Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration

Brown, Juliette A.; Wright, Anna; Bugescu, Raluca; Christensen, Lyndsay; Olson, David P.; Leinninger, Gina M.

doi:10.1038/s41598-018-38143-9

Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration

Article
Open access
Published: 12 February 2019

Volume 9, article number 1873, (2019)
Cite this article

Download PDF

You have full access to this open access article

Scientific Reports

Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration

Download PDF

Juliette A. Brown^1,2,
Anna Wright³,
Raluca Bugescu³,
Lyndsay Christensen⁴,
David P. Olson⁵ &
…
Gina M. Leinninger^2,3

4199 Accesses
29 Citations
2 Altmetric
Explore all metrics

Abstract

The lateral hypothalamic area (LHA) is essential for ingestive behavior but it remains unclear how LHA neurons coordinate feeding vs. drinking. Most LHA populations promote food and water consumption but LHA neurotensin (Nts) neurons preferentially induce water intake while suppressing feeding. We identified two molecularly and projection-specified subpopulations of LHA Nts neurons that are positioned to coordinate either feeding or drinking. One subpopulation co-expresses the long form of the leptin receptor (LepRb) and is activated by the anorectic hormone leptin (Nts^LepRb neurons). A separate subpopulation lacks LepRb and is activated by dehydration (Nts^Dehy neurons). These molecularly distinct LHA Nts subpopulations also differ in connectivity: Nts^LepRb neurons project to the ventral tegmental area and substantia nigra compacta but Nts^Dehy neurons do not. Intriguingly, the LHA Nts subpopulations cannot be discriminated via their classical neurotransmitter content, as we found that all LHA Nts neurons are GABAergic. Collectively, our data identify two molecularly- and projection-specified subpopulations of LHA Nts neurons that intercept either leptin or dehydration cues, and which conceivably could regulate feeding vs. drinking behavior. Selective regulation of these LHA Nts subpopulations might be useful to specialize treatment for ingestive disorders such as polydipsia or obesity.

TrkB-expressing paraventricular hypothalamic neurons suppress appetite through multiple neurocircuits

Article Open access 07 April 2020

A circuit from lateral septum neurotensin neurons to tuberal nucleus controls hedonic feeding

Article Open access 26 August 2022

Glutamatergic projections from homeostatic to hedonic brain nuclei regulate intake of highly palatable food

Article Open access 16 December 2020

Introduction

The lateral hypothalamic area (LHA) of the brain receives inputs from osmotic and energy-sensing sites and projects to centers coordinating goal-directed ingestive behavior to maintain homeostasis^1,2,3,4,5,6. Early studies defined the LHA as a “feeding center” because animals with lesion of LHA cell bodies lost all motivation to eat^7,8. Less emphasized, but equally important, is that animals with LHA lesions also lost the motivation to drink water and their resulting dehydration causes death well before starvation^9,10. Intriguingly, destroying passing dopaminergic fibers within the LHA similarly produces aphagia and adipsia, revealing that the LHA acts in concert with the dopamine system¹¹. Thus, the LHA modifies both types of ingestive behavior necessary for survival, but via incompletely understood mechanisms.

The discovery of molecularly- and projection-specified populations of neurons within the LHA suggested that some of them might be specialized to coordinate drinking vs. feeding. Yet, most of the LHA populations studied to date indiscriminately promote intake of food and water. LHA neurons expressing melanin concentrating hormone promote intake of both substances and do not specifically organize feeding vs. drinking^12,13. A separate population of orexin/hypocretin-expressing LHA neurons regulate arousal-dependent behaviors, including feeding, drinking and locomotor activity, but do not specify a particular ingestive behavior^14,15,16. LHA neurons have also been distinguished by their expression of the classical neurotransmitters glutamate or GABA. Inhibiting LHA glutamate neurons increases intake of a palatable “meal replacement” drink¹⁷, but it is unclear if this is an effort to obtain fluid, calories or if both ingestive behaviors are modulated by these neurons. Activation of all LHA GABA neurons increases behaviors to obtain food and liquids, but also invokes gnawing at non-caloric objects such as wood or the cage floor^18,19,20; thus, bulk activation of LHA GABA neurons cannot be considered to direct any specific ingestive behavior. While en masse activation of LHA GABA neurons is unlikely to occur in nature, there are subpopulations of LHA GABAergic neurons¹⁸ that may be activated by different physiologic cues to control intake. For example, LHA GABA neurons co-expressing the neuropeptide galanin mediate food seeking²¹. Conversely, the subset of LHA GABA neurons co-expressing the long form of the leptin receptor (LepRb) limit feeding with no effect on water intake^22,23. It is therefore possible that subsets of LHA GABA neurons might be activated by distinct physiologic cues, and hence differentially control food vs. water intake. However, the studies of LHA populations to date do not explain how the LHA specifically coordinates feeding or osmolality cues to direct the appropriate ingestive behavior.

We recently characterized a large population of LHA neurons that express the neuropeptide Neurotensin (Nts) and are separate from MCH or orexin/hypocretin neurons^22,24. Unlike other LHA populations that promote both food and water consumption, experimental activation of LHA Nts neurons promotes voracious drinking but restrains feeding²⁴. Since LHA Nts neurons have been reported to contain glutamate²⁵ or GABA^26,27, we hypothesized that there might be neurochemically, molecularly, and functionally heterogeneous subsets of LHA Nts neurons to coordinate drinking vs. feeding. Indeed, some (but not all) LHA Nts neurons co-express the long form of the leptin receptor (LepRb) and GABA and are activated by the anorectic hormone leptin^21,26; we refer to these as Nts^LepRb neurons. This Nts^LepRb population comprises a small, but essential subset of LHA Nts neurons necessary to mediate the anorectic response to leptin and proper regulation of energy balance²². Yet, mice lacking LepRb in LHA Nts^LepRb neurons do not exhibit any disruptions in drinking or bodily fluid content, suggesting that LHA Nts-mediated drinking might be mediated via different LHA Nts neurons²². Some LHA Nts neurons are responsive to physiologic changes in serum osmolality, as dehydration increases expression of Nts mRNA within the LHA²⁸; we refer to these as Nts^Dehy neurons. Exogenous Nts treatment also promotes drinking²⁹, although the endogenous sources of Nts mediating this effect remained unknown. Given that experimental activation of LHA Nts neurons promotes Nts release^24,27 and drinking^24,27,30,31, the dehydration-induced upregulation of LHA Nts could serve as a physiologic signal to drive water seeking and intake once water becomes available³². Taken together, these data suggest that some LHA Nts neurons can be activated by cues of energy or osmolality status and might comprise separate populations to coordinate feeding or drinking behavior. We therefore assessed whether LHA Nts^LepRb neurons and Nts^Dehy neurons are the same, or whether they are separate populations that are distinguishable via molecular, circuit and neurotransmitter criteria.

Results

Methods to Identify LHA Nts Neurons

In situ hybridization (ISH) identifies many Nts-expressing cells within the LHA (Fig. 1A,B)²⁸ but does not easily permit determination of co-expressed transcripts or circuit tracing. Nts immunofluorescence (Nts-IF) permits such analyses, but only labels fibers, not cell bodies (Fig. 1C) unless mice were pre-treated with the axonal transport inhibitor, colchicine (Fig. 1D)^33,34. Since colchicine induces neuronal dysfunction and lethality its use prohibits study of Nts contributions to normal physiology. Nonetheless, Nts-ISH and -IF confirm a large population of LHA neurons that actively express Nts (Fig. 1B,D). We reasoned that Nts^Cre mice would be useful to examine the molecular expression, projections, activation responses and neurochemistry of this large population of LHA Nts neurons without physiology-disrupting colchicine treatment. First, we verified the fidelity of this model for identifying Nts neurons by colchicine-treating Nts^Cre mice on a Cre-inducible GFP reporter background³⁵ (Nts^Cre; GFP mice). We examined two brain regions that have been shown via Nts-ISH to contain numerous Nts neurons: the subthalamic nucleus (STN) and the LHA³⁶. Similarly, Nts^Cre; GFP mice have dense populations of GFP-labeled neurons within the STN and LHA that co-label with Nts-IF (Fig. 1E–K). Thus, Nts^Cre; GFP mice reliably identify Nts neurons and can be used to characterize features of LHA Nts neurons.

