Abstract
Mitochondrial DNAs (mtDNAs) appear in almost all eukaryotic species and are useful molecular markers for phylogenetic studies and species identification. Kinetoplast DNAs (kDNAs) are structurally complex circular mtDNA networks in kinetoplastids, divided into maxicircles and minicircles. Despite several kDNAs of many Leishmania species being examined, the kDNAs of the new species, Leishmania orientalis (formerly named Leishmania siamensis) strain PCM2, have not been explored. This study aimed to investigate the maxicircle and minicircle DNAs of L. orientalis strain PCM2 using hybrid genome sequencing technologies and bioinformatic analyses. The kDNA sequences were isolated and assembled using the SPAdes hybrid assembler from the Illumina short-read and PacBio long-read data. Circular contigs of the maxicircle and minicircle DNAs were reconstructed and confirmed by BLASTn and rKOMICs programs. The kDNA genome was annotated by BLASTn before the genome comparison and phylogenetic analysis by progressiveMauve, MAFFT, and MEGA programs. The maxicircle of L. orientalis strain PCM2 (18,215 bp) showed 99.92% similarity and gene arrangement to Leishmania enriettii strain LEM3045 maxicircle with variation in the 12s rRNA gene and divergent region. Phylogenetics of the whole sequence, coding regions, divergent regions, and 12s rRNA gene also confirmed this relationship and subgenera separation. The identified 105 classes of minicircles (402–1177 bp) were clustered monophyletically and related to the Leishmania donovani minicircles. The kinetoplast maxicircle and minicircle DNAs of L. orientalis strain PCM2 contained a unique conserved region potentially useful for specific diagnosis of L. orientalis and further exploration of this parasite population genetics in Thailand and related regions.
Similar content being viewed by others
Introduction
The genus Leishmania is a member of the order Trypanosomatidae and one of the most important infectious parasitic groups1,2. One characteristic of the Trypanosomatids is the presence of a vast DNA network known as kinetoplast DNAs (kDNAs) within the mitochondrion. This DNA network contains dozens of relaxed maxicircles (20–40 kb) encoded for mitochondrial rRNAs and protein subunits of the electron transport complexes, similar to other eukaryotes, and thousands of minicircles (0.5–2 kb) per species which encode most of the guide RNAs (gRNAs) involved in RNA editing (insertion or deletion of uridine) of some transcripts from the maxicircles3,4,5,6,7. The RNA editing process of Leishmania tarentolae has been widely studied as the best model among several trypanosomatids8,9,10. A single mitochondrion of L. tarentolae has approximately 5000–10,000 minicircles and 20–50 maxicircles11. The L. tarentolae maxicircle contains genes encoding for two small mitochondrial rRNAs (9S and 12S rRNAs), several proteins responsible for the electron transport chain, including cytochrome b (Cyb), cytochrome oxidase subunits I, II, and III (COI, COII, and COIII), NADH dehydrogenase subunits 1, 2, 3, 4, 5, 7, 8, and 9 (ND subunits), a ribosomal protein (RpS12), and four uncharacterized genes i.e., MURF2, MURF5 or uS3m (a component of the mitoribosome), G3 and G4 G-rich genes (components of the respiratory complex I)12,13,14. Some genes of the trypanosomes (COIII, Cytosine-rich Region 4 (CR4), ND9, and RpS12) were dual-coded, resulting in different proteins15,16,17,18,19. The transcripts derived from the leishmanial genes required editing, i.e., the high- or pan-editing of ND8, ND9, G3, G4, ND3, and RpS12 genes before the mRNA translation20,21,22. The large divergent region (DR) of the L. tarentolae maxicircle (approximately 12 kb in length) consists of numerous tandem repeats and is hypothesized to be a functionally unknown noncoding region7,8. Interestingly, another study in Leishmania major displayed different variations in the DR region compared between the promastigote and amastigote stages23.
Several previous studies uncovered the maxicircle DNA fragments from different Leishmania species. These findings included the discovery of the 8.4-kb maxicircle fragment from L. major strain MHOM/SU/73/5ASKH in 200824, an extensive RNA editing of genes encoded from the maxicircle of Leishmania donovani in 200925, and the identification of the 6.5-kb and 4.3-kb maxicircle fragments from Leishmania braziliensis strain MHOM/BR/75/M2904 in 201126. Advancement of next-generation sequencing technologies allowed quick and high-throughput determination of the nuclear genomic sequences of several Leishmania species and strains27,28,29,30. Only a few mitochondrial genomes were characterized in Leishmania31,32,33. In 2019, Camocho et al. used a BLAST search to extract sequence contigs specific to the maxicircles and employed a circularity test to confirm the minicircles of three Leishmania species (L. major, Leishmania infantum, and L. braziliensis) from the genomic sequence contigs31. Comparison of the maxicircles from these three species showed a conserved structure and gene order, while the number of minicircle classes varied: 97 classes for L. major, 49 classes for L. infantum, and three classes for L. braziliensis. Most identified minicircles shared conserved sequence blocks called CSBs. Another study identified 114 minicircle classes from L. tarentolae strain LEM125 and 24 classes from the UC strain using the PacBio sequencing platform13. A comparative genome study of seven L. infantum isolates in 2020 showed intra-specific conservation of the maxicircle and 59 distinct minicircle classes33. These authors found that drug-resistant strains had unique minicircle class patterns and tended to harbour an increased copy number of certain minicircle classes. Structural variation within the maxicircle of Leishmania panamensis strains was also observed, for example, within the ND5 and rpl12 genes, particularly in the DR region32. These genetic variations in the maxicircle and minicircle DNAs would benefit phylogenetic interpretation and understanding of the virulence and resistance of Leishmania species and strains.
