigas and T. tridentatus which in turn was verified using UPGMA phylogram and genetic distance data analysis. Present study also showed the phylogeographical cues in cox1 gene.

4.2 Distance Matrix Method

4.2.1 Neighbor Joining (NJ) Tree

The phylogeographical signals were apparent in Clad 1, segregating T. gigas collected from Pulau Gaya (East Malaysia: Borneo) from the very species sampled in East coast of Peninsular Malaysia (Balok and Pekan). But the phylogram failed to segregate the samples collected from Balok and Pekan. This might probably due to 1. The short geographical distance between these sampled area (~80 km), 2. Constant gene flow between the horseshoe crab populations from these two sampling stations. Similar observation was reported by various researchers on fishes (Akbar John et al. 2010), ticks (Song et al. 2011) spiders (Zhang et al. 2005) and others (Hickerson and Cunningham 2000; MuÑOz et al. 2008). As observed in previous studies, the distant relatedness of American horseshoe crab (L. polyphemus) to the Indo Pacific conspecifics was apparent in the phylograms. More interestingly, the monophyletic origin of T. gigas with T. tridentatus was evident in Neighbor Joining (NJ) phylogram and this observation was cross examined using genetic distance (GD) data analysis which showed the GD value of (0.037, 0.017 and 0.307 at 1st, 2nd and 3rd codon position respectively) between T. gigas and T. tridentatus, whereas the GD values between T. gigas and C. rotundicauda was 0.053, 0.017 and 0.395 at 1st, 2nd and 3rd codon position respectively. Though this observation is in contrast to the previous studies, it is virtually true because of the large number of individual species of horseshoe crab samples used in this study. The monophyletic origin of T. gigas and T. tridentatus and the reliability of the phylogram were also checked by constructing sub phylogram constituting only representative horseshoe crab species and the selected out groups from possible sister taxa which also showed the similar results.

The phylogram clearly showed the genetic relatedness of horseshoe crabs and insects indicating that horseshoe crabs might have probably evolved from the ancient aquatic insects. This observation is in agreement with the conclusions of recent studies on horseshoe crab phylogeny (Xia 2000; Kamaruzzaman et al. 2011). However, Eurypterids (e.g., sea scorpions) have traditionally been regarded as close relatives of horseshoe crabs. Subsequent studies placed eurypterids closer to the arachnids (e.g., spiders, terrestrial scorpions, mites and ticks) in a group called Metastomata (Pavlicek et al. 2008). There has also been a belief that eurypterids are closely related to terrestrial scorpions (Raz et al. 2009). Recent study on the genetic relationships between arachnids and their relatives recognized Eurypterida, Xiphosura and Arachnida as three major groups, and their genetic relatedness at present cannot be resolved using available molecular markers (Shultz 2007). Similar conclusion was evident in the phylogram which was cross checked with genetic distance data that terrestrial scorpions which are closely related to sea scorpions are distantly related to horseshoe crabs.

4.2.2 PGMA Method

Unweighted Pair Group Method with Arithmetic Mean (UPGMA) was used to construct un-rooted phylogenetic tree to 1. Infer the genetic relationship between horseshoe crabs, 2. To check the reliability of information on the monophyletic origin of T. gigas with T. tridentatus, and 3. To verify the observation obtained in NJ tree method. As noted in NJ tree, UPGMA tree had 4 distinct clads segregating representative species to their respective clads. Unlike NJ tree, the basic principle and hypothesis in UPGMA method (constant rate of evolution) restricted its efficiency in showing the distinct phylogeographical cues in the phylogram. However, higher bootstrap value in internal nods and distinct segregation of representative species showed its efficiency in phylogenetic tree construction. The phylogram also proved the monophyletic origin of T. gigas with T. tridentatus and their closer genetic relatedness. Atlantic horseshoe crab (L. polyphemus) was genetically distinct from other species of horseshoe crabs. To verify this observation, a sub tree was constructed consisting of only 4 species of horseshoe crab and 3 out group species which also showed similar facts. Insects were clumped together in Clad 2 which shared a common branch node with horseshoe crabs proving their closer genetic relatedness with horseshoe crabs. Phylogram also showed the distant genetic relatedness of terrestrial scorpions with horseshoe crabs similar to NJ tree. Both NJ and UPGMA phylogram clearly proved the efficacy of COI gene in delineating the members of evolutionarily cryptic groups of organisms, besides revealing the monophyletic origin of south East Asian horseshoe crabs (T. gigas and T. tridentatus).