Nts ^Cre; GFP Mice Confirm that Some LHA Nts Neurons Project to the Midbrain

LHA Nts neurons project to two midbrain regions, the ventral tegmental area (VTA) and the substantia nigra compacta (SNc)^26,37, which regulate motivated behaviors and motor function, respectively^38,39. We therefore hypothesized that different subsets of LHA Nts neurons might project to the VTA or SNc. First, we identified LHA Nts projecting neurons by injecting Nts^Cre; GFP mice with FluoroGold (FG) in the VTA (Fig. 2A–D) or the SNc (Fig. 2E–H), which is taken up by terminals and transported retrogradely to the soma of origin. Examination of VTA-injected mice revealed many LHA cell bodies that accumulated FG, some of which also contained GFP and hence identify LHA Nts neurons that project to the VTA (Fig. 2B–D, yellow arrows). Yet, many LHA Nts neurons did not accumulate FG from the VTA (Fig. 2B–D, green arrows). This could be because some LHA Nts neurons do not project to the VTA, or if there was insufficient FG throughout the VTA subregions containing LHA Nts terminals. However, we also found adjacent FG-labeled cells lacking GFP, indicating non-Nts containing LHA cells that provide input to the VTA and that FG coverage was sufficient to label various LHA soma (Fig. 2B–D, red arrows). Analysis of SNc-injected mice revealed similar groups of labeled neurons (Fig. 2F–H). Together, these data verify that that some LHA Nts neurons project to the VTA and SNc, but nearly twice as many project to the VTA vs. the SNc. (Fig. 2I). Our methodology prevented determination of whether any LHA Nts neurons provide collateral projections to these areas. However, the differing number of projections hint that there may be some separate subpopulations of LHA Nts neurons that project to the VTA, SNc, or sites other than the midbrain.

Nts^LepRb Neurons Are a Subset of LHA Nts Neurons that Project to the Midbrain

Some LHA Nts neurons can be molecularly distinguished via expression of LepRb (Nts^LepRb neurons) and we reasoned that they might project to either the VTA or SNc. To identify Nts^LepRb neurons we treated Nts^Cre; GFP mice with vehicle (Fig. 3A–C) or leptin (5 mg/kg i.p. 2–4 hr), which induces phosphorylation of STAT3 (pSTAT3) specifically in LepRb-expressing neurons. Some GFP-labeled LHA Nts neurons contained leptin-induced pSTAT3 and these are Nts^LepRb neurons (Fig. 3D–F, cyan-outlined magenta arrows). Yet, many GFP-labeled LHA Nts neurons did not contain pSTAT3 (Fig. 3D–F, cyan arrows). These data confirmed that there are at least two molecularly distinct populations of LHA Nts neurons: one population expresses LepRb and can be revealed by leptin-induced pSTAT3 (the Nts^LepRb neurons), but another LHA Nts population lacks LepRb.

Next, we asked whether the molecularly-specified Nts^LepRb neurons are also projection-specified. Nts^Cre; GFP mice were injected with FG to label LHA Nts neurons that project to the VTA or SNc, and also treated with leptin to permit pSTAT3-mediated identification of Nts^LepRb neurons. This paradigm identified Nts^LepRb neurons that accumulated modest amounts of FG from the VTA (Fig. 3G–J, white arrows) and from the SNc (Fig. 3K–N, white arrows). In each case we also observed Nts^LepRb neurons that did not accumulate FG; these may be Nts^LepRb neurons that project to the midbrain region that was not injected with FG or to a yet undetermined site outside of the midbrain (Fig. 3G–N, cyan-outlined magenta arrows). As expected, we also observed LHA Nts neurons lacking LepRb, some of which project to the midbrain (Fig. 3G–P, cyan-outlined yellow arrows), but other LHA Nts neurons did not accumulate FG and hence do not project to either midbrain region (Fig. 3G–P, cyan arrows). Together, these data signify that Nts^LepRb neurons are a molecularly-specified subset of LHA Nts neurons, some of which project to the VTA and SNc.

Nts^Dehy Neurons Are a Subset of LHA Nts Neurons that Do Not Project to the Midbrain

Since dehydration disrupts bodily osmolality and upregulates Nts mRNA in the LHA²⁸, we postulated that it might also modify the activity of LHA Nts neurons. To test this, we provided Nts^Cre; GFP mice with ad lib water (euhydration) or removed water overnight (dehydration), then examined the LHA for GFP and cFos (a marker of recent neuronal depolarization). During euhydration we observed few LHA Nts neurons with cFos, suggesting that LHA Nts neurons are not activated during normal fluid balance (Fig. 4A–C). In contrast, overnight dehydration increased cFos within some (but not all) LHA Nts neurons (Fig. 4D–F, cyan outlined magenta arrows). Thus, dehydration activates a subset of LHA Nts neurons, termed Nts^Dehy neurons. We then assessed midbrain projections of Nts^Dehy neurons in dehydrated Nts^Cre; GFP mice previously injected with FG in the VTA or SNc. Although we observed Nts^Dehy neurons in the LHA (Fig. 4G–N, cyan-outlined magenta arrows), none accumulated FG from the VTA or SNc. FG accumulation within other LHA neurons confirmed successful retrograde labeling (Fig. 4G–N, yellow and cyan-outlined yellow arrows). Together with Fig. 3, these data indicate that some Nts^LepRb neurons project to the midbrain but Nts^Dehy neurons do not. Given that Nts^Dehy neurons and Nts^LepRb neurons have different projection targets, they must comprise distinct subsets of LHA Nts neurons.

Nts^LepRb and Nts^Dehy Neurons Are Separate Subpopulations of LHA Nts Neurons

We reasoned that if Nts^LepRb neurons are distinct from Nts^Dehy neurons they would not be activated by dehydration. The requirement for leptin or dehydration to functionally identify Nts^LepRb and Nts^Dehy neurons meant that we could not simultaneously label these subsets in Nts^Cre; GFP mice. Instead, to test our hypothesis we assessed cFos in brains from dehydrated Nts^Cre; GFP mice (where GFP identifies all LHA Nts neurons) and LepRb^Cre; GFP mice (where GFP identifies all LepRb neurons). Since the majority of LHA LepRb neurons co-express Nts, the LepRb^Cre; GFP mice identify the Nts^LepRb neurons as well as some non-Nts expressing neurons²⁶. While dehydration significantly increased the percentage of LHA Nts neurons containing cFos (Fig. 5A,C), it did not alter the proportion of LHA LepRb neurons containing cFos compared to the euhydrated state (Fig. 5B,C). Because LHA LepRb neurons contain the subset of Nts^LepRb neurons, the absence of induced LepRb-cFos indicates that Nts^LepRb neurons are not activated by dehydration. Conversely, other Nts neurons lacking LepRb can be activated by dehydration. These data indicate that Nts^LepRb neurons are functionally distinct from Nts^Dehy neurons, as distinguished via their response to dehydration. Furthermore, these subpopulations of LHA Nts neurons are molecularly distinct, such that LepRb expression can be used to distinguish Nts^LepRb neurons from Nts^Dehy neurons. Taken together, data from Figs 3–5 reveal that LHA Nts neurons are not a homogeneous population but contain molecularly and projection-specified subsets of Nts^LepRb neurons and Nts^Dehy neurons that are differentially activated in response to changes in energy or fluid balance, respectively.