Leishmania orientalis, formerly named Leishmania siamensis, is a new Leishmania species associated with cutaneous and visceral leishmaniasis observed in immunocompromised and immunocompetent patients, raising concerns about its resistance and pathogenesis owing to limited population genetic and genomic information34. Recently, the nuclear genomes of two L. orientalis strains (PCM2 from the southern province and LSCM4 from the northern province of Thailand) were published, and comparative analysis showed intra-specific genomic similarity35. However, the maxicircle and minicircle DNAs of L. orientalis remain unknown. Here, we aimed to identify the mitochondrial DNAs of L. orientalis strain PCM2 from next-generation and third-generation sequencing data and compare them with previously published maxicircle and minicircle DNAs of other Leishmania species. As a result, we presented the first maxicircle sequences and different minicircle classes of L. orientalis strain PCM2. These are useful for understanding parasite virulence, the RNA editing process, as well as further investigating the L. orientalis population genetics and classification.
Materials and methods
Culture of Leishmania orientalis strain PCM2
Leishmania orientalis strain PCM2 was maintained and provided by the Department of Parasitology, Phramongkutklao College of Medicine, Bangkok, Thailand. The promastigotes were grown at 26 °C in RPMI 1640-modified with 13.3 mM glutamine, 2.5 mM arginine, 0.3 mM cysteine, 1.7 mM glutamate, 62.1 mM proline, 0.6 mM ornithine, 3.8 mM glucose, 2.2 mM fructose, 5.1 mM malate, 2.8 mM α-ketoglutarate, 0.5 mM fumarate, 0.5 mM succinate, 25 mM HEPES, 50 µg/mL gentamicin, 2X MEM vitamins (Gibco, US), and 20% heat-inactivated fetal bovine serum (HIFBS, Gibco, US).
Genomic DNA preparation
Genomic DNAs of L. orientalis were prepared from the late logarithmic phase of the promastigotes. The promastigote pellets (approximately 5 × 107 parasites/mL) were collected and incubated in the lysis buffer (10 mM Tris, 10 mM KCl, 10 mM MgCl2, 0.5 M NaCl, 2 mM EDTA, 0.5% SDS, and 10 µL of 10 mg/mL Proteinase K solution) at 60 °C for 1 h until the pellet disappeared. After incubation, the samples were cooled to room temperature before a 1:1 ratio of chloroform-isoamyl alcohol (24:1, v/v) was added and gently vortexed for 30 s. The samples were centrifuged for 15 min at 10,000 rpm, and 300 µL of the aqueous phases were transferred to 1.5 mL tubes. Ten microliters of RNAse (20 mg/mL) were added, and the samples were incubated at room temperature for 3 min. The chloroform-isoamyl alcohol step was repeated to remove RNase. 750 µL absolute ethanol and 100 µL of 7.5 M ammonium acetate were added, and the samples were gently mixed until the solution was homogenous before incubating at -70 °C overnight. The samples were centrifuged for 15 min at 10,000 rpm. After discarding the supernatant, the DNA pellet was washed twice with 70% ethanol. Residual ethanol was carefully removed, and the pellet was air-dried at room temperature. Next, 100–200 µL Tris–EDTA buffer (pH 8.0) was added to the sample tubes and incubated at 37 °C, allowing the DNA pellet to dissolve. All samples were stored at − 70 °C until further use. The DNA concentration was measured using the NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, US), and the genomic integrity was analyzed by 1% agarose gel electrophoresis. The samples with the following criteria: total yield of 100–150 ng/µL, A260/A280 ratio of 1.80 ± 0.05, and A260/A230 ratio of 1.5 ± 0.05, were proceeded through the genome sequencing steps.
Isolation of maxicircle and minicircle reads from whole genome sequence data
For short-read sequencing, a 101-bp pair-end read library was constructed for whole-genome sequencing using the Illumina HiSeq2000 platform (Illumina, US). For long-read sequencing, a 20-kb PacBio library was constructed using the PacBio standard library preparation methods (Pacific Biosciences, CA) and the SMRTbell Express Template Preparation Kit 1.0. The sequence raw reads were quality-checked by FastQC program version 0.11.9 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)36 and processed through the filtering and trimming steps with a cut-off value of 30 using BBDuk program in the BBtools pipeline (sourceforge.net/projects/bbmap/). The reads from both platforms were used to generate hybrid assemblies of the circular DNA using the SPAdes assembler version 3.15.337,38, and the parameters were set as –pacbio –plasmid to assemble only the reads that could be constructed into the circular chromosome. Contigs were verified by a BLASTn search against the NCBI database39. The maxicircle and minicircle data, including the coding regions, divergent regions, and 12s rRNA gene from the NCBI database, were downloaded using an in-house Python script. The contigs that shared sequence homology corresponding to the maxicircle of Leishmania were selected for further analyses. The rKOMICS package extracted minicircle sequences and polished the contigs from the SPAdes assembly output40. This package performed the minicircle sequence cluster (MSC) analysis, which automated the assembly and circularization of mitochondrial genomes. The process of this toolkit was divided into three main steps: (1) assembling the contigs using MEGAHIT before extracting the minicircles using conserved sequences, (2) identifying the start and end of the minicircle for circularization using BLAST, and (3) correcting the direction of the CSB3 motifs for the polishing step. The polishing process generated a minicircle alignment based on the CSB3 sequence (GGGGTTG[G/A]TGTA) to rearrange the wrong sequence orientation in the minicircle contigs. After the assembly and identification, rKOMICS circularized the assembled minicircles using the BLASTn strategy to detect and remove duplicated sequences. Subsequently, rKOMICS polished the circularized minicircle DNAs to ensure the correct orientation of the CSB3 motifs, created minicircle alignments with the CSB1 motif at the starting position, and clustered the contigs based on the minimum percentage of identity using VSEARCH program41.