4.3 Genetic Distance (GD) Data Analysis

The basic principle behind the DNA barcoding technology is there should be low rates of DNA sequence divergence among individuals of the same species than between the species. In other words, intra species genetic distance should be low compared to inter species genetic distance. These were quite evident in GD data analysis (Hebert et al. 2003, 2004). In this study we mainly concentrated on the calculation of GD within horseshoe crabs because of the representation of all the four extant species in the constructed phylogram. Mean genetic distance within the horseshoe crabs at all the codon positions were 0.053, 0.019 and 0.405 at 1st, 2nd and 3rd Codon position respectively. Genetic Distance between the selected animal groups showed that the GD value was lower between horseshoe crabs and insects with 0.207, 0.077 and 0.718 at 1st, 2nd and 3rd codon position respectively compared to horseshoe crabs and scorpions with 0.217, 0.063 and 1.264 codon position respectively. This observation clearly indicated the closer genetic relatedness of insects with horseshoe crabs. Similar observation was made by Kamaruzzaman et al. (2011). It was also observed that the horseshoe crabs are genetically related to common crabs than the scorpion. This might be the reason why out group (Portunus pelagicus) used in this study clustered with horseshoe crabs closely than scorpions.

Another interesting observation made from the genetic distance data was higher genetic distance observed in third codon position than its corresponding first and second codon positions. Similar observation was made by Ward et al. (2005) while barcoding fishes from Australian waters. Simmons et al. (2006) also observed that greater phylogenetic signal is often found in parsimony-based analyses of third codon positions of protein-coding genes relative to their corresponding first and second codon positions, even for early-derived basal clades (Siemion and Przemyslaw 1994; Ajmal Khan et al. 2010). Average genetic distance among the different groups of test organisms used in this study showed higher GD value at 3rd codon position indicating that detailed study on 3rd codon position might reveal possible evolutionary information among the closely related groups of organisms.

4.4 Tajima’s Neutrality Test

Nucleotide diversity between horseshoe crab species was comparatively smaller (π = 0.150633) than between related sister group taxa and horseshoe crabs (π = 0.210329). Positive Tajima test statistic values of overall and within horseshoe crabs population signified that there were low levels of both low and high frequency polymorphisms in the horseshoe crab sequences which ultimately helped them in retaining the genetic makeup virtually unchanged over millions of years.

4.5 Nucleotide Substitution Analysis

It is a well-known fact that during DNA sequence evolution the rate of transitional changes differs from the rate of transversional changes, with transitions generally occurring more frequently than transversions. This difference is often referred to as transition bias, and estimation of the extent of transition bias may be of interest, since it may vary for different organisms and for different genes within a collection of organisms. In general, there are twice as many possible transversions as transitions due to the relatively high rate of mutation of methylated cytosines to thymine (Brown et al. 1982; Gojobori et al. 1982; Curtis and Clegg 1984; Graur and Li 2000). Proper estimation is also important because the ratio of the rates of transitional to transversional changes (often called the Ti:Tv ratio) play a role in evolutionary distance correction methods and is used in several common evolutionary models (e.g., the F84 model) (Wakeley 1996). However, it was observed that Ti:Tv ratio is strongly influenced by sampling size. Hence, we also calculated ti/tv bias which is more realistic and widely applied reliable estimate. Transition/Transversion (ti/tv) bias is known to be a general property of DNA sequence evolution, it is more pronounced in animal mitochondrial DNAs (mtDNAs) than in nuclear or chloroplast DNAs (Wakeley 1996). Estimation of the ti/tv bias is important not only to our understanding of the patterns of DNA sequence evolution, but also to reliable estimation of sequence distance and phylogeny reconstruction (Rosenberg et al. 2003).

The calculated ti/tv bias among the test organisms (including horseshoe crabs, insects, scorpions and common crabs) was R = 0.988 whereas ti/tv bias within horseshoe crabs was 1.711. This observation clearly proved that horseshoe crab cox1 undergoes more transition mutations compared to transversion mutations. This observation was also proved by calculating Ti:Tv ratio where this ratio was k 1  = 4.143 (for purines) and k 2  = 4.375 (for pyrimidines) within the horseshoe crabs.

5 Conclusion

Molecular taxonomic study clearly segregated American conspecific (Limulus polyphemus) from Indo Pacific horseshoe crabs and thereby proving their distant intra species genetic relatedness. More interestingly, the efficiency of cox1 gene in species level delineation of the cryptic taxonomy of horseshoe crabs proved the monophyletic origin of Tachypleus gigas and T. tridentatus which other molecular markers failed to address. Close genetic relatedness of horseshoe crabs with insects showed that they might have evolved from ancient aquatic insects. The efficiency of cytochrome oxydase C subunit 1 gene in species level identification evolutionarily conserved horseshoe crab genome was apparent in the constructed phylogram together with the precise identification of their differential developmental stages to the species level. It was also evident from the phylogram that cox1 gene has sound phylogeographical signals. Higher Genetic Distance (GD) value obtained from 3rd codon position than its corresponding 1st and 2nd codon positions proved the presence of grater genetic cues in 3rd codon position that could be used to study the genetic relatedness of evolutionarily conserved species in future.