Introduction

Biological control has emerged as an ecologically sustainable alternative to control pest and diseases of economically important agricultural crops. The majority of plant protectionists throughout world believe that biocontrol agents (BCAs) may be safe alternative to harmful chemical pesticides (Meyer et al. 2004; Singh and Mathur 2010a, b; Xu et al. 2011; Singh et al. 2013; Izquierdo-Garcia et al. 2020). Now a days BCAs are an integral part of integrated pest management (IPM) strategies owing to its environmental as well as economically feasible to the farmers. So majority of experts are in agreement with that indigenous strains are better adapted to local conditions and performed better than exotic strains (Singh et al. 2013; Izquierdo-Garcia et al. 2020). Many of the recent studies have focused on using combinations of BCAs to increase the efficacy against plant pathogens (Meyer et al. 2004; Singh and Mathur 2010a; Singh 2019). These combinations are known as consortia which is a microbial association of two or more microorganisms (Izquierdo-Garcia et al. 2020).

In India, root-knot nematodes, Meloidogyne species are the number one enemies for crops grown under green houses and causes severe yield losses (Jain et al. 2007) under fields and protected cultivation system. M. incognita (Mi) is important pest of vegetables, predispose the roots to other pathogens and caused disease-complexes particularly with wilt causing fungi, Fusarium oxysporum (Fo) and root-rot fungus, Rhizoctonia solani (Rs) with synergistic effect on the common host (Singh and Goswami 2001; Sharma et al. 2007). Since all these pests survive in the same niche and involved to cause heavy damage and losses to crops, it is felt desirable to identify BCAs, equally effective against common soil borne pathogens (nematode and fungi). In the present investigation, an attempt was made to isolate, identify and selection of local BCA strains of Trichoderma harzianum (Th), Bacillus subtilis (Bs) and Pseudomonas fluorescence (Pf) to test their efficacy by employing different methods against Mi, Fo and Rs and, compatibility among them. The pathogens and BCAs were extracted and isolated from rhizosphere and plants (bell pepper, cucumber and tomato) growing fields under protected cultivation. The present study helps to develop a potential microbial consortium for further management of soil borne pathogens under protected cultivation.

Materials and methods

Isolation and identification of root-knot nematode, M. incognita

Root knot nematode, M. incognita initially detected on bell pepper, cucumber and tomato crops under protected cultivation system was cultured and maintained. The pure culture of nematode was maintained through single egg mass inoculation on brinjal and tomato plants grown in pots containing sterilized soil at ICAR-NCIPM-Rajpur Khurd Campus, New Delhi-110068. For collection of egg masses infected roots were washed in running tap water to remove adhering soil particles and then egg masses were handpicked from galls using forceps. The egg masses were then surface sterilized with 0.5% sodium hypochlorite for 2 min, followed by three washings with sterile water in 10 ml glass tubes followed by incubation at 25 ± 2 °C in a BOD incubator. After 7 days, the content of each tube was poured onto tissue paper in Baermann funnels (Van Bezooijen 2006). After 48 h, the J2 thus had hatched were collected, counted and the number of J2 were estimated for bio-assay test. M. incognita was identified by the perineal patterns of the mature female and morphological characters of male (Hartman and Sasser 1985).

All bio-assay tests were performed at ICAR-NCIPM (Pusa Campus), New Delhi-110012 and ICAR-NCIPM-Rajpur Khurd Campus, New Delhi-110068. Adequate checks were kept and repeated in due course of time wherever, it was necessary.

Isolation and identification of F. oxysporum and R. solani

Both pathogens (Fo and Rs) were aseptically isolated from the sick soil and plant roots of bell pepper, cucumber and tomato crops grown under protected cultivation fields. Isolation of fungi from soil was made through serial dilution plating technique, which was made up to 10–7, 0.2 ml suspension of various dilutions were transferred and spread it uniformly on sterilized Petri plates containing potato dextrose agar media (PDA). Infected plant roots were washed under tap water, cut into small pieces (1 cm) and surface sterilized with 0.5% NaOCl for 1 min followed by three washings with sterilized water. Root bit were then inoculated on PDA and incubated at 25 ± 2 °C for 7 days., Thus, fungal colonies appeared, were purified by repeatedly sub-culture techniques and identified on the basis of their cultural characteristics and the morphology of their vegetative and reproductive structures produced on different culture media according to different keys of identifications given by Nelson et al. (1983) and Agrios (2004) for F. oxysporum and Yamamoto and Uchida (1982) and Agrios (2004) for R. solani. Observations on microbial growth were taken periodically after 24 h onwards, thus, fungal colonies appeared, were isolated and purified by repeatedly sub-culture techniques and maintained at 4 °C in refrigerator.