Annotation and visualization of the maxicircle and minicircle sequences
The extracted maxicircle contigs were annotated manually using the kDNA of Leishmania enriettii strain LEM3045 (GenBank accession number: BK010880.1) as a reference. The maxicircle genome was visualized and explored using SnapGene® software version 6.1.1 (https://www.snapgene.com/). The circularized and extended minicircle genomes were annotated using the BLASTn program39. Gene annotation and orientation of the maxicircle sequence were compared between different Leishmania species and visualized using the progressiveMauve alignment program42. The L. orientalis maxicircle scaffold sequences were validated by realigning with long-read sequence data using the minimap2 program version 2.1443,44 before polishing with the short-read data using the Pilon program version 1.2445. Quality and precision of the alignment results were assessed based on the read depth coverage using the samtools program version 1.946 and visualized by the SeqMonk program version 1.48.1 (https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/).
Phylogenetic analysis of the whole sequences and specific regions of the L. orientalis maxicircle and minicircle DNAs
Phylogenetic trees were constructed using the whole sequence, coding regions, divergent regions, and 12s rRNA gene of the maxicircle DNA and conserved sequence blocks (CSBs) regions from minicircles of L. orientalis strain PCM2 compared with those of other Leishmania species. The MAFFT program version 747 on the Unipro UGENE software suit version 44.048 was used to align the maxicircle DNAs using the DNA gap open penalty of 1.53, the DNA gap extension penalty of 0.123, and the omitted manual refinements. The pairwise comparison of the maxicircle sequences was conducted using the EMBOSS Water program with the following parameters: EDNAFULL for matrix, the gap penalty of 10.0, and the extended penalty of 0.549. Phylogenetic relationships were inferred using the Randomized Axelerated Maximum Likelihood (RaxML) program version 850 with the bootstrap values of 10,000 replicates for the complete maxicircle, coding regions, divergent regions, and the 12s rRNA gene as well as those of minicircles. For the phylogenetic analysis, the FastTree program version 2.151 and Interactive Tree Of Life (iTOL) version 552 were used to construct a phylogenetic tree, and the tree labels were adjusted using the MEGA 11 program53.
Results
This study reports the kinetoplastid genome assembly of L. orientalis strain PCM2 from an integrative analysis of short-read and long-read whole-genome sequencing data. The maxicircle scaffolds of L. orientalis strain PCM2 were validated by the alignment of the PacBio sequencing reads back to the scaffold, and a high level of read coverage (99.52%) was achieved throughout the scaffold length. This output highlighted the robustness and fidelity of the mapping procedure, indicating a comprehensive selection of the maxicircle sequences mixed within the whole genomic read data (Fig. 1a). The de novo assembly of the maxicircle genome using SPAdes resulted in a circular DNA contig of 18,215 base pairs, similar to the complete kinetoplast of L. enriettii strain LEM3045 (GenBank accession number: BK010880.1) with a length of 17,999 base pairs, e-value of 0.0, 100% coverage, and 99.92% identity. The L. enriettii LEM3045 kinetoplast sequence was shorter because of the different lengths of the divergent region (Fig. 1b). Pairwise alignment of the maxicircle genomes of L. orientalis strain PCM2 and L. enriettii strain LEM3045 confirmed the high level of relatedness of the subgenus Mundinia members, with 98.6% identity, 98.6% similarity, and 1.2% gaps.
To investigate the maxicircle structure, the progressiveMauve alignment program compared the annotated maxicircles of three Leishmania species, including L. tarentolae (20,992 bp), L. enriettii strain LEM3045 (17,999 bp), and L. orientalis strain PCM2 (18,215 bp), and showed a more similar genome structure between L. orientalis and L. enriettii (Fig. 1b). Manual annotation of the L. orientalis strain PCM2 maxicircle was conducted by multiple sequence alignment. The annotation revealed the conserved location and orientation of genes and regions closer to the annotated maxicircle of L. enriettii strain LEM3045 than those of L. tarentolae (Fig. 1c). Similar gene arrangements of the maxicircles of L. orientalis strain PCM2, L. enriettii strain LEM3045, and L. tarentolae were in the following order: 12s rRNA, 9 s rRNA, ND8, ND9, MURF5, ND7, COIII, Cyb, ATPase 6, ND2, G3, ND1, COII, MURF2, COI, G4, ND4, ND3, Rps12, ND5, and DR regions (Fig. 1c). The DR region of L. tarentolae was much longer than those of the other two Leishmania species.