Verification of Cre-Dependent Reagents to Determine Classical Neurotransmitter Content

Given the heterogeneity of LHA Nts neurons at the molecular and circuit level, we hypothesized that they might differ in other ways, such as in classical neurotransmitter content. Neuropeptide-expressing neurons may contain GABA or glutamate, release of which determines whether synaptic targets are inhibited or activated, respectively²⁵. LHA Nts neurons have been reported as GABAergic²⁴ or glutamatergic⁴⁰, thus, we sought to define whether subpopulations might be neurochemically distinguishable. Since GABA and glutamate cell bodies cannot be labeled using immunoreagents, we crossed vGat^Cre and vGlut2^Cre mice with Cre-inducible GFP reporter mice to label these cells with GFP (vGat^Cre; GFP and vGlut2^Cre; GFP mice). A limitation of this model is that neurons can alter neurotransmitter expression over lifespan⁴¹, but recombination during development produces permanent GFP-labeling that may not reflect the neurochemistry of the mature neuron. Thus, we also injected adult vGat^Cre and vGlut2^Cre mice with an AAV Cre-Lox-red fluorescent protein (RFP) so that only actively-expressing GABA and glutamate-expressing neurons undergo recombination to express RFP. Finally, we compared these reporter models with ISH data in brain regions known to primarily contain glutamatergic neurons (the STN) or GABAergic neurons (the zona incerta, ZI) to verify the fidelity of each method for identifying neurotransmitter-expressing neurons in the adult brain. We observed similar distributions of vgat-ISH, and GFP- or AAV- Lox-RFP-labeled vGAT neurons in the ZI, but no labeled neurons in the adjacent STN (Fig. 6A–F). In contrast, ISH, GFP- and AAV-Lox-RFP labeling of vGlut2 cells all confirm the absence of glutamatergic neurons in the ZI but each method identified glutamatergic neurons in the STN (Fig. 6G–L). Hence, these genetic and viral methods accurately identify GABA and glutamate neurons and can be used to examine the neurotransmitter content of the LHA.

Nts ^FlpO Mice Identify LHA Nts Neurons Without the Use of Cre

Defining the neurotransmitter content of LHA Nts neurons requires simultaneous labeling of neurons expressing Nts and vGat or vGlut2. Problematically, the use of vGat^Cre and vGlut2^Cre mice necessary for detection of GABA and glutamate neurons precludes simultaneous Cre-dependent detection of Nts using Nts^Cre mice. To overcome this limitation, we generated Nts^FlpO mice to visualize Nts neurons via a non-Cre, FlpO-dependent mechanism. To verify the specificity of the system we injected Nts^FlpO mice and control mice lacking FlpO (WT) with an AAV that drives FlpO-inducible expression of GFP (AAV-Frt-GFP) (Fig. 6M–R”). We observed no GFP-labeled cells in the LHA, ZI and STN when WT mice were injected with AAV-Frt-GFP, despite the many Nts-expressing cells in these regions demonstrated via Nts-ISH (Fig. 6M–P”); these data confirm the FlpO-dependence for GFP expression. By contrast, injection of AAV-Frt-GFP into the LHA of Nts^FlpO mice resulted in GFP-labeled cell bodies within the LHA, ZI and STN (Fig. 6Q,R”). The distribution of GFP cells in Nts^FlpO mice is similar to that of Nts-ISH (Fig. 6M) and Nts^Cre; GFP mice, although fewer cells are reported; these results are consistent with the limited recombination efficiency of FlpO as compared to Cre⁴².

Determination of Classical Neurotransmitter Content Within LHA Nts Neurons Using the Dual Recombinase System

We generated dual recombinase mice to simultaneously label Nts cells and vGat or vGlut2-expressing cells by crossing Nts^FlpO mice to vGat^Cre or vGlut2^Cre mice, producing Nts^FlpO; vGat^Cre and Nts^FlpO; vGlut^Cre mice respectively. To test the fidelity of these dual recombinase mice, we injected them in the ZI with AAV-Frt-GFP (to permit FlpO-mediated expression of GFP that identifies Nts neurons) and AAV-Lox-RFP (to permit Cre-mediated expression of RFP for detection of vGat or vGlut2 neurons). Since the ZI contains primarily GABAergic but not glutamatergic neurons as well as some Nts neurons (Figs 1 and 6), the dual recombinase system should only result in GFP and RFP co-labeling of ZI cells in Nts^FlpO; vGat^Cre mice, but not in Nts^FlpO; vGlut^Cre mice. As anticipated, dual AAV injection into the ZI of Nts^FlpO; vGlut^Cre mice yielded many GFP-labeled Nts neurons, none of which contain RFP-vGlut2 (Fig. 7A,B”, cyan arrows). The GABAergic ZI is in fact devoid of RFP-vGlut2, despite the robust induction of RFP in surrounding regions known to contain glutamate (Fig. 7A). By contrast, in dual AAV-injected Nts^FlpO; vGat^Cre mice, we observed that all of the GFP-labeled Nts cells co-label with RFP-vGat, indicating that ZI Nts neurons are GABAergic (Fig. 7C,D”; white arrows indicate co-labeled cells, magenta arrows identify RFP-vGat cells that do not contain GFP-Nts). Taken together, these data confirm that the ZI Nts cells are GABAergic, but not glutamatergic, as would be expected of this primarily GABAergic brain region. Our findings also confirmed the reliability of the dual recombinase system to distinguish classical neurotransmitter content, so we next used it to determine whether subsets of LHA Nts neurons can be discriminated via their classical neurotransmitter expression. Dual AAV injection into the LHA of Nts^FlpO; vGlut^Cre mice identified GFP-Nts neurons confined within the perifornical LHA (Fig. 7E,F”, cyan arrows) and RFP-vGlut2 neurons (Fig. 7E,F”, magenta arrows), but we did not observe any LHA cells that co-expressed both labels. By contrast, dual AAV injection into the LHA of Nts^FlpO; vGat^Cre mice identified GFP-Nts neurons within the perifornical LHA, most of which co-labeled with RFP-vGat (Fig. 7G,H”, white arrows). We also observed many RFP-vGAT neurons that did not co-label with GFP-Nts (Fig. 7G,H” magenta arrows). Together these data suggest that LHA Nts neurons are predominantly GABAergic, and they comprise a subset within the larger population of LHA GABA neurons.

Determination of Classical Neurotransmitter Content of LHA Nts Neurons Using Colchicine-Mediated Nts-IF

The dual recombinase method suggests that LHA Nts neurons do not contain glutamate based on the absence of neurons co-expressing both Nts-GFP and RFP-vGlut2. This negative result could also be an artifact, perhaps if there were inefficient AAV-Lox-RFP infection within Nts^FlpO; vGlut^Cre mice that resulted in under-detection of LHA glutamate neurons. We therefore sought to validate the classical neurotransmitter content of LHA Nts neurons using an independent strategy that did not depend on AAV-mediated recombination. We attempted to generate dual-reporter mice, but commercially available FlpO reporter lines proved ineffective for simultaneous labeling of Nts and vGat or vGlut2 neurons. This also raised concern that limited efficiency of FlpO-mediated recombination in Nts^FlpO mice might under-report LHA Nts neurons and diminish the likelihood of detecting a small population of glutamatergic LHA Nts neurons.

