Introduction

The control of herbivores has largely relied upon the use of chemical pesticides [1]. The secondary effects of these molecules include, but are not limited to, (i) insect resistance development (ii) toxicity to non-target organisms and (iii) residue in food crops [2]. Therefore, biologists are endeavoring to find alternatives to the harmful conventional pesticides [3]. Beauveria bassiana (Bals.) Vuill. (Hypocreales: Cordycipitaceae), a soil-borne cosmopolitan entomopathogenic fungus is one of the most famous biopesticides and its aerial conidia consist the basis of several commercially available mycoinsecticides [4]. Beauveria bassiana has been previously described as a generalist pathogen targeting a broad physiological and ecological range of insects and mites [5,6,7,8,9,10,11]. Generally, inundatively applied fungal cells will adhere, germinate, possibly differentiate, penetrate the integument of arthropods, and grow vegetatively as blastospores within their hemocoel [12]. A study conducted by Butt et al. [13] highlighted the genes implicated in the developmental processes of entomopathogenic fungi. The authors described in detail some genes involved in each key stage of the pathogenesis providing an insight into the entomopathogenic fungi-arthropod interaction. B. bassiana genes Cdep1, Bbchit1, and Cyp5337A1 encode proteases, chitinases, and lipases that take part in the degradation of the arthropod cuticle [14]. Moreover, a study conducted by Zhang et al. [15] demonstrated the vital role of the fungal hydrophobins, one of the most principal components of the aerial conidia cell wall. These proteins, encoded by the genes Hyd1 and Hyd2, are involved in hydrophobicity, attachment, and virulence of B. bassiana. The composition of B. bassiana cell wall also includes chitin and glucan, encoded by AY743592 and AY743593, respectively [16]. Beauvericin and bassianolide, the most famous secondary metabolites, are encoded by the genes Bbbeas and Bbbsls, respectively [17, 18]. The cyclooligomer depsipeptides are thought to be important in the pathogenesis of entomopathogenic fungi. A study conducted by Xiao et al. [19] demonstrated that BBA_08728 is responsible for encoding the sugar transporters in B. bassiana. These membrane proteins are believed to have the ability to transport glucose as well as plant cell wall-derived sugars. Furthermore, a mitogen-activated protein kinase (MAPK)-encoding gene, Bbhog1, contributes to stress management and virulence of B. bassiana [20]. However, increased interest in the potential of the endophytic growth of entomopathogenic fungi was recently noted [21]. This new role of the entomopathogenic fungi is being explored for the management of herbivores [22,23,24], plant pathogens [25], and its part in plant growth promotion [23, 26, 27]. The endophytic interaction is relative to plant as well as the fungi species and this association could be advantageous, neutral, or even disadvantageous [28]. Recent studies conducted by Jaber and Ownley [29,30,31], and Vega [24] showed the different endophytic entomopathogenic fungi (EEPF) that can reduce the herbivory of a broad range of pests and enhance the growth of various plants. Numerous studies reported antagonistic activity of B. bassiana, growing internally within the host plant tissues, against plant pests such as Aphis gossypii Glover (Hemiptera: Aphididae) [32, 33], Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) [28], Liriomyza huidobrensis Blanchard (Diptera: Agromyzidae) [34]. Moreover, a review conducted by 30,31 declared the EEPF safe to auxiliary insects. Also, multi-kingdom associations may be established simultaneously between EEPF-herbivore-plant allowing nutrient exchange between all parties. The EEPF can translocate insect-derived nitrogen to the associated crop without causing any symptoms [35], in parallel, the plant can provide carbon to its symbiotic partner [36]. Even though the colonization of EEPF is considered a promising form of natural pest control, studies analyzing the patterns and dynamics of endophytic growth are lacking. A study conducted by Wagner and Lewis [37] briefly described the endophytic growth of entomopathogenic fungi within plant tissues. The authors reported similarities in the adhesion, germination, and penetration of EPIF into the plants when compared to arthropods. However, our understanding of this colonization is still very limited,hence, the limited utilization of EEPF as biopesticides. To elucidate the relationship between EEPF-plant-herbivore, Phaseolus vulgaris L., the common bean, and Tetranychus urticae Koch, the two-spotted spider mite, are outstanding options. Phaseolus vulgaris is one of the most important crops on the economic scale [38]. Also, the endophytic growth of B. bassiana within the internal tissues of P. vulgaris has been previously demonstrated [28]. Tetranychus urticae is a major pest feeding on a broad range of crops including the common bean. The two-spotted mite begins to feed shortly after emergence from the underside of leaves by piercing the epidermal tissue of the host plant withdrawing the contents via their stylets [39]. The latest reviews showed that T. urticae can thrive on 3,800 plant species belonging to 140 families [40]. Favorable outbreak conditions for T. urticae have been created by modern farming systems, fertilizers, and overexploitation of synthetic pesticides Dagli and Tunc [41]. The control of spider mite populations is still largely relying upon chemical acaricides such as organophosphates, neonicotinoids, and inhibitors of complex II and III of mitochondrial electrons [42]. Due to its rapid resistance development, the currently available acaricides are insufficient to suppress the populations of T. urticae in many areas worldwide [42]. The objective of this study is to reveal the expression dynamics of genes involved in key developmental processes of B. bassiana. In their review of 2016, Valero-Jiménez et al. highlighted the vital role of the aforementioned genes during the parasitism of B. bassiana. The expression analysis of those genes elucidated the genetics behind the virulence of entomopathogenic fungi towards insects. However, the role played by those genes during the internal colonization of entomopathogenic fungi is still poorly understood. Here, we investigate (i) the antagonistic activity of a Beauveria sp. to all developmental stages of T. urticae when present as endophyte within the tissues of P. vulgaris and (ii) the transcription profile of genes Cdep1, Bbchit1, Cyp5337A1, Hyd1, Hyd2, Bbbeas, Bbbsls, BBA_08728, and Bbhog1 of B. bassiana when present as an endophyte within the tissues of P. vulgaris in the presence and absence of T. urticae.