To investigate the evolution and similarity of Leishmania maxicircles, the complete maxicircle sequence of L. orientalis PCM2 was compared with that of other Leishmania species. The results showed that the maxicircle could be used to separate different subgenera of Leishmania (Fig. 2a). The close relationship between the maxicircles of L. orientalis strain PCM2 and L. enriettii strain LEM3045 was supported by the phylogenetic results of the coding and divergent regions (Figs. 2b and 2c). Besides the highly conserved structure of trypanosomatid maxicircles54,55, the DR region, which consists of repeating sequences and displays variations across species56 was also selected and examined. The phylogenetic tree of the Leishmania DR regions showed the separation of the subgenus Mundinia from other Leishmania subgenera, as well as the split of the DR regions of the subgenera Leishmania and Viannia into two clusters, similar to the multiple-group separation of Trypanosoma (Fig. 2c). Therefore, the DR region may still be used to distinguish the subgenus Mundinia from other Leishmania subgenera (Fig. 2c).
A 0.02% difference between L. orientalis strain PCM2 and L. enriettii strain LEM3045 was observed not only in the DR region but also in the 12s rRNA gene region between positions 1270 and 1505 (Figs. 3a and 3b). Eleven SNPs and two deletions were detected when comparing the 12s rRNA gene of these two Leishmania species. A phylogenetic tree of the 12s rRNA genes from different Leishmania species was constructed. It showed that the variants within this gene could be used to distinguish L. orientalis strain PCM2 from L. enriettii strain LEM3045 and to discriminate subgenus Mundinia from other subgenera and outgroups (Fig. 3c).
One hundred and five minicircle classes of L. orientalis strain PCM2 were identified and compared. Three conserved sequence blocks (CSBs)57 were detected in the conserved regions of these minicircles, representing the minicircle signature (Fig. 4a). The identification of CSB-1 (AgGGGCGTTC), CSB-2 (cCCCGTNC), and CSB-3 (GGGGTTGGTGTA) confirmed the accuracy of the minicircle contigs of L. orientalis strain PCM2 (Figs. 4b and 4c). Another conserved region at position 1888–1915 was identified by multiple sequence comparisons between these L. orientalis minicircles, indicating the within-species similarity of these minicircle DNAs (Fig. 4d).
Comparison of 105 minicircle sequences of L. orientalis strain PCM2 with 2111 minicircle DNAs of other Leishmania species from the NCBI database showed that most of the L. orientalis strain PCM2 minicircles were monophyletically arranged within the same clade as some of the L. donovani minicircles. In contrast, subgenera Leishmania, Viannia, and Sauroleishmania minicircles were split into multiple groups, indicating the genetic diversification of these minicircles within the same Leishmania species (Fig. 5).
Discussion
This study successfully identified the mitochondrial genome, including a maxicircle and several minicircles, of L. orientalis strain PCM2 to complement its nuclear genome, which was previously published35. A new molecular-integrated taxonomic scheme for Leishmania suggested dividing Leishmania species into two major evolutionary lineages, Euleishmania and Paraleishmania58. Since 1999, L. martiniquensis has been discovered in many CL and VL cases in Thailand and is genetically linked to L. enriettii59,60. The subgenus Mundinia was established in 2018 and included several Leishmania species responsible for human and animal illnesses, L. (Mundinia) enriettii, L. (Mundinia) martiniquensis, formerly assigned to the subgenus Leishmania, and L. (Mundinia) orientalis, formerly named L. siamensis, a recently discovered species responsible for CL in Thailand59,61. Our previous study illustrated the genomic differences between the two strains of L. orientalis in Thailand35. The findings raised several questions regarding the genetics and population diversity of L. orientalis in Thailand and neighbouring countries. The hybrid assembly of the short- and long-read sequence data allowed the successful discovery of a complete maxicircle strand, which was similar to that of L. enriettii in terms of sequence and structural arrangement (Fig. 1), and unique classes of 105 minicircles that shared conserved motifs with those of other Leishmania species (Figs. 4 and 5).
As the maxicircle of Leishmania was previously reported to be useful for inferring phylogenetic relationships61, different formats of maxicircle DNAs, i.e. complete sequence, coding regions, divergent regions, and specific genes (12s rRNA) were explored in this study. Despite the high similarity (99.98%) between the maxicircles of L. orientalis strain PCM2 and L. enriettii strain LEM3045, subtle differences were exclusively observed in the 12s rRNA gene and the highly variable or divergent regions. Phylogenetic analysis of these sequences consistently confirmed the close genetic relationship between L. orientalis and L. enriettii within the subgenus Mundinia, which was nicely separated from other subgenera (Figs. 2 and 3), supporting the proposed usage of the maxicircle for evolutionary examination within the population or the same subgenus of Leishmania.
The divergent region is one of the problematic parts of maxicircle assembly because of the repetitive sequences in this region, and its function remains to be investigated8,62,63, unlike the coding region (CR), which contains fewer repeats. This study employed a hybrid assembly approach that combined short- and long-read sequencing platforms to enhance the coverage of the divergent region with minimized errors compared to short-read data alone, which was not long enough to cover the repeat area. Interestingly, the observed variation within this divergent region was also closely shared among members of the subgenus Mundinia (Fig. 2c), consistent with a previous study on the divergent region in Trypanosomatidae, which could be used to distinguish between different Leishmania species56. This finding was supported by a study by Flegontov et al., who identified conserved repeat patterns in the divergent region of six Leishmania species, including L. tarentolae, L. amazonensis, L. mexicana, L. major, L. turanica, and L. chagasi, using PCR amplification and Sanger sequencing7,23. Therefore, the uniqueness of the divergent region of L. orientalis maxicircle could benefit further investigation of L. orientalis population genetics and diversity in this Southeast Asian area.