Isolation and identification of T. harzianum

Trichoderma species were isolated from soil by serial dilution plating technique as described above, using Trichoderma selective medium (TSM). The isolates were then purified on TSM agar plates using repeated sub-culture technique. It was identified based on the cultural characteristics as well as microscopically by visualizing the arrangement of conidiophore and conidia (Agrios 2004). Initially biocontrol potential of five isolates of Th (1–5) were tested in-vitro against root-knot nematode, M. incognita. On the basis of high antagonistic activity against M. incognita, one isolate Th-3 was further characterized and identified through biochemical tests for biocontrol properties i.e. siderophore production, chitinase activity and 16S rRNA PCR amplification, sequence analysis (Castle et al. 1998). A salinity tolerance test was also performed for this strain.

Siderophore production

Siderophore producing activity of BCAs was tested on PDA medium (Th) and NA medium (Bs and Pf), which was amended with chorme Azurol S blue dye (Kumar et al. 2018). Freshly prepared culture of BCAs were inoculated in the center of Petri plates containing respective media. All the Petri plates were incubated at 28 ± 2 °C in BOD incubator at 28 ± 2 °C. Observations were recorded after 24 h onwards.

Chitinase activity

For determination of chitinase activity of Th, minimal salt medium (Di-Sodium Hydrogen Phosphate—6.0 g, Potassium Di Hygrogen Phosphate—3.0 g, Ammonium Chloride—1.0 g, Sodium Chloride—5.0 g, Yeast extract—0.25 g, Agar—15.0 g, pH 7.0 ± 0.5, Colloidal chitin—1%) amended with 1% colloidal chitin was poured in the Petri plates and 5 mm disc of actively growing culture of Th was inoculated followed by incubation in a BOD incubator at at 28 ± 2 °C for 72 h (Kumar et al. 2018).

Salinity tolerance

Salinity tolerance of Th was also tested on PDA media, amended with 0.25 M NaCl, 0.5 M NaCl and 0.75 M NaCl (Poosapati et al. 2014). Similarly, un-amended media containing Petri plates were used as check. All the Petri plates inoculated with freshly prepared culture and incubated in a BOD incubator at 28 ± 2 °C for 72 h. Observations on the radial growth Th was recorded. All the biochemical tests were replicated three times.

Isolation and identification of B. subtilis and P. fluorescens

Both bacteria (Bs and Pf) were also isolated by serial dilution plating technique using Pseudomonas Fluroscein Agar media (PFA) or Nutrient agar (NA) as described in 2.1.2. The colonies appeared in Petri plates with yellow-green and blue white pigments were detected and marked individually after observed under UV light with the help of an ultra violet (UV) Trans illuminator. Colonies were thus formed picked up with sterilized loop and transferred on to fresh King’s B medium. The pure culture was obtained through repeated sub-culture technique and maintained at 4 °C in refrigerator and identified on the basis of gram reaction and biochemical tests.

Gram reaction

Gram staining of both tested rhizobacteria was done using Gram Stains-Kit, (Hi-media), India. Slides of both bacteria were visualized under 100X in Nikon eclipse 80i, microscope for confirmation of Gram reaction (Bartholomew and Mittwer 1952).

Phosphate solubilisation test

Bacterial colonies were inoculated on Pikovakaya’s agar media (Yeast extract—0.5 g, Dextrose—10.0 g, Calcium Phosphate—5.0 g, Ammonium Sulphate—0.5 g, Potassium Chloride—0.2 g, Magnesium Sulphate—0.1 g, Manganese Sulphate—0.0001 g, Ferrous Sulphate—0.0001 g, Agar—15 g, pH—7.5 ± 0.2), and zone formation was observed around bacterial colonies (Kumar et al. 2018).

Hydrogen cyanide (HCN) production

HCN production by bacterial isolates was tested on NA medium (Lorck 1948). Test bacterium was aseptically streaked on nutrient agar (NA) medium and a filter paper soaked in a mixture of 0.5% W/V picric acid and 2% W/V sodium carbonate was placed on the lid of the Petri plate. The plates were inoculated for 48 to 96 h at 28 ± 2 °C. Change of color of the filter paper was closely monitored and recorded.