Material and methods

Source of entomopathogenic fungi

Beauveria bassiana strain LTB01 (accession number: TEF-α = EU177813, RBP2 = MK908095, BLOC = MK884877, ITS = DQ984676) was used in this study. The strain was initially originated from the corpses of Cephalcia tannourinensis (Hymenoptera: Pamphiliidae) Chevin, and preserved in the laboratories of the American University of Beirut. B. bassiana strain LTB01 was grown on Potato Dextrose Agar (PDA) medium (amended with 0.5 g/L streptomycin) in dark conditions at 27 °C for 14 days. The conidia that developed were disassociated from the medium via a sterile flamed loop after adding 20 ml of sterile distilled water. To remove hyphal cells, the suspension was filtered through 8 layers of cheesecloth. The concentration of the conidia suspension was evaluated using a Neubauer-improved hemocytometer (BLAUBRAND®, Germany). Several dilutions were performed on the mother suspension to obtain the concentration of 2 × 108 conidia/ml. Tween 80 (0.1% of the volume) (Sigma-Aldrich, USA) was added to avoid the formation of a cluster of propagules. The conidial viability was assessed according to the protocol described by Goettel and Inglis [43]. In brief, a random volume of the spore suspension was inoculated on the top of the PDA petri dish that was transferred into an incubator in dark conditions at 27 °C for 48 h. The conidial germination was evaluated under an optical microscope (at ×40 magnification) where all conidia with an apparent germ tube (at least their size) were considered viable. A total of 5 PDA Petri dishes were assessed for conidial viability with an average of 500 conidia per plate. The LTB01 strain recorded viability of 94% ± 1.4 of the conidia.

Plant material

Seeds of the common bean were surface sterilized by submerging them in 96% ethanol and 1% sodium hypochlorite for 10 s and 3 min, respectively. The sterilizing process was repeated 3 times to remove any contaminant microorganisms. The entire surface of sterilized seeds was rinsed with distilled water and rubbed up against PDA Petri dishes, incubated at 27 °C, and observed for microbial contamination. The seeds that caused microbial growth were discarded while the rest were kept until further use.