Alternately, we treated vGat^Cre; GFP and vGlut2^IRESCre; GFP mice (validated in Fig. 6) with colchicine, allowing for simultaneous visualization of GFP-labeled vGat and vGlut2 and Nts-IF (as in Fig. 1). Similar to findings using the dual recombinase strategy, we observed numerous Nts-IF cell bodies within the LHA and ZI of colchicine-treated mice (Fig. 7I–N”). While the ZI from vGlut2^Cre; GFP mice was devoid of GFP-vGlut2 neurons (Fig. 7I,K–K”), vGat^Cre; GFP mice had numerous GFP-vGat neurons in the ZI, many of which also contained Nts-IF (Fig. 7L,N–N”, white arrows). These data are consistent with the GABAergic phenotype of the ZI and our findings using the dual recombinase system (Fig. 7G,H) that ZI Nts neurons are GABAergic but not glutamatergic. We observed many Nts-IF labeled cell bodies within the LHA, as well as GFP-labeled LHA glutamate neurons (Figure I’) and GFP-labeled GABA neurons (Fig. 7L). Despite the robust GFP-labeling induced in both lines, we did not observe any Nts-IF cell bodies within the LHA that co-localized with GFP-vGlut2 (Fig. 7J–J”). By contrast, essentially all of the LHA Nts-IF cell bodies overlapped with GFP-vGat (Fig. 7M–M”, white arrows), but many GFP-vGat neurons did not contain Nts-IR (magenta arrows). In sum, colchicine-mediated Nts-IR recapitulated our findings using the dual-recombinase system: that LHA Nts neurons are GABAergic but comprise a subset of the larger population of LHA GABA neurons.

Discussion

The LHA is essential for the motivation to eat and drink but the neural mediators of these behaviors have yet to be fully understood. While most LHA populations promote food and liquid intake, LHA Nts neurons divergently regulate ingestive behavior by suppressing feeding and promoting drinking^22,24. We therefore hypothesized that separate subpopulations of LHA Nts neurons might exist to coordinate opposing feeding and drinking behavior. Here we characterized two separate subpopulations of LHA Nts neurons that are differentially activated by leptin (Nts^LepRb neurons) or dehydration (Nts^Dehy neurons). While all LHA Nts neurons are GABAergic, the Nts^LepRb and Nts^Dehy subpopulations differ in molecular expression of LepRb and at the circuit level, and hence can be distinguished via these criteria (Fig. 8). These data demonstrate the heterogeneity of LHA Nts neurons and their specific responsiveness to either energy or fluid balance cues suggest that they may coordinate different ingestive behaviors (feeding vs. drinking).

Here we used Nts^Cre and Nts^FlpO mice to non-invasively and reliably identify Nts neurons, which permitted their study under normal, physiologic conditions. Using Nts^Cre mice, we found that dehydration treatment increased activation from ~6% at baseline to ~18%, demonstrating that ~12% of the LHA Nts neurons are Nts^Dehy neurons (Fig. 5C). Additionally, Nts^LepRb neurons make up a separate 15% of LHA Nts neurons²². While these are modestly sized populations, they can significantly influence homeostasis; for example, mice lacking leptin-regulation via Nts^LepRb neurons have impaired response to energy balance cues and diminished dopamine signaling that causes overweight^22,26. Characterization of the remaining 70% of LHA Nts neurons at the molecular and circuit level may provide insights about their function. For example, some LHA Nts neurons are activated by LPS-mediated inflammation and inhibit local orexin/hypocretin neurons, and these may contribute to illness-behavior⁴³. Nts signaling is also implicated in regulation of analgesia, thermoregulation, stress and addiction⁴⁴, so it will be important to determine if/how the remaining LHA Nts neurons contribute to these diverse aspects of physiology. Characterizing the heterogeneity of LHA Nts neurons may also suggest intersectional or pharmacological strategies to target specific subpopulations of LHA Nts neurons, and hence selective physiological outputs.

LHA neurons project widely throughout the brain and differentially modify behavior depending on their targets⁴⁴. Our finding that Nts^LepRb neurons, and not Nts^Dehy neurons, project to the midbrain suggests that there are distinct LHA Nts neural mechanisms for leptin-mediated suppression of feeding vs. regulation of drinking and fluid balance. Experimental activation of all LHA Nts neurons causes release of Nts to the VTA, and dopamine release into the nucleus accumbens²⁷ that can modify motivated intake behavior^27,45,46. Thus, at least some portion of anorectic leptin regulation via Nts^LepRb neurons could occur via direct projections to, and modulation of, mesolimbic dopamine signaling. This is consistent with the requirement of leptin action via Nts^LepRb neurons for regulating body weight and the integrity of the mesolimbic dopamine system, which are due in part to Nts signaling via VTA neurons expressing neurotensin receptor-1 (NtsR1)^26,37. In contrast, Nts^Dehy neurons must act via other yet-to-be determined projection targets, and do not directly modulate dopamine signaling to modify physiology. While the function of Nts^Dehy neurons and their projection sites remains to be established, the activation of Nts^Dehy neurons in response to dehydration suggests that they may coordinate fluid need with the motivation to drink. The discovery of specific subsets of LHA Nts neurons also hints at why experimental activation of all LHA Nts neurons results in diverging ingestive behaviors. Such activation simultaneously induces Nts^LepRb neurons that act partially via the VTA (and may be anorectic) as well as the Nts^Dehy neurons that regulate separate targets, and it is possible that these populations suppress feeding and promote drinking, respectively²⁴. Since Nts^LepRb and Nts^Dehy neurons are induced by separate physiological cues (leptin or dehydration), it remains to be determined whether there are any physiological situations in which these subpopulations are concurrently activated. In any case, our data confirm that Nts^LepRb and Nts^Dehy neurons have distinct circuitry, thus projection-specific modulation may be a useful strategy to discern their respective contributions to ingestive behavior.

Despite the molecular and circuit heterogeneity of LHA Nts neurons, they all contain the same classical neurotransmitter, GABA. LHA Nts neurons presumably inhibit synaptic targets via release of GABA, as well as regulating postsynaptic and adjacent neurons via release of Nts. It remains to be determined if GABA and Nts are always co-released from LHA Nts neurons. Indeed, different physiological stimuli bias the release of neurotransmitter vs. neuropeptide signals in some LHA neurons, and the receipt of these messages depends on the repertoire of receptors expressed on target neurons, which can also vary^47,48,49. Our finding that LHA Nts neurons are GABAergic is consistent with other reports of overlapping LHA Nts and GABAergic neurons^27,50 but contrasts with a report of glutamatergic LHA Nts neurons that directly project to the VTA⁴⁰. This discrepancy may be because AAV-Frt-GFP induced GFP expression was confined to the perifornical LHA (~Bregma −1.34 to 1.70⁵¹), and limited our characterization to this area only. However, the glutamatergic LHA Nts neurons were identified around the “rostral lateral hypothalamus” corresponding to Bregma −0.40, where the rostral LHA merges into the preoptic area, and well beyond the perifornical LHA. Hence, the GABAergic perifornical LHA Nts neurons studied here could be anatomically and neurochemically distinct from LHA Nts neurons of the hypothalamus-preoptic continuum.

While all LHA Nts neurons contain GABA, they are a subset of the vast population of LHA GABA neurons. This may account for the strikingly different behaviors observed after experimental activation of LHA Nts neurons (suppression of feeding, increased drinking) vs. activation of all LHA GABA neurons (increased feeding, drinking and gnawing directed at non-biological objects)^19,20,24,27. Since activation of LHA Nts and LHA GABA neurons promotes drinking, LHA Nts neurons contribute to at least some of the polydipsic effect. The orexigenic effect observed with activation of all LHA GABA neurons likely masks anorectic effects mediated by the subset of LHA Nts neurons encompassed within them. Our findings agree with reports of functionally-distinct subpopulations of LHA GABA neurons¹⁸, and LHA Nts neurons are a functionally unique subset within the larger population of all GABA neurons that suppress feeding instead of promoting it. This arrangement may also explain differences in VTA regulation that have been ascribed to these populations. Some LHA GABA neurons project to the VTA, where they disinhibit VTA GABA neurons that in turn releases inhibition of DA neurons to facilitate DA release and feeding^19,52. Some GABA-containing LHA Nts neurons, including Nts^LepRb neurons, also project to the VTA, and their precise synaptic targets are yet to be defined.

Taken together, our data reveal the heterogeneity of LHA Nts neurons. Since LHA Nts neurons are differentially regulated by energy status (leptin) vs. fluid status (dehydration), and comprise separate subpopulations, there may be separate neural mechanisms to coordinate feeding and drinking necessary for survival. If true, then these data may suggest strategies to selectively modify the LHA Nts neurons that control feeding vs. those that modify drinking.