Indole acetic acid (IAA) production

Nutrient Broth (NB) medium was amended with 0.1% typtophan in test tubes followed by inoculation of bacterial culture. All the test tubes were incubated in BOD incubator at 28 ± 2 °C for 48 h followed by pouring of freshly prepared Salkowski reagent (Kumar et al. 2018). Observations on change of color etc. was observed and recorded.

Fluorescein pigment production

Fluorescein production by bacterial isolates was tested by inoculating bacterial colonies on pseudomonas fluorescein agar (PFA). Presence of pigments by the bacterial colonies on the media was confirmed under UV light and recorded.

Molecular characterization of T. harzianum, B. subtilis and P. fluorescens

All tested biocontrol agents (Th, Bs and Pf) were further identified by the amplifying ITS1-4 region and 16 s rDNA respectively. Genomic DNA of Th, Bs and Pf was isolated as per isolation protocol of Nucleopore gDNA (fungal bacterial mini kit, Genetix, India). For amplification of Th DNA, universal primers ITS-1 with primer sequence 5′ TCCGTAGGTGAACCTGCGG3′ used as forward primer and ITS-4 with primer sequence 5′TCCTCCGCTTATTGATATGC3′ used as reverse primer at 52 °C annealing temperature, (White et al. 1990) whereas for Bs and Pf isolates 16SrDNA primers 5′ AGAGTTTGATCCTGGCTAG3′ (27f) and 5′GGTTACCTTGTTACGACTT3′ (1392R) at 55 °C annealing temperature were used (Chen et al. 2015). Final PCR reaction was carried out in 60 μl reaction mixture containing 30 μl of 2X PCR Master Mix (Genetix Biotech Asia Pvt. Ltd), 3 μl of forward primer (0.6 picomolar per μl), 3 μl of reverse primer (0.6 picomolar per μl), and 18 μl of nuclease free sterile PCR water (Thermo Scientific, USA) and 6 μl (25 ng per μl) of DNA sample. Amplification was performed in thermal cycler (Thermo Scientific, USA). Initial denaturation run at 94 °C for 5 min before cycling start, PCR cycling conditions consisted with 35 cycles, of which denaturation run at 94 °C for 30 s, annealing at optimum temperature for 30 s, extension at 72 °C for 30 s and final extension at 72 °C for 5 min after 35 cycles. The PCR amplicon was checked on 1.5% agarose gel, at 90 V for 1.5 h and was outsourced for sequencing following Dideoxy sanger method (Agrigenome, India). The sequence obtained were assembled using Contig Assembly Program (CAP) in Bioedit analysis software (Hall et al. 1999) and were checked for similarity using Mega Blast tool of National Centre for Biotechnology Information (NCBI) and phylogenetic tree was obtained using (Neighbor joining) NJ method.

Antagonistic activity of T. harzianum against M. incognita eggs (egg parasitization test)

Trichoderma harzianum was aseptically inoculated to the center of a Petri dish containing PDA medium amended with antibiotic streptomycin at 1 mg/l, followed by incubation for 10 days at 25 ± 2 °C in a BOD incubator. To study the egg parasitic properties of Th, handpicked egg masses were placed in 0.5% sodium hypochlorite solution for 2 min, with frequent stirring followed by settling for 30 s. The eggs released through dissolution of gelatinous matrix were further surface disinfested in 0.5% sodium hypochlorite then three washings with sterile water. Each Petri plate was then uniformly spread with 100 eggs of M. incognita. Four replicates were maintained for each fungus and egg free plates served as control. After seven days, eggs were stained with cotton blue and per cent egg parasitism was assessed by counting the parasitized and non-parasitized eggs under microscope. The eggs, either infected by direct hyphal penetration or disintegration of their contents, were counted as infected (Meyer et al. 2004), while eggs that contained live juveniles and eggs from which juveniles had hatched were counted as viable. Adequate checks were also maintained.