Surface sterilized seeds were germinated and grown in pots containing a sterile mixture of soil and sand at a 2:1 ratio and transferred into a controlled greenhouse (20–30 °C, 80% RH, under natural light). The greenhouse was divided into 10 compartments each containing 20 plants of common bean. The compartments were sprayed alternately with (i) spore suspension of B. bassiana strain LTB01 (2 × 108 conidia/ml) + 0.1% Tween (treatment compartment) (ii) sterile water + 0.1% Tween (control compartment) making it a total of 5 technical replicates (5 compartments) within a greenhouse. The above-mentioned compartments were separated with a buffer zone, consisted of 2 non-sprayed compartments, to avoid cross-contamination. This experiment was also repeated in 3 biological replicates (3 different greenhouses in 3 different testing time points; 25 °C with a photoperiod of 16/8 h.) making it a total of 15 compartments of each treatment. The leaves (adaxial surface) of 14-days old plants were manually sprayed with 5 ml of spore suspensions before being covered with a plastic bag for 24 h to maintain humidity. The quantity of inoculum on leaves was estimated at 5.9 μl/cm2 (S.E. = 0.6), obtained by measuring the surface of 20 P. vulgaris leaves using a Delta-T Leaf Area Meter Mk 2 (Delta-T Devices Ltd., Cambridge, UK) and obtaining the weight of spore suspension on the leaves. No additional chemical insecticides or acaricides were applied during the experiments.

Assessment of endophytic growth

Sterilization method

Seven days post-inoculation, the endophytic growth of B. bassiana was evaluated in P. vulgaris plant tissues (leaf, root, stem). To ascertain the internal development of B. bassiana within the plant tissues, thorough surface sterilization was performed as follows: plant tissues were first washed with 0.1% Tween solution for 3 min to break hydrophobic bonds between conidia and plant cells [15]. Afterward, the plant tissues were submerged in 96% ethanol and 1% sodium hypochlorite for 10 s and 3 min respectively before rinsing in sterile water. The sterilizing process was repeated 3 times to remove any viable fungal epiphytes from the external surfaces. To ensure the success of the sterilization method, a pilot study was priorly conducted that consists of subjecting fungal cells directly to the sterilization procedure and confirming the total unviability of the cells. To re-confirm the sterilization process efficacy, aliquots from the final rinse step and surface sterilized tissues were inoculated onto PDA Petri dishes and observed for microbial contamination.

Endophytic growth detection by re-isolation

The endophytic growth was assessed according to the method described by Posada et al. [44]. In brief, surface-sterilized plant tissues were dried on sterile towels, then dissected using a sterile scalpel into 5 mm fragments. The tissues were directly inoculated on top of PDA Petri dishes (amended with 0.5 g/L streptomycin) cultured at 27 °C for 14 days. Five plants were randomly chosen from each of the 5 compartments within a greenhouse (25 bean plants/greenhouse) making a total of 75 plants for 3 biological replicates (3 different greenhouses in 3 different testing time points). Three fragments were dissected from each plant part (leaves, root, and stem) making it a total of 9 fragments from each plant,therefore, 675 plant tissue samples (225 leaves, roots, and stem) were evaluated. The endophytic growth was assessed on every sample based on the presence or absence of fungal cultures (number of colonized fragments).

Detection of fungal DNA

The endophytic growth was also confirmed using molecular detection according to the method described by Rehner et al. [45]. In brief, plant tissues (100 mg), selected as described above, were ground under liquid nitrogen and the DNA of the mixture was extracted using DNeasy kit (QIAGEN, GmbH, Hilden, Germany) following the manufacturer’s instructions. The internal transcribed spacer (ITS) were amplified on a thermocycler (CFX96 Real-Time System, BIO-RAD, USA) using the primers pairs ITS1F (5′ CTTGGTCATTTAGAGGAAGTAA 3′) [46] ITS4 (5′TCCTCCGCTTATTGATATGC 3′) [47] and BB.fw (5′ GAACCTACCTATCGTTGCTTC 3′) BB.rv (5′ ATTCGAGGTCAACGTTCAG 3′) [48] for the two-step nested PCR-approach. To check the success and specificity of the PCR, all amplicons were separated on gel electrophoresis (1.5% agarose) then purified using the QUIAquick PCR purification kit (QIAGEN, GmbH, Hilden, Germany) following the manufacturer's instructions. To determine the identity of the DNA, all purified amplicons were sequenced using the ABI3500 instrument.