In contrast, subtle variations were detected only in the coding region of the 12s rRNA gene of the maxicircles of L. orientalis and L. enriettii (Fig. 3). This gene is a mitoribosomal RNA gene that plays a role in the translation process and is recognized as a highly conserved gene in the Trypanosomatidae family56. The 12s rRNA variation was also observed in other Leishmania and trypanosome species, suggesting that this gene variation was perhaps the first event that occurred during the divergence of these two members in the subgenus Mundinia. The trypanosomal mitochondrial rRNAs, including 12S and 9S rRNAs, are substantially smaller than the eubacterial 23S and 16S rRNAs and also smaller than the mammalian mitochondrial 16S and 12S rRNAs due to the missing stem-loop structure in the secondary structure64,65. This variation may affect rRNA stability, secondary structure, and translation process66. The variable positions of the 12s rRNA gene were thus helpful for distinguishing between L. orientalis and L. enriettii and for further improvement of species-specific diagnostic methods.
The second part of the Leishmania kDNA network contains several thousands of minicircles ranging from 0.5 to 2 kbp, which transcribe guide RNAs required for the RNA editing process of maxicircle gene transcripts3. These guide RNAs bind to mitochondrial mRNA and edit the targeted mRNA sequences5,67,68. In Trypanosoma brucei, transcript editing accounts for over half of mature mRNAs69. According to the large number of minicircles (approximately 10,000 molecules classified into different classes) per cell, these minicircle DNAs were previously used as another suitable target for PCR-based Leishmania diagnosis70,71,72. The present and previous evolutionary studies have consistently distinguished the Old World (L. donovani, L. infantum, L. chagasi, L. tropica, L. major, and L. aethiopica) and New World (L. mexicana, L. amazonensis, L. venezuelensis, L. braziliensis, L. guyanensis, L. panamensis, and L. peruviana) Leishmania species using minicircle DNA analysis73,74,75.
Interestingly, in the present study, different classes of minicircles were detected in L. orientalis strain PCM2, which could be classified in the same clade and were closely related to L. donovani minicircles (Fig. 5). This study also identified an L. orientalis-specific conserved region in all samples between positions 1888 and 1916 (A/TTCCCCTAACTCGGGTGGGCCTCCGGGGGAG) of their minicircle DNAs, which was not related to any known minicircle DNAs in the NCBI nucleotide database (Fig. 4d). However, minicircle data of the subgenus Mundinia remain limited, and the inter- and intra-specific relationships within this genus could be further expanded using minicircle DNAs76. Considering the kDNA function, maxicircle DNAs function as mtDNA of other organisms, while minicircle DNAs play crucial roles in RNA editing77. The high genetic heterogeneity of these minicircles was previously reported and showed that different minicircular sequences could drive similar editing functions, but perhaps on different groups of genes78,79,80. The minicircular variation could also be divided into more than 200 classes within the same species, suggesting unexplained adaptable and pathogenic mechanisms to be further investigated81 as well as possible different functions of these different guide RNA genes82. Therefore, the unique sequences observed in the maxicircle and minicircle DNAs of L. orientalis strain PCM2 may be useful for a better specific diagnosis and identification of L. orientalis from more samples in the future.
Conclusion
This study was the first report to identify the mitochondrial genome or kDNA of L. orientalis strain PCM2, comprising a maxicircle and 105 minicircle classes, using hybrid whole-genome sequencing data. The maxicircle displayed a conserved genomic structure and gene arrangement in closely related Leishmania species. Variations in maxicircle and minicircle DNAs would benefit species identification and population genetic studies. Classes and sequence variations of minicircle DNAs could affect parasite adaptation and pathogenesis via RNA editing. Further investigation of the maxicircle and minicircle of more L. orientalis isolates would allow monitoring of this parasite for better medical treatment and healthcare.
Data availability
The data supporting this study's findings are submitted to the NCBI GenBank database, accession numbers OP159070-OP159175.
References
Cecílio, P. et al. Deception and manipulation: The arms of Leishmania, a successful parasite. Front. Immunol. 5, 480 (2014).
Akhoundi, M. et al. A historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Negl. Trop. Dis. 10(3), e0004349 (2016).
Jensen, R. E. & Englund, P. T. Network news: The replication of kinetoplast DNA. Annu. Rev. Microbiol. 66, 473–491 (2012).
Cavalcanti, D. P. & de Souza, W. The kinetoplast of trypanosomatids: From early studies of electron microscopy to recent advances in atomic force microscopy. Scanning 2018, 9603051 (2018).
Blum, B., Bakalara, N. & Simpson, L. A model for RNA editing in kinetoplastid mitochondria: RNA molecules transcribed from maxicircle DNA provide the edited information. Cell 60(2), 189–198 (1990).
Felsenstein, J. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evolut. 17(6), 368–376 (1981).
Flegontov, P. N., Guo, Q., Ren, L., Strelkova, M. V. & Kolesnikov, A. A. Conserved repeats in the kinetoplast maxicircle divergent region of Leishmania sp. and Leptomonas seymouri. Mol. Genet. Genom. 276(4), 322–333 (2006).
Muhich, M. L., Neckelmann, N. & Simpson, L. The divergent region of the Leishmania tarentolae kinetoplast maxicircle DNA contains a diverse set of repetitive sequences. Nucleic Acids Res. 13(9), 3241–3260 (1985).