Antagonistic activity of T. harzianum, B. subtilis and P. fluorescens culture filtrates on M. incognita egg hatching (egg hatching test)

All biocontrol agents (Th, Bs and Pf) were cultured in autoclaved 250-ml flasks containing 150 ml appropriate broth medium (PDB for T. harzianum and NB for B. subtilis and P. fluroscens). Culture filtrates (CF) were obtained by filtering the culture broth after 7 days of incubation at 25 ± 2 °C in a BOD incubator. 800 eggs of Mi were placed into sterile small Petri plates containing 5 ml Th, Bs and PF culture filtrates. The plates were kept at room temperature (25 °C) for 96 h. After different time interval i.e. 24, 48, 72 and 96 h, the numbers of second-stage juveniles (J2) hatched were counted using a stereo microscope and the percentage of hatched eggs was determined. Simultaneously, two controls were maintained for comparison; one in pure distilled water and another in the non-inoculated sterilized broth medium. Four replicates were carried out for each treatment.

Antagonistic activity of T. harzianum, B. subtilis and P. fluorescens culture and culture filtrates against M. incognita mortality (mortality test)

The test was conducted in sterilized Petri plates filled with 5 ml of each culture filtrate and 1 ml of nematode suspension containing 800 nematode. The effect of fungal culture filtrates on the nematode activity was determined after different time intervals (24, 48, 72 and 96 h). Toxicity was estimated according to the number/percentage of paralyzed nematodes. Nematodes that were rigid and elongated with head and tail sometimes slightly bent were considered as immobilized and if they did not react when probed with a fine needle were considered as paralyzed (Cayrol et al. 1989). Percentage of dead nematodes was determined after revival test for which nematodes were washed three times with sterile water using centrifugation for 3 min at 1000 rpm, and incubated in distilled water for 24 h. After 24 h, nematodes still inactive were considered as dead. There were four replicates for each treatment.

Antagonistic activity of T. harzianum, B. subtilis and P. fluorescens culture against R. solani and F. oxysporum

The antagonistic activity of Th against Fo and Rs was tested on PDA medium by dual culture method. For which, five mm diameter disc from 7 days old culture of Fo and Rs was placed on one end of the Petri dish with the help of sterilized inoculation needle and 5 mm diameter disc from antagonist Th culture was inoculated at opposite side. Similarly, for bacterial (Bs and Pf) antagonists, 5 mm diameter disc from 7 days old culture of Fo and Rs was placed on one end of the Petri dish with the help of sterilized inoculation needle and bacterial antagonists were streaked on the opposite side. Petri plates without antagonist served as control and replicated thrice. Observations on growth were recorded up to 7 days Per cent growth inhibition (PGI) of antagonist was calculated according to Vincent (1927) using the formula given below.

$${\text{Percent growth inhibition}} = \left( {\left. {\frac{Growth \;in \;control - Growth\; in\; treatment}{{Growth\; in\; control}}} \right)} \right. \times 100$$

Compatibility test among fungal (T. rzianum) and bacterial (B. subtilis and P. fluorescens) bio-agents

Under in-vitro compatibility test between Th, Bs and Pf was carried out on PDA plates. An overnight culture of Bs and Pf were streaked on two sides of a Petri dish containing PDA media, while center of the plate was inoculated with 2 mm disc of Th (5-day old culture). The plates were then incubated at 25 ± 2 °C in a BOD incubator and zone of inhibition (if any) was measured. The test was repeated thrice. Each biocontrol agent was inoculated separately in a Petri plates served as control for ascertaining viability of the culture.

Compatibility test among B. subtilis and P. fluorescens

Compatibility test between Bs and Pf were tested following the method of Fukui et al. (1994). The compatibility was performed by inoculating of Bs and Pf strains using NA medium. The bacterial strains were streaked horizontally and vertically to each other. The plates were incubated at room temperature of 25 ± 2 °C for 72 h and observations on inhibition zone were recorded. Absence of inhibition zone indicated the compatibility with respective bacterial strains and the presence of inhibition zone indicated the incompatibility.

Statistical analysis

The pooled data (mean of two trials) for two consecutive experiments on egg parasitism, egg hatching, nematode activity, mortality and pathogenic fungi inhibition were analyzed and subjected to ANOVA using SPSS ver.16. A test for homogeneity of variances was conducted prior to pooling the data. Similarly, average mean with standard error of mean of three replication was calculated. Dun-can’s multiple range test (DMRT) was used to determine significant difference (P < 0.05) between test antagonists.

