Introduction

According to the global cancer burden based on the GLOBOCAN 2020, it was estimated that 19.3 million new cancer cases and almost 10.0 million cancer deaths will happen in 2020. Breast cancer is the most frequently diagnosed cancer, with almost 2.3 million new cases reported to be distinguished in 2020 [1]. Many drugs in chemotherapy suffer from different side effects such as enhancing multi-drug resistance (MDR), poor solubility, and undesirable damage to normal cells, which indicate results of commonly therapeutic intervention strategies [2].

Recently, the development of metal nanoparticles is gaining consideration due to their cancer diagnosis, tumor imaging, and drug delivery [3].

Recently, AgNPs have unique electrical, optical, and thermal characteristics and been reported to display wound healing, antibacterial activities, [4] antimicrobial, [5] antioxidant, [6] and anticancer properties [7]. The fabrication of nanoparticles is mediated through a variety of chemical, physical, and biological strategies [8]. There is an increased interest in the synthesis of nanoparticles using the green fabrication method used by plants owning to their various advantages such as simple, cost effective, environmentally eco-friendly, and not requiring hazardous chemicals [9]. On the other hand, Onopordum acanthium L. is a flowering plant belonging to the family Asteraceae, with rich phytochemical compounds. Onopordum acanthium L. displayed significant medical activities such as antiradical, antibacterial, antihypertensive, cardiotonic agent, antitumor, and anti-inflammatory activities [10].

In this context, we have explored the apoptotic activity of AgNPs using Onopordum acanthium L. (AgNPs-OAL) extract as a reducing agent. The FESEM was utilized to identify the morphological feature of the nanoparticles. The crystalline nature of nanoparticles was explored using XRD. The in vitro cytotoxicity was performed in MDA-MB231 (human breast cancer), and HEK293 (human embryonic kidney) cell lines upon treatment with prepared AgNPs-OAL. Moreover, cell cycle analysis, morphological properties of apoptotic/necrotic cells, ROS generation, apoptotic Bax and CAD gene expressions, and induction of apoptosis/necrosis were also evaluated by Annexin V/PI staining to explore the significant impacts of the AgNPs-OAL as anticancer agents.

Materials and methods

Fabrication and determination of green AgNPs-OAL

For preparation of plant extract, the powder form (50 g) of dried plant Onopordum acanthium L. was added to 200 cc of solvent ethanol (50%) and centrifuged for 20 min at 14,000 rpm. The resulting extract was filtered through a filter paper and then stored in the refrigerator before. The extract of Onopordum acanthium L. about 5 mL was added dropwise in 100 mL 1 mM silver nitrate (AgNO3, 99%) solution with constant stirring at room temperature. To collect the suspension, Onopordum acanthium L. extract-derived AgNPs (AgNPs-OAL) were centrifuged at 13,000 rpm for 20 min. The determination studies were confirmed by X-ray diffraction XRD and FESEM analyzes. The crystalline nature of AgNPs-OAL was characterized by XRD (Burker AXS D8 X-Ray diffractometer) instrument using Cu Kα radiation in 2θ range of 5°-80°. The particle morphology of prepared AgNPs-OAL was imaged and analyzed through FESEM (Philips XL30) instrument.

Cell culture

MDA-MB231 (human breast cancer) (C578), HEK293 (C630) (human embryonic kidney) cell lines were procured from NCBI (National Cell Bank of Iran), Pasteur Institute of Iran. The cells were sustained in RPMI1640 media pH= 7.2 with 10% Fetal bovine serum FBS (Gibco, U.S). The medium was added with 1% penicillin/streptomycin solution, followed by incubation at 5% CO2, 37 °C.

Viability assay

The percentage of cell viability has been evaluated toward MDA-MB231 and HEK293 cell lines via the MTT method followed by treatment with AgNPs-OAL according to previous standard protocol [11]. All the cells (1 × 104 cell /well) were grown in 96-well plates and exposed to various test doses (0, 0.625, 12.5, 25, 50, and 100 µg/mL) of AgNPs-OAL. After 24 h incubation, MTT solution (5 mg/mL) was introduced into each well for 4 h. The formazan crystals formed followed by adding MTT dye. DMSO solution was added to samples to improve dissolving, followed by recording the absorbance value at 570 nm using an ELISA microplate reader. The data are presented as the mean ± SEM of three replicates from three independent experiments.

