Introduction

Scarabaeid dung beetles are cosmopolitan insects performing vital functions of terrestrial ecosystems such as nutrient cycling and secondary seed dispersal (Davis and Scholtz 2001). They are considered as excellent ecological indicator species (McGeoch et al. 2002). The true dung beetles belonging to Scarabaeinae with 16 tribes are diverse and cosmopolitan in the world (Bouchard et al. 2011; Tarasov and Dimitrov 2016; Tarasov 2017; Davis et al. 2019). Among them, Onthophagini with 35 genera (Philips 2016) and Onthophagus Latreille 1802 with ca. 2189 species are the most diverse taxa (Schoolmeesters 2020). They are cosmopolitan (Emlen et al. 2005, Schoolmeesters 2020), but speciose in tropics (Hanski and Krikken 1991). Oriental region has about 600 species of Onthophagus (Tarasov and Solodovnikov 2011).

India has about 400 species of dung beetles, belonging to 30 genera and 9 tribes (Priyadarsanan et al. 2017). Among these, 194 species belonging to 29 genera have been reported from the Western Ghats biodiversity hotspot (Priyadarsanan et al. 2017), and 78 species have been recorded from the moist southern Western Ghats, in which 19 are endemic to the Western Ghats (Sabu et al. 2011). Yet, the dung beetles of India is underrepresented in global biogeography and phylogeny studies due to their poor representation in global databases (Monaghan et al. 2007; Breeschoten et al. 2016). This study is aimed to fill this critical gap by generating the DNA barcodes of dung beetle species belonging to Onthophagus and Onitis from the Western Ghats.

Onthophagus is considered to have a possible Afrotropical origin (Emlen et al. 2005; Monaghan et al. 2007; Tarasov and Solodovnikov 2011; Philips 2016) and subsequent range expansion to Palearctic and Oriental regions (Davis et al. 2002). A satisfactory classification of the innumerable species of this genus using morphological traits is highly challenging. Since the species are sexually dimorphic, it is not easy to find characters common to both (Arrow 1931). Onthophagus displays a variety of noticeable morphological traits such as single/paired horns in the head and/ or thorax and phenotypic diversity. These morphological traits have been used for grouping the beetles into different taxonomic Species Groups. Arrow (1931), Balthasar (1963), Boucomont (1923), Branco (1992), and d’Orbigny (1913) have relied on these traits to group them into Species Groups. The Fauna of British India (Arrow 1931) and Balthasar (1963) have given a comprehensive taxonomic treatment of the Indian dung beetles. Like D’Orbigny (1913) treated Onthophagus of Africa, Arrow (1931) has classified 191 species of Onthophagus in Indian subcontinent into 25 Species Groups. But, clarity on generic and infra-generic status of some dung beetle genera was required. Balthasar’s (1963) classification of Scarabaeinae consists of 12 tribes. It is the most commonly used tribal level classification and comprises six tribes each of rollers and tunnellers. Balthasar (1963) listed 551 species of Onthophagus belonging to 16 subgenera from Oriental and Palaearctic region. Since then, there are no considerable initiatives made to study the Indian dung beetles in a comprehensive manner. Sewak (2003) listed 96 species of Onthophagus from the states of Arunachal Pradesh, Gujarat and Rajasthan in India. Subsequently, checklists of dung beetles collected from different localities of the Western Ghats were made available (Sabu et al. 2011; Karimbumkara and Rajan 2013; Sathiandran et al. 2015; Thomas and Sabu 2018).

Mitochondrial genes are reliable genetic markers for studying insect phylogeny and biogeography (Simon et al. 1994; Caterino et al. 2000; Simmons and Weller 2001) as they are estimated to evolve faster than nuclear protein-coding genes (Monteiro and Pierce 2001). Most importantly, DNA barcoding is widely used in taxonomic revisions (Erlacher and Erlacher 2016; Gibson and Fusu 2016; Belokobylskij et al. 2017; Zupolini et al. 2017; Corley and Ferreira 2019; Ferrari 2020; Levesque-Beaudin and Mlynarek 2020) .

Many studies provide evidence for Gondwanan relics and endemicity of the Western Ghats fauna, such as frogs and toads (Biju and Bossuyt 2003), caecilians (Oommen et al. 2000), and geckos (Mirza et al. 2014). Since the Indian plate is the only tectonic plate that moved northwards from the Gondwana (Briggs 2003), it is expected that the molecular characterization of the Indian dung beetles can give additional insights into the origin, diversification, and biogeography of dung beetles. At present, none of the Indian dung beetles have been molecularly characterized or sequenced. This creates a major gap in global studies on dung beetle diversity, distribution, and biogeography as noticed by Breeschoten et al. (2016). This study is aimed to a) generate DNA barcodes of 27 species of Onthophagus and one species of Onitis, and b) enquire whether the molecular phylogeny complies with the Species Groups as suggested by the morphological classification.