Results

Identification and selection of fungal (T. harzianum) and bacterial (B. subtilis and P. fluorescens) bio-agents

Initially five Trichoderma isolates (Fig. 1) were identified based on culture characteristics, color of colony which ranged from white to green with concentric rings. All the isolates were tested against Mi for their nematicidal activity (Table 2). Among all five isolates of Trichoderma, isolate Th-3 exhibited high nematicidal (egg parasitic and toxin producing) activity. Based on their antagonistic activity against Mi, Th-3 (called Th throughout the text) was selected for further in vitro studies against soil borne fungi. Its biocontrol potential in terms of siderophore and chitinase (yellow to halo zones around colonies) and spore production was recorded and confirmed. Beside this, the isolate showed salinity tolerance up to 0.5 M NaCl in amended media (Table 1). The genomic DNA of all five Trichoderma isolates was amplified with the help of ITS 1–4 primer pair and an amplicon of 500 bp to 600 bp was observed on 1.5% agarose gel (Fig. 2a).

Fig. 1
figure 1

a–e Five isolates of Trichoderma harzianum (Th)—a Th-1, b Th-2, c Th-3, d Th-4, e Th-5 and f conidiophore and conidia of Th-3

Full size image
Table 1 Biochemical characteristics of Trichoderma harzianum, Bacillus subtilis and Pseudomonas fluorescens
Full size table
Fig. 2
figure 2

a ITS 1–4 amplification of Trichoderma isolates (lane 1–5), lane NC—negative control, lane M—1 Kb ladder, Generuler, Thermofisher. b Neighbour joining tree of pair wise alignment of Trichoderma harzianum (Th-3)

Full size image

Sequencing of amplicon of Th isolate which was followed by BLAST analysis sequences, the strain was identified as T. harzianum (Accession No. MT734519) with homology of 99.6%. (Fig. 2b). Bacterial antagonists, initially isolated from soil collected from capsicum, cucumber and tomato crops under protected cultivation. Pseudomonas showed positive reaction to biochemical tests i.e. for IAA production, phosphatase reaction, siderophore production and fluorescein production (Fig. 3a, b; Table 1) while negative reaction with gram staining, HCN production and spore production.

Fig. 3
figure 3

a Negative gram reaction shown by Pseudomonas fluorescens. b Positive gram reaction shown by Bacillus subtilis. c Siderophore production and d fluorescence production by Pseudomonas fluorescens

Full size image

All the biochemical tests confirmed the presence of Pseudomonas spp. and due to production of fluorescein pigment in the PFA medium it was confirmed as P. fluorescens. Similarly, gram positive rod shape Bacillus spp. gave positive reaction to Gram staining, phosphatase test and spore production (Table 1) which indicates that it’s belong to Bacillus genus. The genomic DNA of bacteria was amplified with the 27f and 1392 primers targeting 16 s rDNA of the bacteria (Fig. 4). Sequencing of amplicon of Bacillus isolate followed by BLAST analysis sequences. The strain was identified as gram positive B. subtilis (Accession No. MW008011) with homology of 100% and gram negative P. fluorescens (NCIPM/PCPF/01).

Fig. 4
figure 4

a 16S rDNA amplification of bacterial isolates Lane B1belongs to Bacillus subtilis and B2 belongs to Pseudomanas fluorescens. Lane M—1 Kb ladder, Generuler, Thermofisher and b neighbour joining tree of para wise allignment of Bacullus subtilis

Full size image

Effect of fungal (T. harzianum) and bacterial (B. subtilis and P. fluorescens) culture and their culture filtrates on eggs and second stage juveniles (J2) of M. incognita

Under in-vitro assays, all tested BCAs showed significant (P > 0.05) bio-control activities against the Mi as compared to their respective controls (Tables 2 and 3). Data presented in Table 2 showed that all tested isolates of Th (1–5) infect eggs of Mi and caused infection in the range of (47–89%). Th-3 caused significantly (P > 0.05) higher egg parasitisation (89%) as compared to other tested Trichoderma isolates and control. It is followed by Th-5 and Th-4 causing 64 and 60% egg parasitisation respectively. Maximum percent egg inhibition was recorded in Th-3 which caused significantly (P > 0.05) lower egg hatching (25%). It is noted that all other isolates did not differ statistically (P ≤ 0.05) with each other, however, differ statistically compared to controls. All treatments and dilutions substantially immobilized Mi juveniles after 24 h of exposure to 96 h. Standard extracts (SE) were more effective and statistically (P > 0.05) differ compared to lower dilutions. The mobility of Mi juveniles was decreased and mortality was increased consequently with increase in exposure time (Tables 2 and 3).The Th-3 isolate showed significantly higher (P > 0.05) antagonistic activities and killed 100% nematode J2 after 96 h even after revival test for 24 h compared to control and other isolates which did not shows any significant (P < 0.05) difference among them. The media used to culture Th did not have any negative impact on the mobility, mortality and inhibition of eggs of Mi as broth and water (controls) did not differ statistically (Table 2).