Alfonzo, J. D., Blanc, V., Estevez, A. M., Rubio, M. A. T. & Simpson, L. C to U editing of the anticodon of imported mitochondrial tRNATrp allows decoding of the UGA stop codon in Leishmania tarentolae. EMBO J. 18(24), 7056–7062 (1999).
Sturm, N. R., Maslov, D. A., Blum, B. & Simpson, L. Generation of unexpected editing patterns in Leishmania tarentolae mitochondrial mRNAs: Misediting produced by misguiding. Cell 70(3), 469–476 (1992).
Simpson, L. The mitochondrial genome of kinetoplastid protozoa: Genomic organization, transcription, replication, and evolution. Annu. Rev. Microbiol. 41(1), 363–380 (1987).
Ramrath, D. J. et al. Evolutionary shift toward protein-based architecture in trypanosomal mitochondrial ribosomes. Science 362(6413), eaau7735 (2018).
Simpson, L., Douglass, S. M., Lake, J. A., Pellegrini, M. & Li, F. Comparison of the mitochondrial genomes and steady state transcriptomes of two strains of the trypanosomatid parasite, Leishmania tarentolae. PLoS Negl. Trop. Dis. 9(7), e0003841 (2015).
Duarte, M. & Tomás, A. M. The mitochondrial complex I of trypanosomatids-an overview of current knowledge. J. Bioenerg. Biomembr. 46(4), 299–311 (2014).
Kirby, L. E. & Koslowsky, D. Mitochondrial dual-coding genes in Trypanosoma brucei. PLoS Negl. Trop. Dis. 11(10), e0005989 (2017).
Ochsenreiter, T. & Hajduk, S. L. Alternative editing of cytochrome c oxidase III mRNA in trypanosome mitochondria generates protein diversity. EMBO Rep. 7(11), 1128–1133 (2006).
Sykes, S. E. & Hajduk, S. L. Dual functions of α-ketoglutarate dehydrogenase E2 in the Krebs cycle and mitochondrial DNA inheritance in Trypanosoma brucei. Eukaryot. Cell 12(1), 78–90 (2013).
Sykes, S., Szempruch, A. & Hajduk, S. The krebs cycle enzyme α-ketoglutarate decarboxylase is an essential glycosomal protein in bloodstream African trypanosomes. Eukaryot. Cell 14(3), 206–215 (2015).
Ochsenreiter, T., Cipriano, M. & Hajduk, S. L. Alternative mRNA editing in trypanosomes is extensive and may contribute to mitochondrial protein diversity. PloS One 3(2), e1566 (2008).
Maslov, D. A. Complete set of mitochondrial pan-edited mRNAs in Leishmania mexicana amazonensis LV78. Mol. Biochem. Parasitol. 173(2), 107–114 (2010).
Simpson, L. & Shaw, J. RNA editing and the mitochondrial cryptogenes of kinetoplastid protozoa. Cell. 57(3), 355–366 (1989).
Thiemann, O. H., Maslov, D. A. & Simpson, L. Disruption of RNA editing in Leishmania tarentolae by the loss of minicircle-encoded guide RNA genes. EMBO J. 13(23), 5689–5700 (1994).
Flegontov, P. N., Strelkova, M. V. & Kolesnikov, A. A. The Leishmania major maxicircle divergent region is variable in different isolates and cell types. Mol. Biochem. Parasitol. 146(2), 173–179 (2006).
Yatawara, L., Le, T. H., Wickramasinghe, S. & Agatsuma, T. Maxicircle (mitochondrial) genome sequence (partial) of Leishmania major: Gene content, arrangement and composition compared with Leishmania tarentolae. Gene 424(1–2), 80–86 (2008).
Neboháčová, M., Kim, C. E., Simpson, L. & Maslov, D. A. RNA editing and mitochondrial activity in promastigotes and amastigotes of Leishmania donovani. Int. J. Parasitol. 39(6), 635–644 (2009).
Nocua, P., Ramírez, C., Requena, J. M. & Puerta, C. J. Secuencia parcial del genoma del maxicírculo de Leishmania braziliensis, comparación con otros tripanosomátidos. Univ. Sci. 16(1), 29–50 (2011).
Rogers, M. B. et al. Chromosome and gene copy number variation allow major structural change between species and strains of Leishmania. Genome Res. 21(12), 2129–2142 (2011).
Singh, N., Chikara, S. & Sundar, S. SOLiD™ sequencing of genomes of clinical isolates of Leishmania donovani from India confirm leptomonas co-infection and raise some key questions. Plos one. 8(2), e55738 (2013).
Real, F. et al. The genome sequence of Leishmania (Leishmania) amazonensis: Functional annotation and extended analysis of gene models. DNA Res. 20(6), 567–581 (2013).
Llanes, A., Restrepo, C. M., Vecchio, G. D., Anguizola, F. J. & Lleonart, R. The genome of Leishmania panamensis: Insights into genomics of the L. (Viannia) subgenus. Sci. Rep. 5(1), 1–10 (2015).
Camacho, E. et al. Leishmania mitochondrial genomes: Maxicircle structure and heterogeneity of minicircles. Genes 10(10), 758 (2019).
Urrea, D. A., Triana-Chavez, O. & Alzate, J. F. Mitochondrial genomics of human pathogenic parasite Leishmania (Viannia) panamensis. PeerJ. 7, e7235 (2019).