Analysis of apoptotic gene expressions

The apoptotic Bax and CAD gene expressions in AgNPs-OAL-treated cells were distinguished through SYBR Green real-time quantitative PCR at the mRNA level. The cells were firstly treated with AgNPs-OAL in IC50 concentration overnight. The RNA-isolation kit was used for the isolation of the total cellular RNA (Qiagen, Valencia, CA) based on manufacturer’s protocols. Then, complementary DNA (cDNA) was fabricated in terms of the manufacturer’s protocols using a PrimeScriptTM RT Kit (Takara, Japan). The primers utilized for RT-PCR were: forward 5′ CGGCAACTTCAACTGGGG 3′ and reverse 5′ TCCAGCCCAACAGCCG 3′ for Bax, forward 5′ TGGCAGAGATCGGAGAGCAT 3′ and reverse 5′ TCCTTCCATCCCTTCAGAGACTT 3′ for CAD. Also, the sequence of the forward primer for Glyceraldehyde 3 phosphate Dehydrogenase (GAPDH) as a housekeeping gene was 5′ CCCACTCCTCCACCTTTGAC 3′ and that of reverse primer was 5′ CATACCAGGAAATGAGCTTGACAA 3′. The ratio formula (2 −ΔΔCt) was used to assess the apoptotic gene expressions.

In vitro apoptosis/necrosis assay

The quantification of the mode of AgNPs-OAL-induced cell death in the MDA-MB231 cells were assessed using flow cytometry followed by staining with fluorescein isothiocyanate (FITC)-Annexin V and propidium iodide (PI) staining in terms of the kit’s Protocol (Roch, Switzerland). For this, the cells (3 × 105 cells/well) were subjected to 66.04 µg/mL of AgNPs-OAL, allowed to grow for 24 h. The treated cells were washed by PBS, re-suspended in binding buffer, and staining with PI and Annexin V followed by incubation in the dark. After incubated for 10 min, the percentage of the apoptotic and necrotic cells was ascertained through flow cytometer [12].

2′,7′-Dichloro dihydro fluorescein diacetate (DCFH‐DA) assay

Intracellular ROS generation was distinguished using flow cytometry [13]. The cells (MDA-MB231, 3 × 105 cell /well) were seeded in 6-well plates for 24 h followed by the addition of required concentration of AgNPs-OAL. The MDA-MB231 cells were washed with phosphate-buffered saline and then cells were exposed with DCFH-DA dye after a further treatment of 30 min. The stained cells were further investigated via flow cytometer for determination of ROS production.

Cell cycle analysis

Flow cytometric analysis was determined to investigate the changes in cell cycle evaluation in AgNPs-OAL treated MDA-MB231 cells. The MDA-MB231 cells were cultured in 6-well plates and exposed with 66.04 (µg/mL) of the AgNPs-OAL in the CO2 incubator for 24 h.

Further, the cells were harvested and washed with PBS. After fixation in ice 70% ethanol, the cells were then stained with PI, followed by treatment of RNase A (100 µg/ml). Finally, the DNA content of stained cells was measured through a flow cytometer.

Morphology of apoptotic/necrotic cells

Determination of apoptotic/necrotic cells was investigated by a dual acridine orange and ethidium bromide (AO/EB) and Hoechst nuclear staining. The MDA-MB231 cells were treated with 66.04 µg/mL of AgNPs-OAL. After washing with PBS, control and treated cells were fixed with 4% formaldehyde and stained with 10 µL of AO/EB solution for 5 min incubation.

For the Hoechst 33,258 staining, MDA-MB231 cells were subjected to six-well plating, overnight incubation with AgNPs-OAL, staining with Hoechst 33,258 solutions for 5 min in the dark, followed by washing thrice with PBS. For observation, treated and control cells were visualized for their apoptotic to the nuclei using fluorescence microscopy images.

Result and discussion

Characterization of AgNPs-OAL

In recent decades, AgNPs fabricated using biological methods has a promising impact on cancer cell lines [14, 15]. Plant mediated green strategy for AgNPs synthesis can be superior to fungal and bacterial-mediated strategies because of their accessibility, environmentally friendly procedures, and safety methods [16,17,18]. In this investigation, Onopordum acanthium L. extract was used to fabricate AgNPs. As the Onopordum acanthium L. extract was mixed with silver nitrate solution, the color variation was seen in the solution that converted into the dark brown overnight, indicating the fabrication of silver nanoparticles by phytoconstituents of Onopordum acanthium L. extract.

XRD pattern of particles confirms the crystallinity level of the AgNPs-OALʼ structure (Fig. S1). Intense peaks of silver nanoparticles from the extract of Onopordum acanthium L. were visualized at 37.93°, 43.88°, 64.13° and 77.13° in the 2θ range noted at (111), (200), (220) and (311) diffraction pattern, respectively. The reflection planes of the fabricated AgNPs-OAL were consistent with earlier investigations [12, 19]. The FESEM analysis was investigated to find out the shapes and morphology of the produced AgNPs-OAL. The AgNPs-OAL was spherically shaped with a size in the range of 1–100 nm (Fig. 1).