Materials and methods

Specimen collection and identification

Dung beetles were collected from the forests and adjoining home gardens of Coorg (between 12°0.489′N 76°2.279′E and 12°16.108′N 75°38.592′E), Kasaragod (between 12° 17.14′N 75° 15.1′E and 12°8.200′N 75°9.384′E), and Trivandrum (between 8°17.512′N 77°6.468′E and 8°47.686′N 76°45.902′E) parts of the Western Ghats. The dung pat was laid at around 6 AM on the floor after clearing the litter and retrieved at around 6 AM next day. We retrieved the dung along with the soil underneath and carried to lab in polythene carry bags. We soaked the entire contents in a bucket full of water and stirred well to allow the beetles to float on the surface of water. The floated beetles were collected and preserved in 99% ethanol. They were keyed out following Arrow (1931) and Balthasar (1963). Voucher specimens were maintained and deposited in the Entomology collection of the Central University of Kerala, India. In the present investigation, we considered 27 species of Onthophagus belonging to the 9 Species Groups and one species of Onitis was included as an outgroup (Table 1).

Table 1 List of species used in the study with their corresponding tribe and species group
Full size table

DNA isolation, amplification and sequencing

Genomic DNA was isolated from the thorax of small species and from the hind leg of large species (Orsini et al. 2007) using QIAGEN DNeasy Blood & Tissue Kit (Qiagen, Germany) as per the manufacturer’s instructions with slight modification. Tissues were incubated overnight at 56 °C in 180 μl of ATL buffer and 20 μl of Proteinase K to completely lyse the tissue. The quality and quantity of the isolated DNA were checked using Gel Electrophoresis and Nanodrop (2000c, Thermoscientific, USA) respectively.

A 650 bp nucleotide portion of mitochondrial cytochrome c oxidase I (cox1) gene was amplified using the primers LCO1490 (5′ GGTCAACAAATCATAAAGATATTGG 3′) and the reverse primer HCO2198 (5′TAAACTTCAGGGTGACCAAAAAATCA3′) (Folmer et al. 1994). The PCR reaction mixture was set up for 27 μl which constituted 12.5 μl of PROMEGA master mix (2X), 10 pmol each of forward primer and reverse primer, 10–50 ng of template DNA and 6.5 μl of nuclease free water. The following PCR thermocycling conditions were applied: initial denaturation for 3 min at 95 °C followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 42 °C–43.5 °C for 1 min and extension at 72 °C for 1 min followed by final extension at 72 °C for 5 min. The amplification was performed in Eppendorf master cycle Pro-S. The amplified PCR products were further purified using Invitrogen’s PureLink PCR Purification Kit as per the manufacturer’s instructions and sequenced on ABI 3730 system using Big Dye Terminator v3.1 kit.

Sequence analysis

The sequences were checked for the quality with Sequence Scanner Software 2, version 2.0 and submitted to GenBank of NCBI (www.ncbi.nlm.nih.gov) and accession numbers were obtained (Supplementary Table 1). The BioEdit sequence alignment editor, version 7.2.6 (Hall 1999) and ClustalW in MEGA 6.06 (Tamura et al. 2013) were used to edit and align the sequences respectively. The Neighbour Joining tree was generated in Mega 6.06. Onitis sp. was used as the outgroup. Kimura 2 parameter model of base substitution was used for the calculation of interspecific distance.

Results

Sequences of 115 samples representing 27 Onthophagus species and one Onitis species were generated. The sequences were compared with those in the NCBI GenBank by performing BLAST analysis. The respective species were identified to Onthophagus and Onitis, but due to poor representation of Indian dung beetle species in the database, the sequences were not identified to respective species. The average nucleotide frequencies were T = 38.9%, C = 15.8%, A = 29.1%, G = 16.2%. The Base composition analysis showed that the mean T content was highest and the mean C content was lowest. The mean AT content (68%) was more than the mean GC content (32%). Onthophagus duporti Boucomont had the highest GC content (34.5%) and Onthophagus pygmaeus Schaller had the lowest GC content (29.9%) (Supplementary file, F1). The overall mean genetic distance was 0.14. The interspecific genetic distance ranged from 0.02 to 0.20. The distance matrix showing the pair-wise distance revealed the evolutionary divergence between the sequences. The number of base substitutions per site between sequences is given in Supplementary file F2.