Evaluation of the endophytic activity against two-spotted spider mite (TSSM)

The strain of T. urticae was originally collected from P. vulgaris and reared under laboratory conditions (25 °C, 16/8 h L:D) without exposure to chemical molecules. To limit the variation in susceptibility due to differences in activities associated with developmental stages, single-age populations of the mites were prepared as described by Chandler et al. [6]. After confirmation of the endophytic growth of B. bassiana, 30 mites belonging to each life stage (eggs, nymphs, adults) of the mite were inoculated on the adaxis of the first pair of 3-week-old P. vulgaris leaves using a fine brush. Five plants from each of the 5 compartments within a greenhouse were used (25 bean plants/greenhouse). This experiment was repeated in 3 biological replicates (3 different greenhouses) making it a total of 75 plants; thus, 2250 individuals of each developmental stage of the mite were tested for their mortalities till 7 days post-inoculation (DPI). The sampling of the infected mites was performed as described by Batta [49] with slight modifications. In brief, dead individuals were surface sterilized, and then transferred to PDA Petri dishes (amended with 0.5 g/L streptomycin) which were incubated at 27 °C to promote fungal growth. The sampling of the infected mites continued for 14 days after initial transfer into the Petri dishes. Additionally, the macroscopic and microscopic characteristics of fungal colonies were observed.

Genetic expression of endophyte B. bassiana

The expression analysis focused on eleven genes believed to play an essential role in key developmental stages of B. bassiana. The leaves of 14-days old plants were treated with 2 × 108 spore suspensions as described above. After 24 h, 30 motile stages (larvae and adults) of T. urticae were allowed to feed on the treated leaves of P. vulgaris.

The RNA extraction was performed on leaf fragments collected from plants at 0, 2- and 7-days post-inoculation of spore suspensions using Zymo Research, USA kit according to the manufacturer's instructions. Until further use, purified RNA was stored at − 80 °C. Two μg of purified RNA were transcribed, using BIORAD's kit, into cDNA using the manufacturer's instructions. SYBR® Green rt-PCR (real-time PCR) Sigma- Aldrich was used to obtain rt-PCR products. rt-PCR reactions were performed in a CFX96 Real-Time System (BIO-RAD) using the specific primer pairs (Table 1). The PCR reactions, including the cDNA dilutions and primer concentrations, were adjusted to obtain approximatively similar gene amplification efficiencies reactions were optimally set to master mix (25 μl) containing: 12.5 μl SYBR® Green rt-PCR (Sigma-Aldrich), 150 nM or 250 nM forward and reverse primers (Macrogen, Korea), and 2 μl of cDNA. PCR thermal conditions consisted of one cycle of 50 °C for 2 min, one cycle of 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The melting curve analysis (single peak) was considered as an indicator of the amplification specificity. Moreover, negative controls (no template) were run for each gene to detect primer dimerization and unspecific amplification. To minimize intra-experiments, the rt-PCR analysis was performed in triplicate (technical replicates), and the mean of 3 biological replicates (3 different plant tissue/cDNA samples in 3 different testing time points) was calculated for the gene expression analysis. The amplification efficacy for each primer set was calculated as E = 10[−1/slope]; slopes of standard curves were generated by plotting the log of cDNA versus Ct values acquired over a range of 10- fold dilution to the mother solution (Table 1). The average value collected at 0 days post-inoculation was considered as calibrator and average values collected at 2- and 7- days post-inoculation were considered as test values and time required for the entomopathogenic fungi penetration and endophytic growth respectively. The relative differences in the expression level of genes in different samples were calculated using the Livak and Schmittgen [50] method (2−ΔΔCq). Cyclophilin A was chosen as a reference gene (housekeeping gene) due to its expression stability in Beauveria spp. [51].

Table 1 PCR amplification primer sequence, amplicon size, and amplification efficiency
Full size table

Statistical analyses

The data obtained by the re-isolation, detection of fungal DNA experiment were statistically analyzed by one-way Analysis of Variance (ANOVA). The antagonist activity of EEPF/plant against T. urticae was analyzed by Kaplan Meier survival curves using SPSS (version 25) software. The statistical differences between data obtained with each treatment and the control for each experiment were measured by the Log-rank test expressed by Chi-2 results and P-values. The data obtained by rt-PCR was analyzed by two-way ANOVA (days post-inoculation and presence/absence of T. urticae) using SPSS Statistics for Windows, version 25.0 (SPSS Inc., Chicago, Ill., USA). The Tukey test was used at the 5% threshold for the separation of means.

Results

Evaluation of endophytic growth by re-isolation

The endophytic growth of B. bassiana in P. vulgaris plant tissues tested positive. The fungal development detected from dishes inoculated with various plant tissues (leaf = 48.4 ± 1.9%; stem = 32.4 ± 2%; root = 3.96 ± 0.7%) was significantly different (F = 153.461 df = 2, P < 0.05). No B. bassiana endophytic growth was detected within any tissue of the control plants.