Fig. 1
figure 1

FESEM image of the silver nanoparticles fabricated using bioactive extract of Onopordum acanthium L

Full size image

Cytotoxicity effect of AgNPs-OAL on MDA-MB-231cells

In this study, cytotoxicity of AgNPs-OAL was examined toward MDA-MB-231 and HEK293 cells at a concentration of 6.25 to 100 µg/mL using MTT assay. In studies conducted by other groups, it was reported that that HEK293 cells as a normal (non cancerous cells). These cells were initially thought to originate from an endothelial, epithelial, or fibroblastic cell from the fetal kidney and frequently used as non- or low tumorigenic for testing oncogenic properties of cancer-associated genes [20, 21].

According to some articles and performing MTT test with different doses, selected doses such as: 0, 0.625, 12.5, 25, 50, and 100 µg/mL have been the most appropriate doses to compare the effect of AgNPs-OAL on cancer cell lines. Different types of reports are available on anti-tumor effect of green silver nanoparticles toward various cell lines such as AGS [22], MCF-7 [23], and human prostate cancer LNCaP cells [24]. Al Tamimi et al. in their study exhibited the fabrication of Silver–copper alloy nanoparticles (AgCu-NP), Cu-NP, and Ag-NP, and showed that AgCu-NP increased toxicity against MCF-7 breast cancer cells at 10 µg/mL concentration, while as AgNPs and CuNPs have no significant toxic effect [25]. The silver nanoparticles fabricated by black tea leaf inhibited the cell viability of He-La cervical cancer cell lines up to 75% [26]. Moreover, AgNP were shown to inhibit the angiogenesis, metastasis and induce apoptosis in HER2 Positive Breast cancer cells [27]. Interestingly, AgNPs-OAL showed significant dose-dependency on cell viability followed by increased concentrations. The IC50 values of AgNPs-OAL against MDA-MB231 and HEK293 cells were 66.04 and 101.04 µg/mL, respectively. The in vitro cell viability was exhibited as 85% in AgNPs-OAL at 12.5 µg/mL; however, the viability percentage was remarkably reduced to 45% at 100 µg/mL of nanoparticles (Fig. S2). Herein, we showed that MDA-MB-231 cells are more sensitive to AgNPs-OAL than normal HEK293 cells. Different doses of nanoparticles were reported in other studies.

Our results are consistent with the results of [28], where biologically synthesized AgNPs using Bacillus funiculus culture supernatant, it recorded significant cytotoxicity against MDA-MB-231 cell line in a dose dependent manner, with IC50 value of 8.7 µg/mL [28]. Also, Ghandehari et al. (2019) reported apoptotic properties of Rubia tinctorum produced AgNPs toward the MDA-MB-231 cell line (IC50=4 µg/mL/48 h). These findings imply that fabricated AgNPs-OAL depressed MDA-MB-231 cell viability [29]. According to our MTT results, AgNPs-OAL exhibited dose-dependent relationship on the viability of MDA-MB-231cells, which could be related to the synergetic activities of functional groups derived from Onopordum acanthium L. attaching to the AgNPs. Moreover, the impacts of green-fabricated AgNPs in MDA-MB-231 are consistent with earlier studies [30, 31].

Measurement of ROS production

The ROS are produced in normal cells and have roles in many physiological conditions [32]. Under excessiveness of ROS, a series of cellular events were occurring which resulted in lipid peroxidation, DNA damaging, cell cycle arrest, and promote apoptosis pathway [33]. It has been reported that new strategies for targeting ROS contribute to cancer therapy [13]. Various reports have elucidated the roles of different nanometals in triggering ROS content in different cancer cells [34, 35]. Zhu et al. reported that AgNPs could induce human hepatocellular carcinoma HepG-2 cell apoptosis via ROS-mediated MAPKs, AKT, and p53 signaling pathways [36]. Moreover, ROS production in cancers modulates the different signaling pathways by regulating apoptosis, angiogenesis, and proliferation [37].

In our study, ROS production in treated MDA-MB231 cells was 71.7%, while the control cells were 4.08%. In this study, the ROS production in MDA-MB231 cells was illustrated in Fig. 2. Maximum production of ROS was closely exhibited for AgNPs-OAL, resulting in high cytotoxicity on MDA-MB231 cells as presented in the above results.

Fig. 2
figure 2

Effect of the produced AgNPs-OAL on ROS generation in untreated (a) and treated (b) MDA_MB231 cells utilizing DCFH-DA followed by flow cytometry

Full size image

AgNPs-OAL induce apoptosis in MDA-MB231 cells

Apoptosis represents a well-defined intracellular physiological cell death that often doesn’t trigger the inflammatory response [38]. Effector caspase 3 activations are required for efficient execution of apoptotic death [39]. Translocation and cleavage of caspase-activated DNAse (CAD) were activated by caspase 3, results in DNA fragmentation.