Materials and Methods

Animals

Adult male and female mice were used for studies. Some Nts^Cre; GFP and LepRb^Cre; GFP mice were generated and treated with euhydration or dehydration at the University of Michigan, under the supervision of the Unit for Laboratory Animal Medicine (ULAM). These procedures were approved by the University of Michigan Institutional Animal Care and Use Committee (IACUC). All other mice were generated from a breeding colony at Michigan State University. MSU mice were cared for by Campus Animal Resources (CAR) and all animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at Michigan State University. All mouse experiments were performed in accordance with Association for Assessment and Accreditation of Laboratory Animal Care and National Institutes of Health guidelines. In all cases mice were housed in a 12 h light/12 h dark cycle and had ad libitum access to water and chow diet unless otherwise noted.

Generation of Nts ^FlpO Knock-In Mice

We modified the targeting vector used to generate Nts^Cre mice²⁶ to create an Nts^FlpO targeting vector. Briefly, the IRES-Cre was replaced with an IRES-FlpO sequence, such that it is inserted between the stop codon and the polyadenylation site of the sequence encoding the 3’ end of the mouse Nts gene. An frt-flanked NEO cassette lied upstream of the IRES-FlpO for selection purposes. The linearized Nts^FlpO targeting vector was electroporated into mouse R1 embryonic stem (ES) cells (129sv background) and cells were selected with G418. DNA from ES cell clones was analyzed via qPCR for loss of homozygosity using Taqman primer and probes for the genomic Nts insertion sites (Nts-IRES: Forward: TGAAAAGGCAGCTGTATGAAAATAA, Nts-IRES: Reverse: TCAAGAATTAGCTTCTCAGTAGTAGTAGGAA, Nts-IRES: Probe: CCAGAAGGCCCTACATTCTCAAGAGG. NGF was used as a copy number control. Putative positive ES clones were expanded, confirmed for homologous recombination by Southern blot and injected into mouse C57BL/6 blastocysts to generate chimeras. Chimeric males were mated with C57BL/6 females (Jackson Laboratory) and germline transmission was determined initially via progeny coat color, then confirmed via conventional PCR for FlpO (as described below).

Breeding and Genotyping

The Nts^Cre; GFP and LepRb^Cre; GFP mice were generated and genotyped as described previously²³. For all other experiments we utilized Nts^cre mice (Jackson stock #017525) that had been bred onto the C57/Bl6 background (Jackson #000664) mice for at least seven generations. To visualize Nts, vGat and vGlut2-expressing neurons, heterozygous Nts^cre mice, homozygous Slc32a1^tm2(cre)Lowl [Jackson stock #028862] and Slc17a6^tm2(cre)Lowl [Jackson stock # 028863] mice were crossed with homozygous Rosa26^EGFP-L10a mice³⁵ and progeny heterozygous for both alleles were studied (Nts^cre; GFP mice, vGat^Cre; GFP and vGlut2^Cre; GFP mice respectively). To simultaneously detect Nts and vGat or vGlut2 we utilized a dual-recombinase strategy. Briefly, we interbred Nts^FlpO mice (to permit FlpO-mediated recombination) and Slc32a1^tm2(cre)Lowl or Slc17a6^tm2(cre)Lowl mice (that enable Cre-mediated recombination) to generate progeny that were heterozygous for FlpO and Cre. These mice were injected with FlpO- and Cre-dependent reporters to visualize Nts and vGAT/vGlut-expressing neurons as described below. Genotyping was performed using standard PCR using the following primer sequences: Nts^cre: common forward: 5′ ATA GGC TGC TGA ACC AGG AA, Cre reverse: 5′ CCA AAA GAC GGC AAT ATG GT and WT reverse: 5′ CAA TCA CAA TCA CAG GTC AAG AA. Rosa26^EGFP-L10a: mutant forward: 5′ TCT ACA AAT GTG GTA GAT CCA GGC, WT forward: 5′ GAG GGG AGT GTT GCA ATA CC and common reverse: 5′ CAG ATG ACT ACC TAT CCT CCC. Nts^FlpO: Nts-FlpO-WT: Forward: CCAGGAAGATATCCTTGATAACGTCAAT, Reverse: GCAAGAAACATCACATCCAATAAAGCA N, Nts-FlpO-M: Forward: TGACCTACCTGTGCTGGATGAT, Reverse: CCACGTTCTTGATGTCGCTGAA. vGat^Cre: VgatIRESCre Common Forward: CTTCGTCATCGGCGGCATCTG, VgatIRESCre -WT Reverse: CAGGGCGATGTGGAATAGAAA, VgatIRESCre -Mutant Reverse: CCAAAAGACGGCAATATGGT.

Stereotaxic Injections

Stereotaxic surgeries were performed as described previously²² using coordinates from the mouse brain atlas of Paxinos and Franklin⁵¹. To facilitate detection of Nts containing cell bodies via Nts-IF, adult Nts^cre; GFP, vGat^Cre; GFP and vGlut2^Cre; GFP mice received injections of colchicine (10 μg in a volume of 500 nL) into the lateral ventricle (A/P −0.2, M/L −1.0, D/V −2.1), and were euthanized via cardiac perfusion ~48 hours after treatment. For tract tracing studies, Nts^cre; GFP mice were injected unilaterally with 75 nL of the retrograde tracer FluoroGold (FG) into the VTA (A/P: −3.2, M/L: +/−0.48, D/V: −4.65) or SNc (A/P: −3, M/L +/−1.3, D/V −4.7), and recovered for 7–10 days to allow for accumulation of FG in cell bodies of origin. Animals were only included in the study if the FG injection was targeted to and confined within the VTA or SNc. To simultaneously identify Nts and vGAT or vGlut, adult Nts^FlpO; vGat^Cre and Nts^FlpO; vGlut2^Cre mice were injected in the LHA with 400 nL of AAV-Frt-GFP adenovirus (provided by David Olson, University of Michigan) followed by 400 nL of AAV-hM3Dq-mCherry purchased from the UNC Vector Core (here termed AAV-Lox-RFP); these were infused at a rate of 100 nL/minute. LHA coordinates were A/P: −1.34, M/L +/−1.5, D/V −4.9, angle: 6°. Mice recovered for 2–3 weeks to permit sufficient time for recombinase-mediated reporter expression.

Leptin or Dehydration Treatment

Some FG-injected Nts^cre; GFP mice were treated with PBS or recombinant mouse leptin (5 mg/kg, i.p.) purchased from the National Hormone and Peptide Program (Los Angeles Biomedical Research Institute, Los Angeles, CA) then were perfused 2–4 hours later to enable detection of leptin-induced pSTAT3. In our hands, both of these leptin treatment times produce comparable pSTAT3. Males and females were studied but no notable differences between sexes were observed so they were pooled for analysis: VTA-injected vehicle-treated n = 6; female VTA-injected leptin-treated n = 10; SNc-injected vehicle-treated n = 5; SNc-injected leptin-treated n = 9.

Other FG-injected Nts^cre; GFP mice underwent a dehydration-activation paradigm in which they were either had ad libitum access to water (euhydration) or the water bottle was removed for 12 hr during the dark cycle (when mice drink most of their daily water). Mice were perfused the following morning and brain sections were stained for cFos, GFP and FG (see below). Due to the lack of observable differences between sexes, males and females were pooled for analysis: VTA-injected, euhydrated n = 5; VTA-injected, dehydrated n = 9; SNc-injected, euhydrated n = 5, SNc-injected, dehydrated n = 9.