Detection of fungal DNA

The ITS of entomopathogenic fungi was considered as evidence of endophytic growth. The amplification of fungal DNA detected from the treatment plant tissue extracts (leaf = 27.06 ± 4.9%; stem = 15.06 ± 1.9; root = 0 ± 0%) was also significantly different (F = 19.61 df = 2, P < 0.05). No amplification was detected from the control plant tissue extracts. The amount of fungal DNA at the different plant tissues can be put into the following order according to their cycle threshold values (cycles ± S.E.): root (no DNA amplification) < stem (Ct = 34.92 ± 0.2) < leaf (Ct = 36.34 ± 0). The same melting temperature was recorded in this study indicating a specific and unique amplification. After conducting sequence alignment, the amplicon revealed to be 100% identical with the previously described ITS of B. bassiana LTB01 strain (accession number: DQ984676) [54].

Pathogenicity of EEPF colonized P. vulgaris against all developmental stages of T. urticae

The activity of Beauveria, when present as endophyte within the tissues of P. vulgaris, was daily observed on the survival (adults and nymphs) and the hatching (eggs) of T. urticae for 7 DPIDPI. Significantly high, moderate, and low effects were observed against the adults (χ2 = 818.354; df = 1; P < 0.0001), nymphs (χ2 = 345.766; df = 1; P < 0.0001) and eggs (χ2 = 173.496; df = 1; P < 0.0001) of T. urticae respectively (Fig. 1). The antagonistic activity of EEPF/plant against the different developmental, based on their chi-square value, can be put into the following order: adults > nymphs > eggs; therefore, the survival capacity seems to be relative to the developmental stage of the mite. Furthermore, the mycosis percentage recorded in this study was 3.7 (± 0.2), 2.9 (± 0.1), and 0 (± 0) % for the adults, nymphs, and eggs of T. urticae respectively.

Fig. 1
figure 1

Curves representing survival (of a adults and b nymphs) and hatching (of c eggs) of T. urticae reared on P. vulgaris colonized with the EEPF B. bassiana. Observed survivals and hatchings are presented using curves with markers; circle: Treatment (T. urticae reared on EEPF-colonized P. vulgaris); triangle: control (T. urticae reared on the P. vulgaris)

Full size image

Expression analysis of genes involved in the growth of B. bassiana

The amplification conditions were optimized for each gene. The melting temperatures were unique for each gene indicating specific amplification for the target genes. The amplification efficacies were evaluated for each primer set and they varied between 98.2 and 102.2% indicating good reaction conditions (Table 1).

Genes encoding for degrading enzymes

The Cdep1 gene, responsible for encoding a subtilisin protease, was significantly induced at 2- and 7-DPI (F = 1178, df = 2, P < 0.05). A significant increase of 11.1- fold change was recorded at 2 DPI when compared to the calibrator; afterward, an increase of 2.07- fold change was recorded at 7 DPI with no significant difference when compared to the calibrator. The presence of the TSSM showed an effect only at 7 DPI where a significant induction (6.8 fold change) was recorded (F = 82.022, df = 1, P < 0.05) (Fig. 2).

Fig. 2
figure 2

Fold expression levels (± S.E.) of Cdep1, Cyp5337A1, Bbchit1, BBA_08728, Hyd1, Hyd2,BbCHS, BbFKS, Bbbeas, Bbbsls, and Bbhog1 genes of B. bassiana at 0-, 2-, and 7- days post inoculation in P. vulgaris in the presence or absence of T. urticae. Means followed by distinct letters within each gene differ by the Tukey test at the 5% probability level

Full size image

The Bbchit1 gene, responsible for encoding a chitinase, was significantly induced at 7-DPI (F = 410.005, df = 2, P < 0.05) during the presence of the herbivore (F = 437.270, df = 1, P < 0.05).

The Cyp5337A1 gene, responsible for encoding a fatty acid hydroxylase, was always significantly induced post-inoculation (F = 71.941, df = 2, P < 0.05). At 2 days post-inoculation, the expression was significantly increased (7.2- fold change) when compared to the calibrator. At 7 days post-inoculation, the expression was increased (1.5- fold change) with no significant difference when compared to the calibrator (Fig. 2). Here, the effect of the TSSM was not notable at 2- and 7- DPI. (F = 0, df = 1, P > 0.05).