Table 2 Effect of culture and culture filtrates of Trichoderma harzianum on egg infection, egg hatching, mobility and mortality of root-knot nematode, Meloidogyne incognita at different time intervals under in vitro condition
Full size table
Table 3 Effect of culture filtrates (bacteria cell free) of Bacillus subtilis and Pseudomonas fluorescens on egg hatching, mobility and mortality of root-knot nematode, Meloidogyne incognita at different time intervals under in vitro condition
Full size table

Bacteria cell free CF of both Bs and Pf showed significant (P > 0.05) inhibition of egg hatching of M incognita eggs at various degree which increased consequently with increase in time of exposure and decrease with lower dilutions of culture filtrate (Table 3). SE of both bacteria inhibited up to 65% of egg hatching followed by next dilution (1:10) which caused inhibition up to 50%. It gradually decrease with lower dilutions (1:75) and recorded only 11 and 14% respectively with Bs and Pf. Both tested bacteria caused significantly (P > 0.05) high immobility up to 99 and 96% respectively after 96 h and killed 100% Mi juveniles even after 24 h when exposed to water for revival test (Table 3).

Effect of fungal (T. harzianum) and bacterial (B. subtilis and P. fluorescens) culture against R. solani and F. oxysporum

Data presented in Table 4 showed that all tested BCAs caused growth inhibition under in-vitro trials at various degree and differ statistically to each other. Th caused highest growth inhibition compared to bacterial isolates which was recorded up to 99 and 66% against Rs and Fo respectively. The PGI caused by Pf was recorded 83 and 40% against Rs and Fo respectively, whereas Bs caused growth inhibition up to 48 and 41% respectively, under in-vitro bioassay test (Table 4).

Table 4 Percent growth inhibition of fungal pathogens, Fusarium oxysporum and Rhizoctonia solani caused by Trichoderma harzianum, Bacillus subtilis and Pseudomonas fluorescens under in vitro condition
Full size table

Compatibility test between fungal (T. harzianum) and bacterial (B. subtilis and P. fluorescens) isolates under in vitro

Compatibility test among Th, Bs and Pf isolates was carried out to ascertain the survival of all three in permutation and combination (Table 5), if they introduced in the same niche. It is notable that when Th, Bs and Pf were inoculated together, they did not form inhibition zone, which showed that they are compatible to each other (Fig. 5a–c). Compatibility of Pf and Bs was studied on NA (Fig. 5b). It is notable here that they did not form inhibition zone upon co-inoculation. It is also noted that the bacterial colonies merge after 5 days of inoculation. In contrast, all the three biocontrol agents show highly incompatible interaction with fungal pathogens (Rs and Fo). Pf and Bs showed zone of inhibition with Fo and Rs while in case of Th overgrowth was observed over the fungal pathogens such that growth of pathogens was restricted (Fig. 6).

Table 5 Interaction between biocontrol agents (Trichoderma harzianum, Bacillus subtilis and Pseudomonas fluorescens) and fungal pathogens (Fusarium oxysporum and Rhizoctonia solani) under in vitro condition
Full size table
Fig. 5
figure 5

a Compatability between Trichoderma harzianum, Bacillus subtilis and Pseudomonas fluorescens, b interaction between antagonists under UV light and c, d revival of B. subtilis (right side) from the overgrown Trichoderma harzianum

Full size image
Fig. 6
figure 6

a–h Confrontation assay with bio-agents, Trichoderma harzianum (Th3), Pseudomonas fluorescens (psf) Bacillus subtilis (BS) with Fusarium oxysporum (FO) and Rhizoctonia solani (RS). a Th3 with RS, b Psf with RS, c RS control d BS with RS e Th3 with FO, f Psf with FO, g FO control, h Psf with FO