Bussotti, G. et al. Nuclear and mitochondrial genome sequencing of North-African Leishmania infantum isolates from cured and relapsed visceral leishmaniasis patients reveals variations correlating with geography and phenotype. Microb. Genom. 6(10), mgen000444 (2020).
Bualert, L. et al. Case Report: Autochthonous disseminated dermal and visceral leishmaniasis in an AIDS patient, southern Thailand, caused by Leishmania siamensis. Am. J. Trop. Med. Hyg. 86(5), 821 (2012).
Anuntasomboon, P. et al. Comparative draft genomes of Leishmania orientalis Isolate PCM2 (formerly named Leishmania siamensis) and Leishmania martiniquensis Isolate PCM3 from the Southern Province of Thailand. Biology 11(4), 515 (2022).
Andrews, S. FastQC: A quality control tool for high throughput sequence data. In Babraham Bioinformatics (Babraham Institute, Cambridge, 2010).
Antipov, D., Korobeynikov, A., McLean, J. S. & Pevzner, P. A. hybridSPAdes: An algorithm for hybrid assembly of short and long reads. Bioinformatics 32(7), 1009–1015 (2016).
Antipov, D. et al. plasmidSPAdes: Assembling plasmids from whole genome sequencing data. Bioinformatics 32(22), 3380–3387 (2016).
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215(3), 403–410 (1990).
Geerts, M., Schnaufer, A. & Van den Broeck, F. rKOMICS: An R package for processing mitochondrial minicircle assemblies in population-scale genome projects. BMC Bioinform. 22(1), 1–14 (2021).
Rognes, T., Flouri, T., Nichols, B., Quince, C. & Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 4, e2584 (2016).
Darling, A. C., Mau, B., Blattner, F. R. & Perna, N. T. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14(7), 1394–1403 (2004).
Li, H. Minimap2: Pairwise alignment for nucleotide sequences. Bioinformatics 34(18), 3094–3100 (2018).
Li, H. New strategies to improve minimap2 alignment accuracy. Bioinformatics 37(23), 4572–4574 (2021).
Walker, B. J. et al. Pilon: An integrated tool for comprehensive microbial variant detection and genome assembly improvement. PloS One 9(11), e112963 (2014).
Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25(16), 2078–2079 (2009).
Katoh, K., Misawa, K., Kuma, K. I. & Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30(14), 3059–3066 (2002).
Okonechnikov, K., Golosova, O., Fursov, M., & Team, U. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics. 28(8), 1166–1167 (2012).
Thompson, J. D., Higgins, D. G. & Gibson, T. J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22(22), 4673–4680 (1994).
Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30(9), 1312–1313 (2014).
Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evolut. 26(7), 1641–1650 (2009).
Letunic, I. & Bork, P. Interactive tree of life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 49(W1), W293–W296 (2021).
Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evolut. 35(6), 1547 (2018).
Callejas-Hernández, F., Herreros-Cabello, A., del Moral-Salmoral, J., Fresno, M., & Gironès, N. The complete mitochondrial DNA of Trypanosoma cruzi: Maxicircles and minicircles. Front. Cell. Infect. Microbiol. 556 (2021).
Berná, L. et al. Maxicircle architecture and evolutionary insights into Trypanosoma cruzi complex. PLoS Negl. Trop. Dis. 15(8), e0009719 (2021).
Gerasimov, E. S. et al. Common structural patterns in the maxicircle divergent region of Trypanosomatidae. Pathogens 9(2), 100 (2020).
Ray, D. S. Conserved sequence blocks in kinetoplast minicircles from diverse species of trypanosomes. Mol. Cell. Biol. 9(3), 1365–1367 (1989).
Killick-Kendrick, R., Lainson, R., Rioux, J.-A., & Sar'janova, V. The taxonomy of Leishmania-like parasites of reptiles. pp. 143–8 (1986).
Espinosa, O., Serrano, M., Camargo, E., Teixeira, M. & Shaw, J. An appraisal of the taxonomy and nomenclature of trypanosomatids presently classified as Leishmania and Endotrypanum. Parasitology 145(4), 430–442 (2018).
Pothirat, T. et al. First isolation of Leishmania from Northern Thailand: Case report, identification as Leishmania martiniquensis and phylogenetic position within the Leishmania enriettii complex. PLoS Negl. Trop. Dis. 8(12), e3339 (2014).
Jariyapan, N. et al. Leishmania (Mundinia) orientalis n. sp. (Trypanosomatidae), a parasite from Thailand responsible for localised cutaneous leishmaniasis. Parasites Vectors 11(1), 1–9 (2018).
Sloof, P. et al. The nucleotide sequence of the variable region in Trypanosoma brucei completes the sequence analysis of the maxicircle component of mitochondrial kinetoplast DNA. Mol. Biochem. Parasitol. 56(2), 289–299 (1992).
Lee, S. T., Liu, H. Y., Chu, T. & Lin, S. Y. Specific A+ T-rich repetitive DNA-sequences in maxicircles from wildtype Leishmania mexicana amazonensis and variants with DNA amplification. Exp. Parasitol. 79(1), 29–40 (1994).
De la Cruz, V., Neckelmann, N. & Simpson, L. Sequences of six genes and several open reading frames in the kinetoplast maxicircle DNA of Leishmania tarentolae. J. Biol. Chem. 259(24), 15136–15147 (1984).