Genes encoding for hydrophobins

The hydrophobin coding genes Hyd1 (F = 146.749, df = 2, P < 0.05) and Hyd2 (F = 141.408, df = 2, P < 0.05) were only significantly induced at 7- days post-inoculation when compared to the calibrator (Fig. 2). No significant difference was recorded to the Hyd1 (F = 0.259, df = 1, P > 0.05) and Hyd2 (F = 0.123, df = 1, P > 0.05) gene expression after the inoculation of the TSSM (Fig. 2).

Genes encoding for cell wall components

The genes BbCHS (F = 107.407, df = 2, P < 0.05) and BbFKS (F = 350.028, df = 2, P < 0.05) involved in the synthesis of chitin and glucan, respectively were significantly induced at 7- days post inoculation relative to the calibrator (Fig. 2). The presence of the herbivor has no significant effect on the expression of BbCHS (F = 0.001, df = 1, P > 0.05) and BbFKS (F = 0.364, df = 1, P > 0.05).

Genes encoding for secondary metabolites

Significantly different induction levels of the beauvericin coding gene Bbbeas were recorded at different timings of the essay (F = 186.603, df = 2, P < 0.05). The recorded fold changes in the expression were 3.9 and 1.1 at 2- and 7- days post-inoculation respectively. Similarly, significantly induction levels of the bassianolide coding gene Bbbsls were recorded at 2 and 7 days post-inoculation (F = 48.062, df = 1, P < 0.05). The recorded fold changes in the expression were 2.1 and 1.1 at 2- and 7- days post-inoculation respectively. The presence of the herbivore did not show any significant difference on the expression levels of Bbbeas (F = 0, df = 1, P > 0.05) and Bbbsls (F = 0.436, df = 1, P > 0.05) (Fig. 2).

Gene encoding for sugar transporter

The BBA_08728 gene responsible for the expression of the sugar transporters was induced at 2- and 7- days post-inoculation with a significant difference (F = 357.709, df = 2, P < 0.05). An increase of 2.2- fold change was recorded at 2 days post-inoculation; afterward, a significant increase of 4.19 fold-change was recorded at 7 days post-inoculation (Fig. 2). The presence of herbivore resulted in a significant (F = 77.291, df = 1, P < 0.05) induction of the gene (8.95- fold increase) at 7DPI (Fig. 2).

Gene encoding for high osmolarity glycerol

The mitogen-activated protein kinase-encoding gene, Bbhog1, was significantly induced at all times of the experiment (F = 78.952, df = 2, P < 0.05). At 2- and 7- DPI, 8.67- and 4.59- fold increases were recorded, respectively, when compared to the calibrator. The presence of the herbivore did not show any effect on the expression (F = 0.189, df = 1, P > 0.05) (Fig. 2).

Discussion

Several authors reported the possibility of B. bassiana to dwell in different P. vulgaris tissues [55]. A study conducted by Afandhi et al. [26] confirmed that such colonization can enhance the growth of the common bean. In this present study, we have demonstrated the endophytic colonization of B. bassiana in different tissues (leaf, stem, and roots) of P. vulgaris via spraying of infective propagules. As indications, it was relied upon the fungal re-isolation as well as the detection of fungal DNA from surface-sterilized plant tissues (leaf, stem, and root) located farthest from the area of inoculation. Based on both detection methods the localization of (EEPF) is high, moderate, and low at the leaves, stem, and roots respectively. These results could be hypothesized by an vertical colonization of B. bassiana with the tissues of P. vulgaris. A study conducted by Parsa et al. [56] previously demonstrated the systemic vertical growth of B. bassiana in P. vulgaris; however, in this present study, the same was demonstrated, for the first time, using the molecular technique of fungal genomic detection. Several studies suggested that for the endophytic biological control strategy the best option will be to localize the EEPF onto lower parts of the P. vulgaris (e.g. seed soaking, soil/root drench); thus, allowing endophytic growth towards the uppermost of the host [21, 28, 57]. In this study, it was demonstrated that a foliar application of B. bassiana could also result in the internal colonization of the host. This goes in line with the results obtained from Wagner and Lewis [37] who confirmed and described the endophytic growth of B. bassiana within the internal tissues of Zea mays after inoculation with a foliar spray of conidia.