The sequence divergence between Onitis sp. and Onthophagus spp. ranged from 0.14 to 0.17. Onitis sp. showed a maximum evolutionary distance of 0.170 with Onthophagus spinifex Fabricius, and a minimum evolutionary distance of 0.137 with Onthophagus quadridentatus Fabricius. The evolutionary distance of 0.02 to 0.20 between the Onthophagus species was low because they all belonged to the same genus. Onthophagus favrei Boucomont and Onthophagus fasciatus Boucomont were closer with a genetic distance of 0.02, whereas Onthophagus spinifex Fabricius and Onthophagus urpator Balthasar were most distant with a genetic distance of 0.20 (Supplementary file F2).

The NJ tree (Fig. 1) although did not fully support the morphological Species Groups of Arrow (1931) the following species came more immediate in the tree: Onthophagus dama Fabricius and O.laevigatus Fabricius of the Dama group, O. duporti and O.cervus Fabricius of the Mopsus Group, O. fasciatus and O. favrei of the Fasciatus Group, Onthophagus bifasciatus Fabricius and O.centricornis Fabricius of the Mopsus Group, Onthophagus fuscopunctatus Fabricius and Onthophagus parvulus Fabricius of the Variegates Group.

Fig. 1
figure 1

Neighbour Joining tree of Onthophagus Latreile 1802 from Western Ghats biodiversity hotspot of India based on cox1 barcode sequences

Full size image

Discussion

In the present study, we provided the DNA barcode of 27 species of Onthophagus and one species of Onitis dung beetles of the southern Western Ghats and inquired whether their phylogeny matched with the proposed morphological Species Groups. The Western Ghats, despite a mega-biodiversity hotspot of the world (Myers et al. 2000) and represents an important biogeographical region in the world (Briggs 2003), is least explored for invertebrates. Therefore, their phylogenetic origin and distribution are obscure, a reason why the fauna of India is not represented in global phylogenetic and biogeographic investigations (Monaghan et al. 2007; Breeschoten et al. 2016). Our sequences matched up to 89% with that of the dung beetle species from Oriental and African biogeographical regions upon BLAST search. However, due to the lack of reference sequences of any dung beetle species in the database, our sequences represent the first DNA barcodes of dung beetles. Among the 27 species used in the present study, Onthophagus andrewesi, Onthophagus bronzeus, Onthophagus castetsi, Onthophagus madoqua and Onthophagus usurpator are endemic to the Western Ghats (Sabu et al. 2011; Sathiandran et al. 2015).

The morphological Species Grouping in Onthophagini has been subjected to revisions. Roggero et al. (2016) revised the Afro-tropical Species Group proposed by d’Orbigny (1913). The Species Group variegates is currently treated as a subgenus Furconthophagus (see Zunino 1979) of Onthophagus. Onthophagus orientalis is probably a member of subgenus Sinonthophagus Kabakov (see Genier and Moretto 2017). Onthophagus rectecornutus is currently treated a member of the subgenus Serrophorus, while Onthophagus catta belongs to Digitonthophagus. Onthophagus rudis is currently a member of the genus Parascatonomous, the genus was recently revised by Ochi et al. (2017). Breeschoten et al. (2016) also points out that the taxonomic placement of Onthophagini and the genus Onthophagus may be wrong based on their evolutionary history. Our molecular analyses support the revised classification of different Species Groups elsewhere. Although an investigation has been made on members of different tribes of Scarabaeinae (Asha and Sinu Unpublished), we do not discuss the phylogeny of inter-tribes here. The scope of the present study is therefore to generate the DNA barcodes of species present in the Western Ghats, which, we hope, can serve as a useful reference for dung beetle identification and to understand the biogeographical origin and radiation of species.

The phylogenetic tree (Fig. 1) strongly supports the species level traditional taxonomy of dung beetles as all the 27 species of Onthophagus were branched separately on the tree. However, it did not fully support the traditional Species Grouping of Onthophagus spp. (Arrow1931; Table 1) that the other studies also have concurred elsewhere (see Kabakov 2006; Genier and Moretto 2017; Ochi et al. 2017; Ziani et al. 2019). Taking into consideration the matter that the species included in this study is only representatives of the Species Groups, it is difficult to make a conclusive statement about their in-depth phylogeny.

Concluding remarks

Among insects, dung beetles are the most illustrated surrogate species and indicators of different global changes, such as land-use change, fragmentation, deforestation, urbanization, and climate change. Therefore, correct species identification, availability of DNA barcode, and knowledge on their phylogenetic position are important for biodiversity and phylogeographic studies, particularly which use metabarcoding for biodiversity investigations. The present study dealt with a small representative sample from the Western Ghats biodiversity hotspot and generated the DNA barcodes of 27 species of Onthophagus and one species of Onitis. Our study might set a platform for a pan-India phylogeny and phylogeography of dung beetles. The sequences generated from the Indian dung beetle species might be useful for reconstructing the phylogeny and phylogeography of global dung beetles.