Adult male 8–12 wk old Nts^Cre; GFP and LepRb^Cre; GFP mice were also treated via euhydration or had water bottles removed for 24 hr (including during the dark cycle) to induce dehydration then were perfused (Euhydrated Nts^Cre; GFP n = 7, LepRb^Cre; GFP n = 5; Dehydrated Nts^Cre; GFP n = 4, LepRb^Cre; GFP n = 3). Brains were analyzed for cFos and GFP, and 3 representative LHA sections spanning the same Bregma sections from each mouse were analyzed using Photoshop to count the number of GFP-only labeled neurons and GFP neurons containing cFos. Graphed data represent the average percentage of GFP neurons containing cFos out of the total number of GFP-labeled neurons ±SEM. Significant differences between genotypes and treatments were determined via 2-way ANOVA with Bonferroni posttests.

Immunohistochemistry and Immunofluorescence (IF)

Mice were treated with a lethal dose of i.p. pentobarbital and perfused transcardially with either 10% formalin or 4% paraformaldehyde (Sigma-Aldrich 158127) containing 0.4% picric acid (Sigma-Aldrich 197378). Brains were removed, post-fixed in the same fixative overnight at 4 °C, dehydrated with 30% sucrose/PBS for 2–3 days, then sectioned into 30 µm slices using a sliding microtome (Leica). Brain sections were analyzed by immunohistochemistry and/or IF as previously described²². For activation studies, brain sections first were exposed to either rabbit-anti pSTAT3 (1:500, Cell Signaling) or goat-anti cFos (1:500, Santa Cruz) followed by incubation with species specific Alexa-488 conjugated (Jackson ImmunoResearch, 1:200) or Alexa-568 conjugated antibodies (LifeTech, 1:200) and visualization with DAB (Sigma). IF labeling was performed exposing sections to primary antibodies, including chicken anti-GFP (1:2000, Abcam), rabbit anti-FG (1:500, Fluorochrome), rabbit-anti Nts (1:500, Phoenix) and/or anti-dsRed (1:1000, Clontech), followed by incubation with species-specific secondary antibodies conjugated to AlexaFluor 488 or 568 fluorophores (1:200, Life Technologies or Jackson ImmunoResearch). Immunolabeled brain sections were analyzed using an Olympus BX53 fluorescence microscope outfitted with transmitted light to analyze DAB-labeling as well as FITC and Texas Red filters for IF. Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled camera, and images were analyzed using Photoshop software (Adobe). We collected images from all mice within an experiment and compared them side-by-side to select the representative images included in the manuscript.

Quantification of Nts Neuronal LHA –> VTA and LHA –> SNc Projections

FG-injected Nts^cre; GFP mice were perfused and brains were stained as described above. An intact section between Bregma −1.3 and −1.5 was taken from each sample for quantification. The area medial and dorsal to the Fornix and ventral to the MT was counted to determine the number of FG (VTA/SNc-projecting) and GFP (Nts) labelled neurons in each. Males and females were studied but no notable differences between sexes were observed so they were pooled for analysis: VTA-injected n = 6; female; SNc-injected vehicle-treated n = 5. Graphed data represent the average number of GFP neurons containing FG. Significant differences between brain areas were determined via Student’s t-test and were calculated using GraphPad Prism (GraphPad Software Inc., San Diego, CA). Error bars depict ± standard error of the mean (SEM). **p < 0.01.

In Situ Hybridization (ISH) Data

Some figures include Nts, vGat and vGlut2 ISH data from the coronally-sectioned adult mouse brain courtesy of the Allen Brain Atlas (Lein et al.³⁶), which are identified within our figures as “Courtesy of Allen Brain”. The entire datasets can be referenced via the Allen Brain Atlas website: Nts: http://mouse.brain-map.org/experiment/show/73788032; vGat: http://mouse.brain-map.org/experiment/show/72081554; vGlut2: http://mouse.brain-map.org/experiment/show/73818754.

Data Availability Statement

No datasets were generated during this study. Links to the publicly available datasets of ISH data that were analyzed for this work are listed in the previous section.