Our findings also revealed that the colonization rates of Beauveria spp. can be relative to the detection method (cultivation-dependant method > cultivation-independent method). Such risk of error has been previously discussed by McKinnon et al. [57]. It is hypothesized that the low concentration of the fungal DNA within the teated plant extracts may lead to amplification failure. In addition, Healey et al. [58] related PCR inhibition to the presence of plant secondary metabolites. Therefore, to ensure accurate results it would be best to adapt several techniques for the detection of fungal endophytism.

It was notable that most of the studies evaluated the insecticidal effect of EEPF with no differentiation of the herbivore life stage. The present study demonstrated that the EEPF activity caused high, moderate, and low mortality rates against adults, nymphs, and eggs of T. urticae respectively. These results are in accordance with those obtained from Al Khoury et al. [59] who observed similar mortality rates within the different developmental stages of T. urticae after inundative application of B. bassiana aerial conidia. However, the endophytic approach of entomopathogenic fungi may have an advantage relative to the conventional inundative application of different types of infective propagules. A study conducted by Tehri et al. [60] revealed that inadequate environmental conditions are considered the principal limitation and concern during biological control with B. bassiana. It is hypothesized that the endophytic fungal growth within the internal tissues of the host plant will minimize their exposure to abiotic factors; thus, enhancing their survival capacity. Moreover, the mycosis percentages obtained in this study are extremely low when compared to those attained after inundative application of B. bassiana [59, 61]. The localization of endophytic B. bassiana within the parenchymal cells of the host has been previously demonstrated [37, 62, 63]. The feeding behavior of the TSSM consists of withdrawing the plant cellular content via their stylet, including the parenchyma-localized fungal cells [64]. Infections caused by conidial ingestion have been previously reported [12, 65]. As far as we are aware, studies demonstrating that the ingestion of B. bassiana colonized plant tissue results in mycosis are not available in the literature. A study conducted by Mannino et al. [66] hypothesized that the host microbiota could inhibit the entomopathogenic fungal growth following per os infection. Taken together, these findings provide additional support to the hypothesis that the endophytic colonization of B. bassiana per se is not responsible for the antagonistic activity; nevertheless, the fungal growth may be indirectly involved in the reduction of herbivore damage.

The knowledge gap regarding the tri-trophic interaction between EEPF-plant–herbivore is notable. Through rt-PCR, a series of genes involved in the development and growth of B. bassiana were analyzed for their expression during endophytic colonization within P. vulgaris in the presence or absence of T. urticae.

The expression of degrading enzyme genes Cdep1 and Cyp5337A1 (excluding Bbchit1) was found to increase at 2 DPI suggesting that B. bassiana utilizes some depolymerases for the penetration of the plant tissues. Thus, it is suggested that EEPF invasion is not limited to the natural opening (e.g. stomata) but it could also occur via degradation holes. These results are in accordance with those from Wagner and Lewis [37], who described the penetration process of Z. mays by B. bassiana. On the contrary to arthropods, the induction of chitinases may not be necessary for the penetration of the plant leaf tissues. This may be hypothesized by the fact that chitin is not found in the plant cell walls [67]. Afterward, the expression of the depolymerases genes was repressed during the development of the fungi (7 DPI). This could be hypothesized by the fact that the endophytic growth of EEPF does not harm the plant host,thus, the former can acquire the needed nutrients for development in a non-conventional approach. Interestingly, after the introduction of the herbivore, the cuticle degrading enzymes were significantly induced at 7 DPI. Therefore, it can be speculated that the EEPF may induce various depolymerases targeting the cuticle of arthropods in order to transfer insect-derived nutrients to their plant host. This assumption ties well with the results from Behie et al. [35] who demonstrated that the endophytism and arthropod parasitism of Metarhizim robertsii are combined so that the fungus functions as a channel to provide insect-derived nutrients to plant hosts.

To further explain the nutrient exchanges between all parties, we have analyzed the expression of the gene encoding sugar transporters. As might have been expected, a limited expression was recorded at 2 DPI (penetration phase) since the fungus may obtain the required nutrients directly from the lysed plant tissue. However, after the internal colonization of the plant tissues, a significant induction of the gene was recorded. This is in complete agreement with results obtained by Behie et al. [68] who demonstrated that the host plant provides photosynthate to EEPF. Remarkably, the presence of the herbivore results in a significant fold increase in the sugar transporter-encoding gene. The correlation between the levels of insect-derived nitrogen and the plant-derived carbon is noteworthy. As it seems, after translocating the nitrogen from the arthropod to the plant, the fungus increased its carbon uptake from the plant host. A "fair" nutrient trade is established during this mutualistic association.