Eperon, I., Janssen, J., Hoeijmakers, J. H. J. & Borst, P. The major transcripts of the kinetoplast DNA of Trypanosoma brucei are very small ribosomal RNAs. Nucleic Acids Res. 11(1), 105–125 (1983).
Michelotti, E. F., Harris, M. E., Adler, B., Torri, A. F. & Hajduk, S. L. Trypanosoma brucei mitochondrial ribosomal RNA synthesis, processing and developmentally regulated expression. Mol. Biochem. Parasitol. 54(1), 31–41 (1992).
Pollard, V. W., Rohrer, S. P., Michelotti, E. F., Hancock, K. & Hajduk, S. L. Organization of minicircle genes for guide RNAs in Trypanosoma brucei. Cell. 63(4), 783–790 (1990).
Koslowsky, D. J., Riley, G. R., Feagin, J. E. & Stuart, K. Guide RNAs for transcripts with developmentally regulated RNA editing are present in both life cycle stages of Trypanosoma brucei. Mol. Cell. Biol. 12(5), 2043–2049 (1992).
Read, L. K., Myler, P. J. & Stuart, K. Extensive editing of both processed and preprocessed maxicircle CR6 transcripts in Trypanosoma brucei. J. Biol. Chem. 267(2), 1123–1128 (1992).
Selvapandiyan, A. et al. A Leishmania minicircle DNA footprint assay for sensitive detection and rapid speciation of clinical isolates. Transfusion 48(9), 1787–1798 (2008).
Noyes, H. A., Reyburn, H., Bailey, J. W. & Smith, D. A nested-PCR-based schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of Leishmania tropica in Pakistan. J. Clin. Microbiol. 36(10), 2877–2881 (1998).
Aransay, A. M., Scoulica, E. & Tselentis, Y. Detection and identification of Leishmania DNA within naturally infected sand flies by seminested PCR on minicircle kinetoplastic DNA. Appl. Environ. Microbiol. 66(5), 1933–1938 (2000).
Nicolas, L., Milon, G. & Prina, E. Rapid differentiation of Old World Leishmania species by LightCycler polymerase chain reaction and melting curve analysis. J. Microbiol. Methods 51(3), 295–299 (2002).
de Monbrison, F., Mihoubi, I. & Picot, S. Real-time PCR assay for the identification of cutaneous Leishmania parasite species in Constantine region of Algeria. Acta Trop. 102(2), 79–83 (2007).
de Paiva Cavalcanti, M. et al. Quantitative real time PCR assays for the detection of Leishmania (Viannia) braziliensis in animals and humans. Mol. Cell. Probes 27(3–4), 122–128 (2013).
Junqueira, A. C., Degrave, W. & Brandão, A. Minicircle organization and diversity in Trypanosoma cruzi populations. Trends Parasitol. 21(6), 270–272 (2005).
Stuart, K. & Feagin, J. E. Mitochondrial DNA of kinetoplastids. Int. Rev. Cytol. 141, 65–88 (1992).
Morel, C. et al. Strains and clones of Trypanosoma cruzi can be characterized by pattern of restriction endonuclease products of kinetoplast DNA minicircles. Proc. Natl. Acad. Sci. 77(11), 6810–6814 (1980).
Macedo, A. M., Martins, M. S., Chiari, E. & Pena, S. D. DNA fingerprinting of Trypanosoma cruzi: A new tool for characterization of strains and clones. Mol. Biochem. Parasitol. 55(1–2), 147–153 (1992).
Hanke, J. et al. Mapping the Trypanosoma cruzi genome: Analyses of representative cosmid libraries. Biotechniques 21(4), 686–693 (1996).
Hong, M. & Simpson, L. Genomic organization of Trypanosoma brucei kinetoplast DNA minicircles. Protist 154(2), 265–279 (2003).
Rusman, F., Floridia-Yapur, N., Tomasini, N. & Diosque, P. Guide RNA repertoires in the main lineages of Trypanosoma cruzi: High diversity and variable redundancy among strains. Front. Cell. Infect. Microbiol. 11, 663416 (2021).
Acknowledgements
The authors would like to thank the Department of Parasitology, Phramongkutklao College of Medicine; the Department of Microbiology, Faculty of Science, Mahidol University; the Department of Genetics, Faculty of Science, Kasetsart University for supporting this project; and the Faculty of Science, Kasetsart University for providing high-performance computing facilities.
Funding
This research was funded by Kasetsart University Research and Development Institute (KURDI) (Grant Number FF(KU)6.65).
Author information
Authors and Affiliations
Contributions
Conceptualisation, T.E., M.M., S.L., and R.B.; methodology, T.E., P.A., and S.S.; software, T.E. and P.A.; validation, T.E. and P.A.; investigation, T.E. and P.A.; resources, K.C. and S.U.; data curation, T.E.; writing—original draft preparation, T.E. and P.A.; writing—review and editing, M.M., S.L., and T.E.; supervision, M.M., S.L., R.B., and T.E.; project administration, T.E.; funding acquisition, T.E. All authors have read and agreed to the published version of the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Anuntasomboon, P., Siripattanapipong, S., Unajak, S. et al. Identification of a unique conserved region from a kinetoplastid genome of Leishmania orientalis (formerly named Leishmania siamensis) strain PCM2 in Thailand. Sci Rep 13, 19644 (2023). https://doi.org/10.1038/s41598-023-46638-3
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-023-46638-3
- Springer Nature Limited