References

Watts, A. G. & Boyle, C. N. The functional architecture of dehydration-anorexia. Physiology & behavior 100, 472–477, https://doi.org/10.1016/j.physbeh.2010.04.010 (2010).
Article CAS Google Scholar
Goto, M., Canteras, N. S., Burns, G. & Swanson, L. W. Projections from the subfornical region of the lateral hypothalamic area. The Journal of comparative neurology 493, 412–438, https://doi.org/10.1002/cne.20764 (2005).
Article PubMed PubMed Central Google Scholar
Hahn, J. D. & Swanson, L. W. Distinct patterns of neuronal inputs and outputs of the juxtaparaventricular and suprafornical regions of the lateral hypothalamic area in the male rat. Brain research reviews 64, 14–103, https://doi.org/10.1016/j.brainresrev.2010.02.002 (2010).
Article PubMed PubMed Central Google Scholar
Saper, C. B., Swanson, L. W. & Cowan, W. M. An autoradiographic study of the efferent connections of the lateral hypothalamic area in the rat. The Journal of comparative neurology 183, 689–706, https://doi.org/10.1002/cne.901830402 (1979).
Article CAS PubMed Google Scholar
Hahn, J. D. & Swanson, L. W. Connections of the lateral hypothalamic area juxtadorsomedial region in the male rat. The Journal of comparative neurology 520, 1831–1890, https://doi.org/10.1002/cne.23064 (2012).
Article PubMed PubMed Central Google Scholar
Hahn, J. D. & Swanson, L. W. Connections of the juxtaventromedial region of the lateral hypothalamic area in the male rat. Front Syst Neurosci 9, 66, https://doi.org/10.3389/fnsys.2015.00066 (2015).
Article CAS PubMed PubMed Central Google Scholar
Anand, B. K. & Brobeck, J. R. Localization of a “feeding center” in the hypothalamus of the rat. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 77, 323–324 (1951).
Article CAS Google Scholar
Anand, B. K. & Brobeck, J. R. Hypothalamic control of food intake in rats and cats. The Yale journal of biology and medicine 24, 123–140 (1951).
CAS PubMed PubMed Central Google Scholar
Morrison, S. D., Barrnett, R. J. & Mayer, J. Localization of lesions in the lateral hypothalamus of rats with induced adipsia and aphagia. The American journal of physiology 193, 230–234 (1958).
Article CAS Google Scholar
Teitelbaum, P. & Epstein, A. N. The lateral hypothalamic syndrome: recovery of feeding and drinking after lateral hypothalamic lesions. Psychological review 69, 74–90 (1962).
Article CAS Google Scholar
Ungerstedt, U. Adipsia and aphagia after 6-hydroxydopamine induced degeneration of the nigro-striatal dopamine system. Acta physiologica Scandinavica. Supplementum 367, 95–122 (1971).
CAS Google Scholar
Duncan, E. A., Proulx, K. & Woods, S. C. Central administration of melanin-concentrating hormone increases alcohol and sucrose/quinine intake in rats. Alcoholism, clinical and experimental research 29, 958–964 (2005).
Article CAS Google Scholar
Clegg, D. J. et al. Intraventricular melanin-concentrating hormone stimulates water intake independent of food intake. American journal of physiology. Regulatory, integrative and comparative physiology 284, R494–499 (2003).
Article CAS Google Scholar
Inutsuka, A. et al. Concurrent and robust regulation of feeding behaviors and metabolism by orexin neurons. Neuropharmacology 85C, 451–460, https://doi.org/10.1016/j.neuropharm.2014.06.015 (2014).
Article CAS Google Scholar
Tabuchi, S. et al. Conditional ablation of orexin/hypocretin neurons: a new mouse model for the study of narcolepsy and orexin system function. The Journal of neuroscience: the official journal of the Society for Neuroscience 34, 6495–6509, https://doi.org/10.1523/JNEUROSCI.0073-14.2014 (2014).
Article CAS Google Scholar
McGregor, R., Wu, M. F., Barber, G., Ramanathan, L. & Siegel, J. M. Highly specific role of hypocretin (orexin) neurons: differential activation as a function of diurnal phase, operant reinforcement versus operant avoidance and light level. The Journal of neuroscience: the official journal of the Society for Neuroscience 31, 15455–15467, https://doi.org/10.1523/JNEUROSCI.4017-11.2011 (2011).
Article CAS Google Scholar
Stamatakis, A. M. et al. Lateral Hypothalamic Area Glutamatergic Neurons and Their Projections to the Lateral Habenula Regulate Feeding and Reward. The Journal of neuroscience: the official journal of the Society for Neuroscience 36, 302–311, https://doi.org/10.1523/JNEUROSCI.1202-15.2016 (2016).
Article CAS Google Scholar
Jennings, J. H. et al. Visualizing hypothalamic network dynamics for appetitive and consummatory behaviors. Cell 160, 516–527, https://doi.org/10.1016/j.cell.2014.12.026 (2015).
Article CAS PubMed PubMed Central Google Scholar
Nieh, E. H. et al. Decoding neural circuits that control compulsive sucrose seeking. Cell 160, 528–541, https://doi.org/10.1016/j.cell.2015.01.003 (2015).
Article CAS PubMed PubMed Central Google Scholar
Navarro, M. et al. Lateral Hypothalamus GABAergic Neurons Modulate Consummatory Behaviors Regardless of the Caloric Content or Biological Relevance of the Consumed Stimuli. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 41, 1505–1512, https://doi.org/10.1038/npp.2015.304 (2016).
Article CAS Google Scholar
Qualls-Creekmore, E. et al. Galanin-Expressing GABA Neurons in the Lateral Hypothalamus Modulate Food Reward and Noncompulsive Locomotion. The Journal of neuroscience: the official journal of the Society for Neuroscience 37, 6053–6065, https://doi.org/10.1523/JNEUROSCI.0155-17.2017 (2017).
Article CAS Google Scholar
Brown, J. A. et al. Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts Leptin and Ghrelin-Mediated Control of Energy Balance. Endocrinology 158, 1271–1288, https://doi.org/10.1210/en.2017-00122 (2017).
Article PubMed PubMed Central Google Scholar
Leinninger, G. M. et al. Leptin acts via leptin receptor-expressing lateral hypothalamic neurons to modulate the mesolimbic dopamine system and suppress feeding. Cell metabolism 10, 89–98, https://doi.org/10.1016/j.cmet.2009.06.011 (2009).
Article CAS PubMed PubMed Central Google Scholar
Woodworth, H. L. et al. Neurotensin Receptor-1 Identifies a Subset of Ventral Tegmental Dopamine Neurons that Coordinates Energy Balance. Cell Rep 20, 1881–1892, https://doi.org/10.1016/j.celrep.2017.08.001 (2017).
Article CAS PubMed PubMed Central Google Scholar
van den Pol, A. N. Neuropeptide transmission in brain circuits. Neuron 76, 98–115, https://doi.org/10.1016/j.neuron.2012.09.014 (2012).
Article CAS PubMed PubMed Central Google Scholar
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the mesolimbic dopamine system and energy balance. Cell metabolism 14, 313–323, https://doi.org/10.1016/j.cmet.2011.06.016 (2011).
Article CAS PubMed PubMed Central Google Scholar
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral hypothalamus to locomotor activity and striatal dopamine efflux in male mice. Endocrinology, en20141986, https://doi.org/10.1210/en.2014-1986 (2015).
Watts, A. G., Kelly, A. B. & Sanchez-Watts, G. Neuropeptides and thirst: the temporal response of corticotropin-releasing hormone and neurotensin/neuromedin N gene expression in rat limbic forebrain neurons to drinking hypertonic saline. Behavioral neuroscience 109, 1146–1157 (1995).
Article CAS Google Scholar
Hawkins, M. F., Baker, J. D. & Baumeister, A. A. Neurotensin-induced polydipsia: a structure-activity study. Brain research 487, 188–191 (1989).
Article CAS Google Scholar
Watts, A. G., Sanchez-Watts, G. & Kelly, A. B. Distinct patterns of neuropeptide gene expression in the lateral hypothalamic area and arcuate nucleus are associated with dehydration-induced anorexia. The Journal of neuroscience: the official journal of the Society for Neuroscience 19, 6111–6121 (1999).
Article CAS Google Scholar
Watts, A. G. & Sanchez-Watts, G. Rapid and preferential activation of Fos protein in hypocretin/orexin neurons following the reversal of dehydration-anorexia. The Journal of comparative neurology 502, 768–782 (2007).
Article CAS Google Scholar
Watts, A. G. Osmotic stimulation differentially affects cellular levels of corticotropin-releasing hormone and neurotensin/neuromedin N mRNAs in the lateral hypothalamic area and central nucleus of the amygdala. Brain research 581, 208-216, 0006-8993(92)90710-Q [pii] (1992).
Kahn, D., Abrams, G. M., Zimmerman, E. A., Carraway, R. & Leeman, S. E. Neurotensin neurons in the rat hypothalamus: an immunocytochemical study. Endocrinology 107, 47–54, https://doi.org/10.1210/endo-107-1-47 (1980).
Article CAS PubMed Google Scholar
Woodworth, H. L., Brown, J. A., Batchelor, H. M., Bugescu, R. & Leinninger, G. M. Determination of neurotensin projections to the ventral tegmental area in mice. Neuropeptides, https://doi.org/10.1016/j.npep.2018.02.003 (2018).
Krashes, M. J. et al. An excitatory paraventricular nucleus to AgRP neuron circuit that drives hunger. Nature 507, 238–242, https://doi.org/10.1038/nature12956 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Lein, E. S. et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature 445, 168–176, https://doi.org/10.1038/nature05453 (2007).
Article ADS CAS PubMed Google Scholar
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic dopamine system by leptin and promotes hedonic feeding and obesity. Molecular metabolism 2, 423–434, https://doi.org/10.1016/j.molmet.2013.07.008 (2013).
Article CAS PubMed PubMed Central Google Scholar
Wise, R. A. & McDevitt, R. A. Drive and Reinforcement Circuitry in the Brain: Origins, Neurotransmitters, and Projection Fields. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology, https://doi.org/10.1038/npp.2017.228 (2017).
Bissonette, G. B. & Roesch, M. R. Development and function of the midbrain dopamine system: what we know and what we need to. Genes Brain Behav 15, 62–73, https://doi.org/10.1111/gbb.12257 (2016).
Article CAS PubMed Google Scholar
Kempadoo, K. A. et al. Hypothalamic Neurotensin Projections Promote Reward by Enhancing Glutamate Transmission in the VTA. The Journal of neuroscience: the official journal of the Society for Neuroscience 33, 7618–7626, https://doi.org/10.1523/JNEUROSCI.2588-12.2013 (2013).
Article CAS Google Scholar
Dulcis, D. et al. Neurotransmitter Switching Regulated by miRNAs Controls Changes in Social Preference. Neuron 95, 1319–1333 e1315, https://doi.org/10.1016/j.neuron.2017.08.023 (2017).
Article CAS PubMed PubMed Central Google Scholar
Kranz, A. et al. An improved Flp deleter mouse in C57Bl/6 based on Flpo recombinase. Genesis 48, 512–520, https://doi.org/10.1002/dvg.20641 (2010).
Article CAS PubMed Google Scholar
Grossberg, A. J. et al. Inflammation-induced lethargy is mediated by suppression of orexin neuron activity. The Journal of neuroscience: the official journal of the Society for Neuroscience 31, 11376–11386, https://doi.org/10.1523/JNEUROSCI.2311-11.2011 (2011).
Article CAS Google Scholar
Schroeder, L. E. & Leinninger, G. M. Role of central neurotensin in regulating feeding: Implications for the development and treatment of body weight disorders. Biochim Biophys Acta 1864, 900–916, https://doi.org/10.1016/j.bbadis.2017.12.036 (2018).
Article CAS Google Scholar
Ferrario, C. R. et al. Homeostasis Meets Motivation in the Battle to Control Food Intake. The Journal of neuroscience: the official journal of the Society for Neuroscience 36, 11469–11481, https://doi.org/10.1523/JNEUROSCI.2338-16.2016 (2016).
Article CAS Google Scholar
Berridge, K. C. & Kringelbach, M. L. Pleasure systems in the brain. Neuron 86, 646–664, https://doi.org/10.1016/j.neuron.2015.02.018 (2015).
Article CAS PubMed PubMed Central Google Scholar
Barbano, M. F., Wang, H. L., Morales, M. & Wise, R. A. Feeding and Reward Are Differentially Induced by Activating GABAergic Lateral Hypothalamic Projections to VTA. The Journal of neuroscience: the official journal of the Society for Neuroscience 36, 2975–2985, https://doi.org/10.1523/JNEUROSCI.3799-15.2016 (2016).
Article CAS Google Scholar
Baimel, C., Lau, B. K., Qiao, M. & Borgland, S. L. Projection-Target-Defined Effects of Orexin and Dynorphin on VTA Dopamine Neurons. Cell Rep 18, 1346–1355, https://doi.org/10.1016/j.celrep.2017.01.030 (2017).
Article CAS PubMed Google Scholar
Muschamp, J. W. et al. Hypocretin (orexin) facilitates reward by attenuating the antireward effects of its cotransmitter dynorphin in ventral tegmental area. Proceedings of the National Academy of Sciences of the United States of America 111, E1648–1655, https://doi.org/10.1073/pnas.1315542111 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Leinninger, G. M. Location, location, location: the CNS sites of leptin action dictate its regulation of homeostatic and hedonic pathways. International journal of obesity 33(2), S14–17, https://doi.org/10.1038/ijo.2009.66 (2009).
Article CAS PubMed Google Scholar
Paxinos, G. & Franklin, B. The Mouse Brain in Stereotaxic Coordinates. Second Edition edn, (Academic Press, 2001).
Nieh, E. H. et al. Inhibitory Input from the Lateral Hypothalamus to the Ventral Tegmental Area Disinhibits Dopamine Neurons and Promotes Behavioral Activation. Neuron, https://doi.org/10.1016/j.neuron.2016.04.035 (2016).