The remarkable observation to emerge is the induction of Hyd1 and Hyd2 expression during different timings of the essay. Despite the fact that Branine et al. [69] discussed the similar mechanisms adapted by EEPF to infect both plants and insect hosts, our results suggest a different post-penetration infection strategy between endophytism and parasitism. A study conducted by Holder et al. [70] showed that once the entomopathogenic fungi reach the hemocoel, blastospores (yeast-like cells) are produced and disseminated throughout the arthropod. Unexpectedly, the analysis did not show any dimorphic transition of the fungi during the post-penetration events during the presence and absence of the herbivore.

The mechanism underlying this novel role of EEPF as plant bodyguards remains unknown. Vidal and Jaber [28] suggested that the antagonistic activity against herbivorous pests may be due to changes in the metabolism of the host plant. It is hypothesized that ligands (chitin and glucans) present on the cell wall of B. bassiana, known as pathogen-associated molecular patterns (PAMPs), can be recognized by the host immune system [13]. A study conducted by Pieterse et al. [71] revealed that such antigens are able to trigger the induced system resistance (ISR) for enhanced defenses. Results in this study showed that synthesis of PMAPs is significantly induced during the post-penetration events,therefore, it may be that the plant pattern recognition is translated into ISR. This result ties well with the previous study of Jaber and Ownley [29] who suggested that the endophytic growth can initiate the ISR and result in the secretion of compounds with insecticidal activities.

Furthermore, contrary to the earlier research that indicates secondary metabolite production by Beauveria spp. after breaching the arthropod surface [72], this study suggests the non-involvement of the secondary metabolites (beauvericin and bassianolide) post-penetration of plant tissues by the EEPF. It may be suggested that host plants initially identify the EEPF as possible pathogens,thus, the former activate their immune system and the latter produce the secondary metabolites to overpower it. Afterward, the beneficial endophytic growth will be established and the EEPF will be recognized as a mutualist by its host. This is in good agreement with previous findings of Barelli et al. [73] indicating that EEPF-plant relation is mediated by diffusible communication molecules, as in other plant-mutualistic fungi, indicating they are not pathogens. This is consistent with what has been found in a review conducted by Zimmermann [74] who argued that the secondary metabolites found in plants and food are mostly produced by Fusarium spp. The mammal toxicity of secondary metabolites such as beauvericin has been previously discussed [75], therefore, the present result may overcome a major hurdle in the consideration of EEPF for potential biocontrol applications. However, it is important to note that our findings are based on the work on P. vulgaris plants grown in sterile conditions, the expression of the Bbbeas and Bbbsls genes may be significantly different under the natural conditions as Beauveria spp. can produce secondary metabolites to prevent microbial competition for limited nutrients.

A further novel finding is the repression of BBhog1 gene implicated in the stress management of B. bassiana in planta (7 DPI) when compared to that obtained in natura (0- and 2- DPI). This finding is directly in line with those from Mascarin and Jaronski [76], who indicated that the endophytic growth of B. bassiana provides protection from abiotic stresses. Knowing that inconvenient environmental conditions are considered the first limitation during the inundative application of B. bassiana [58], it is believed that the internal colonization of EEPF would transcend this major obstacle leading towards a more persistent and cost-effective biocontrol agent.

Conclusion

This study presented the first evidence of the possibility of B. bassiana to grow within P. vulgaris with preferential tissue colonization. The internal growth of EEPF was most favorable within the leaves followed by the stem and roots of P. vulgaris. Furthermore, it is clarified that the report of endophytes is method dependent; therefore, advanced studies should investigate the EEPF-plant relationship using different methodologies (infection, detection methods, etc.). In addition, this is the first analysis of genes involved in the endophytic colonization of B. bassiana in planta. This insight into the endophytic growth of EEPF would enhance the engineering and production of a more efficient endophytic biocontrol agent. A transcriptome analysis would reveal the biological pathways for the mutualism relationship. Nevertheless, this work has allowed us to conclude that EEPF adopt different mechanisms relative to its intended host.