Full size image

Discussion

The success of BCAs depends mostly on rhizospheric competence i.e. the ability to colonize and survival in the rhizosphere (Singh and Mathur 2010a; Singh et al. 2013; Singh 2019) whether it is competitiveness or availability of host. However, In-vitro screening of microorganisms is an important method to evaluate their bio-control potential before release in the rhizosphere (Singh and Mathur 2010a, b). During present investigation all our fungal and bacterial isolates showed nematicidal as well as fungicidal effects of varying degrees on M. incognita, F. oxysporum and R. solani. BCAs have long been known to be soil borne and common in agricultural field soils, where pathogens exists and are culturable. Among three tested BCAs T. harzianum was most effective against tested soil borne pathogens, it showed dual mode of action (egg pararsitization as well as toxin producing) against M. incognita. Also it clearly hampered the growth of F. oxysporum and R. solani in terms of percent growth inhibition under in-vitro trials. It has been described earlier that how BCAs can contribute to plant health and antagonize pathogens (Nagesh et al. 2005; Sahebani and Hadaavi 2008; Singh 2013; Izquierdo-Garcia et al. 2020) when applied alone and/or in combinations.

In the present study, we found that the interaction between T. harzianum, B. subtilis and P. fluorescens was not negative and further they did not affect growth and proliferation of each other, so this direct interaction would not affect the establishment of BCAs in soil when applied at the field. Moreover, their direct activity in the suppression of M. incognita, F. oxysporum and R. solani suggesting that inclusion of T. harzianum, B. subtilis and P. fluorescens in the consortia not only check individual pathogen but may reduce complex disease incidences involving nematode and fungus, as in most of the cases nematode acts as predisposing factor to other microorganisms (Singh et al. 2007; Nagesh et al. 2005). It is well established that the success of a microbial consortium depends on the individual ability of BCAs and their mutual interaction among them. Mixture of fungus-fungus, fungus-bacteria and bacteria-bacteria have been evaluated in most of the studies (Singh and Mathur 2010a, b; Singh et al. 2013; Sharma et al. 2015; Izquierdo-Garcia et al. 2020).

The natural utilities of tested BCAs besides biocontrol, such as biodegradation, mineralization, plant growth promotion etc. establish the equilibrium in soil for sustainable agriculture by increasing the productivity (Kostov et al. 2009). These characteristics make them perfect contenders to be employed as a consortium in an agroecosystem to control root-knot nematode and/or wilt and root rot diseases as well as complex diseases involving theses pathogens. However, the information on testing these BCAs against group of pathogens are scanty in literature. In this study it was found that neither of the two BCAs negatively affected nor inhibited their growth when tested their compatibility under in-vitro bioassays.

In addition, as evident from the results both tested isolates of bacteria exhibits strong nematicidal activity against M. incognita. Both are ubiquitous bacteria in agricultural soils and possesses many traits that make them well suited as biocontrol and growth promoting agents (Weller 2007). In addition, B. subtilis has the ability to produce endospores and various biologically active compounds make it potentially powerful biocontrol agent (Nagorska et al. 2007). We found that both are able to reduce egg hatching significantly and killed 100% M. incognita juveniles at the end of trials when subjected to standard extract of bacterial cell free culture filtrate. The results were in the concord with that of Nagesh et al. (2005), who recorded reduction in egg hatching up to 90% and caused 100% mortality against M. incognita when exposed to bacterial culture filtrates. The nematicidal volatile products (benzeneacetaldehyde, 2-nonanone, decanal, 2-undecanone and dimethyl disulphide) produced by B. subtilis and large number of toxic secondary metabolites (phenazines, indoles, compounds, phenylpyrroles and pterines) produced by P. fluorescens are responsible for high egg hatching inhibition, reduced mobility and mortality of M. incognita juveniles (Lindberg 1981).

Once the nematicidal as well as fungicidal activity of BCAs, used in the study was established under in-vitro tests, compatibility of these microbes was studied under in-vitro condition and it was recorded that T. harzianum, B. subtilis and P. fluorescens isolates are compatible to each other. In contrast, the interaction of BCAs with tested pathogenic fungi was recorded negative or antagonistic. Our results suggests that tested BCAs may be applied together as consortia for field application to control diseases/complex diseases caused by soil borne pathogens.

Conclusion

Trichodermaharzianum, B. subtilis and P. fluorescens are three native soil inhabitant microbes, their biocontrol potential and compatibility has been demonstrated during present investigation, emphasized the effects of these as effective alternative for management of M. incognita, F. oxysporum and R. solani present in the same rhizosphere and infecting common host crops plants. Additional studies are required to know molecular interaction of the T. harzianum, B. subtilis and P. fluorescens for a better understanding of their compatibility in the rhizosphere.