Download references

Acknowledgements

We thank co-author David P. Olson (University of Michigan) for graciously sharing the Cre-inducible Rosa^eGFP-L10a reporter line and AAV-Frt-GFP used in these studies and for guidance in designing Nts^FlpO mice. Thanks to Martin G. Myers, Jr. for generously providing LepRb^Cre; GFP mice for experiments. We also thank the transgenic cores at the University of Michigan and Van Andel Research Institute for assistance generating NtsR1^FlpO mice. This research was supported by grants from the NIH to JAB (T32-ES00725527, F31-DK107081) and GML (R01-DK103808), and Anna Wright was supported by an MSU College of Natural Science Undergraduate Research Award.

Author information

Authors and Affiliations

Michigan State University Department of Pharmacology and Toxicology, East Lansing, 48824, MI, USA
Juliette A. Brown
Institute for Integrative Toxicology at Michigan State University, East Lansing, 48824, MI, USA
Juliette A. Brown & Gina M. Leinninger
Michigan State University Department of Physiology, East Lansing, 48824, MI, USA
Anna Wright, Raluca Bugescu & Gina M. Leinninger
Division of Metabolism, Endocrinology and Diabetes, Department of Internal Medicine, University of Michigan, Ann Arbor, MI, 48109, USA
Lyndsay Christensen
Department of Pediatrics and Communicable Diseases, University of Michigan, Ann Arbor, MI, 48109, USA
David P. Olson

Authors

Juliette A. Brown
View author publications
You can also search for this author in PubMed Google Scholar
Anna Wright
View author publications
You can also search for this author in PubMed Google Scholar
Raluca Bugescu
View author publications
You can also search for this author in PubMed Google Scholar
Lyndsay Christensen
View author publications
You can also search for this author in PubMed Google Scholar
David P. Olson
View author publications
You can also search for this author in PubMed Google Scholar
Gina M. Leinninger
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.B. conducted the research, analyzed the data and wrote the manuscript. A.W. assisted in data collection for the dual recombinase model and assisted in preparation of Figs 6 and 7. R.B. bred and genotyped mice used for the studies. G.L. performed the experiment described in Fig. 5 and L.C. analyzed the data under the direction of G.L., who then prepared the figure. D.P. provided the AAV-Frt-GFP and guidance on its use for experiments presented in Fig. 7. G.L. oversaw the research and edited the manuscript. All authors reviewed and approved the manuscript.

Corresponding author

Correspondence to Gina M. Leinninger.

Ethics declarations

Competing Interests

The authors declare no competing interests.

Additional information

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Brown, J.A., Wright, A., Bugescu, R. et al. Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration. Sci Rep 9, 1873 (2019). https://doi.org/10.1038/s41598-018-38143-9

Download citation

Received: 08 June 2018
Accepted: 20 December 2018
Published: 12 February 2019
DOI: https://doi.org/10.1038/s41598-018-38143-9
Springer Nature Limited

This article is cited by

Circuit coordination of opposing neuropeptide and neurotransmitter signals
- Marta E. Soden
- Joshua X. Yee
- Larry S. Zweifel
Nature (2023)
Ontogenetic rules for the molecular diversification of hypothalamic neurons
- Marco Benevento
- Tomas Hökfelt
- Tibor Harkany
Nature Reviews Neuroscience (2022)

Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration

Abstract

Similar content being viewed by others

TrkB-expressing paraventricular hypothalamic neurons suppress appetite through multiple neurocircuits

A circuit from lateral septum neurotensin neurons to tuberal nucleus controls hedonic feeding

Glutamatergic projections from homeostatic to hedonic brain nuclei regulate intake of highly palatable food

Introduction

Results

Methods to Identify LHA Nts Neurons

Nts Cre; GFP Mice Confirm that Some LHA Nts Neurons Project to the Midbrain

NtsLepRb Neurons Are a Subset of LHA Nts Neurons that Project to the Midbrain

NtsDehy Neurons Are a Subset of LHA Nts Neurons that Do Not Project to the Midbrain

NtsLepRb and NtsDehy Neurons Are Separate Subpopulations of LHA Nts Neurons

Verification of Cre-Dependent Reagents to Determine Classical Neurotransmitter Content

Nts FlpO Mice Identify LHA Nts Neurons Without the Use of Cre

Determination of Classical Neurotransmitter Content Within LHA Nts Neurons Using the Dual Recombinase System

Determination of Classical Neurotransmitter Content of LHA Nts Neurons Using Colchicine-Mediated Nts-IF

Discussion

Materials and Methods

Animals

Generation of Nts FlpO Knock-In Mice

Breeding and Genotyping

Stereotaxic Injections

Leptin or Dehydration Treatment

Immunohistochemistry and Immunofluorescence (IF)

Quantification of Nts Neuronal LHA –> VTA and LHA –> SNc Projections

In Situ Hybridization (ISH) Data

Data Availability Statement

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Competing Interests

Additional information

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Circuit coordination of opposing neuropeptide and neurotransmitter signals

Ontogenetic rules for the molecular diversification of hypothalamic neurons

Search

Navigation

Nts ^Cre; GFP Mice Confirm that Some LHA Nts Neurons Project to the Midbrain

Nts^LepRb Neurons Are a Subset of LHA Nts Neurons that Project to the Midbrain

Nts^Dehy Neurons Are a Subset of LHA Nts Neurons that Do Not Project to the Midbrain

Nts^LepRb and Nts^Dehy Neurons Are Separate Subpopulations of LHA Nts Neurons

Nts ^FlpO Mice Identify LHA Nts Neurons Without the Use of Cre

Generation of Nts ^FlpO Knock-In Mice