In the current study, we evaluated the roles of pro-apoptotic Bax and CAD regulation concerning to the apoptotic death of cancer cells [33]. The mRNA expression levels of genes in AgNPs-OAL—mediated apoptotic cells were displayed by the qRT-PCR method, presented in Fig. S3. The expression of the CAD and pro-apoptotic Bax genes was enhanced by a 4.04-fold, and 1.38 fold in AgNPs-OAL treated MDA-MB231 cells, respectively.

Annexin V/PI staining determined the MDA-MB231 cells undergoing programmed cell death and necrosis (Fig. 3). We found that the AgNPs-OAL enhanced the number of early and late apoptosis on MDA-MB231 by 47.8% at 66.04 µg/mL. In the report conducted by Mohammadi-Ziveh et al., the apoptotic property of Ag-S.Khuzistanica on the colorectal HT29 cancer cell line was investigated. They indicated that 375, 750, 1500, 3000 µg/mL of Ag- S.Khuzistanica could increase the apoptosis rate (~ 30%) along with the up-regulation of apoptotic index ratio. In our study, the apoptosis rate (47.8%) was much higher after exposure to AgNPs-OAL than the Mohammadi-Ziveh results (~ 30%) [40].

Fig. 3
figure 3

Evaluation of apoptosis/necrosis in MDA-MB231 cancer cells by flow cytometric analysis. a Negative control b Annexin/PI staining of exposed cells to AgNPs-OAL at 66.04 µg/mL

Full size image

According to the main pattern of nanoparticles in apoptosis, the cell cycle results were conducted on AgNPs-OAL -exposed MDA-MB231 cells. The cellular DNA of treated MDA-MB231 cells was stained with PI, followed by testing the DNA content via flow cytometry assay. Herein, the proportion of AgNPs-OAL-exposed cells in the apoptotic cell population (sub-G1) phase was increased from 7.04 to 12.58% in MDA-MB231 cells (Fig. 4). A comparison of the Annexin V/PI staining and cell cycle results indicates that the exposure of MDA-MB231 cells with AgNPs-OAL cause inhibition of the sub-G1 phase and the up-regulation of apoptosis by increasing the early and late phase of the apoptosis pathway.

Fig. 4
figure 4

Effect of AgNPs-OAL after 24 h treatment on cell cycle arrest analysis of a untreated and b treated MDA-MB231 cells

Full size image

Moreover, we employed a further examination to determine the possible stimulation role of AgNPs-OAL in the apoptosis pathway. Given that the previous section demonstrated that the AgNPs-OAL can trigger an apoptosis pathway, the alterations in the nuclear morphology of apoptotic, necrotic cells were tested by AO/EB double staining and Hoescht 33,258 after treated with AgNPs-OAL.

The Hoescht 33,258 results show AgNPs-OAL-treated cells have enhanced apoptosis via cell structure abnormality, bright color, and condensed chromatin (Fig. 5).

Fig. 5
figure 5

Morphology properties of MDA_MB231 cells with Hoescht 33,258 staining under fluorescence microscope, a untreatment as control b the cells exposed to IC50 of synthetic AgNPs-OAL for 24 h. The arrow revealed the apoptotic cells

Full size image

At the concentration of 66.04 µg/mL, AO/EB double staining was investigated to discriminate the variations in apoptotic and normal cells. The Fig. 6 shows that treated cells display apoptosis by changing the color of the nucleus into orange, while green nuclei represent untreated cells. Nanoparticles-exposed MDA-MB231 cells demonstrated an increase in the cell shrinkage and nuclear fragmentation compared to untreated cells, exhibiting the promotion of apoptosis pathway by the fabricated AgNPs-OAL. Thus, the results exhibited that the AgNPs-OAL increased cell death, leading to the induction of apoptosis pathway.

Fig. 6
figure 6

Morphology changes of a untreated and b treated MDA_MB231 cells with fabricated AgNPs-OAL following AO/EB dye under fluorescence microscope. The arrow revealed the apoptotic cells

Full size image

Conclusions

In summary, plant-mediated AgNPs synthesis from Onopordum acanthium L. extract was generated by the green fabrication route. Determinations of the obtained nanoparticles were conducted by FESEM and XRD analysis. The in vitro cytotoxicity assay results, apoptotic genes expressions, cell cycle analysis, annexin V/PI staining, AO/EB staining, Hoescht 33,258 staining, and generation of ROS exhibited that fabricated AgNPs could act as a promising strategy in the treatment of breast cancer in the future.